Dataset for CDS LMW5-HL of organism African swine fever virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A9JKY0_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JLP1_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D0Q0E8_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
P42485_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A0A0C5AZD3_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
Q07819_LMW5HL-01        atggagggagaagagctaatatatcataatatcattaatgaaatactcgt
                        *************** * ***************************** **

A9JKY0_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JLP1_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D0Q0E8_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
P42485_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A0A0C5AZD3_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
Q07819_LMW5HL-01        ggggtatattaaatattacatgaatgatatttcagagcatgaacttagcc
                        *** ***************** ******************** *******

A9JKY0_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JLP1_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D0Q0E8_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
P42485_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A0A0C5AZD3_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
Q07819_LMW5HL-01        cgtaccagcaacaaattaaaaaaattttaacctattatgacgaatgtttg
                        * ** ** ******** *********************** ** ******

A9JKY0_LMW5HL-01        aacaaacaggttataattaccttttctcttacgagtgtccaagaaattaa
A9JLP1_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D0Q0E8_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
P42485_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
A0A0C5AZD3_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
Q07819_LMW5HL-01        aacaaacaggttaccattaccttttctcttacgaatgcccaagaaattaa
                        ***** *******  ******************* ** ************

A9JKY0_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JLP1_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D0Q0E8_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
P42485_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A0A0C5AZD3_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
Q07819_LMW5HL-01        aacccagtttactggggttgtgactgagttgtttaaggatcttatcaact
                        ************** ************* *********************

A9JKY0_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JLP1_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D0Q0E8_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
P42485_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A0A0C5AZD3_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
Q07819_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtat
                        ************************************ ************ 

A9JKY0_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JLP1_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D0Q0E8_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
P42485_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A0A0C5AZD3_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
Q07819_LMW5HL-01        tgcaaagatgccaataaccatctggagtccacggtgatcactacggcata
                        ******** ***** ***********************************

A9JKY0_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JLP1_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D0Q0E8_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
P42485_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A0C5AZD3_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
Q07819_LMW5HL-01        caacttcatgaaacacaacctactaccatggatgatttcccacggcggtc
                        *************************** **********************

A9JKY0_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JLP1_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D0Q0E8_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
P42485_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A0A0C5AZD3_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
Q07819_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
                        ************************************* ************

A9JKY0_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JLP1_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D0Q0E8_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
P42485_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A0A0C5AZD3_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
Q07819_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
                        *********************************************** **

A9JKY0_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JLP1_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D0Q0E8_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
P42485_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A0A0C5AZD3_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
Q07819_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
                        ************ *********************** ***

© 1998-2019