Dataset for CDS adenoviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

223 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      ---atgaagaggcctgtggctgcagaagtccaa-----------------
A0A1W5PVU4_E1B19K-      atgatgaagaggcctgtggctgcagaagtccaa-----------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      atgggaagtgagagcacatctgccttg-----------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIL0_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIC5_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AI40_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AII9_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIN5_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIU0_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIS9_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
A0A2H5AIT6_E1B19K-      atgggaagtgagagcacagctgcctta-----------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      atgattaactgctgtgaactttggttgtttattcaaagggtattacctgg
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        atgattaacggctgtgaactttggttgtttattcaaaggggattacctgg
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
F2WTM9_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
A0A1C8EG46_E1B19K-      atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAN8_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAS0_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAV3_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAY5_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      ---------------------------atgactcatgggcggggcttagt
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        ---------------------------atgactcatgggcgtggcttagt
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      gaggtataaagggagcggctttcaggctagaggcatttacccactagccg
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        gaggtataaagggagcggctttcaggctagaggcatttacccactagccg
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        gaggtataaagggagcggccgtggggttggggcatttcacc---------
F2WTM9_E1B19K-01        gaggtataaagggagcggccgtggggttggggcatttcacc---------
A0A1C8EG46_E1B19K-      gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        gaggtataaagggagtggtggtgaggttggggcatttcacc---------
H9AAN8_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAS0_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAV3_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAY5_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      cctatataagtggcaacacctgggcacttgggcacagaccttcagggagt
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        cctatataagtggcaacacctgggcactggggcacagaccttcagggagt
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        cctatataagtggcaacacctgggcactcgggcacagaccttcagggagt
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        cctatataagtggcaacacctgggcactggggcacagaccttcaggaagt
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        tctatataagtggcaacacctgggcacttgggcacagaccttcagggagt
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      -----atggat-----------------cttgacagggtgttggagaatt
A0A0M3TH18_E1B19K-      -----atggag-----------------cttgacaggctgttagagaatt
A0A1W5PVU4_E1B19K-      -----atggag-----------------cttgacaggctgttagagaatt
Q6QPF3_E1B19K-01        -----atggag-----------------atctggactgtcttggaagact
Q6QPB7_E1B19K-01        -----atggag-----------------atctggacggtcttggaagact
Q6QPI9_E1B19K-01        -----atggag-----------------atctggacagtcttggaagact
G9G841_E1B19K-01        -----atggag-----------------atttggacgatcttggaagatc
Q2KSM8_E1B19K-02        -----atggag-----------------atttggacggtcttggaagact
Q2KSG6_E1B19K-01        -----atggag-----------------atttggacggtcttggaagact
Q2KSM8_E1B19K-01        -----atggag-----------------atttggacggtcttggaagact
A0A2L1F3A2_E1B19K-      -----atggag-----------------atttggacggtcttggaagact
A0A2R3WN16_E1B19K-      -----atggag-----------------atttggacggtcttggaagact
Q2KSG6_E1B19K-02        -----atggag-----------------atttggacggtcttggaagact
A0A2L1F392_E1B19K-      -----atggag-----------------atttggacggtcttggaagact
Q8UY91_E1B19K-01        -----atggag-----------------atttggacggtcttggaagact
P10406_E1B19K-01        -----atggag-----------------atttggacggttttggaagact
Q5GFC7_E1B19K-01        -----atggag-----------------atttggacggttttggaagact
A0A2R3WN62_E1B19K-      -----atggag-----------------atttggacggttttggaagact
Q5GFC8_E1B19K-01        -----atggag-----------------atttggacggttttggaagact
Q6H1D7_E1B19K-01        -----atggag-----------------atttggacggttttggaagact
T1UJX4_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
Q7T951_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
T1UE63_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
Q7T8D8_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
Q5UW22_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
Q8B8U7_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
C7SRS7_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
Q32UI6_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
J7H4R9_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
D2DM83_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
J7I6W7_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
W6EIX6_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
A0A1L7NRH1_E1B19K-      -----atggag-----------------gtttgggccattttggaagacc
Q3ZL02_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
T1UFS4_E1B19K-01        -----atggag-----------------gtttgggccattttggaagacc
T2CI10_E1B19K-01        -----atggag-----------------gtttgggccatcttggaagatc
A0A0K0PX35_E1B19K-      -----atggag-----------------gtttgggctatcttggaagacc
A0A0K0PX99_E1B19K-      -----atggag-----------------gtttgggctatcttggaagacc
Q3ZKW2_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
Q2KRU2_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
K7NG43_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
Q2KS85_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
A0A0B4SJH1_E1B19K-      -----atggag-----------------gtttgggctatcttggaagacc
A0A075IQ70_E1B19K-      -----atggag-----------------gtttgggctatcttggaagacc
T1UIP3_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
R4HLE1_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
Q5EY83_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
Q2Y0J3_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
J7ID56_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
I6LEP5_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
R4HLJ6_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
R4HLA0_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
Q2KSL3_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
I6LES1_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
T1UF50_E1B19K-01        -----atgaag-----------------gtttgggctatcttggaagacc
R4HMC6_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
I1V161_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
J7I6S4_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
A0A220VZ73_E1B19K-      -----atggag-----------------gtttgggctatcttggaagacc
P03248_E1B19K-02        -----atggag-----------------gtttgggctatcttggaagacc
Q6RK98_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
J7I6Q4_E1B19K-01        -----atggag-----------------gtttgggctatcttggaagacc
A0A1S6ELT2_E1B19K-      -----atggag-----------------ttttggagtgagctacaaagtt
F4ZCJ8_E1B19K-01        -----atggag-----------------ttttggagtgagctacaaagtt
B5SNR1_E1B19K-01        -----atggag-----------------ttttggagtgagctacaaagtt
P10544_E1B19K-01        -----atggag-----------------ttttggagtgagctacaaagtt
W0S1G8_E1B19K-01        -----atggag-----------------ttttggagtgagctacaaagtt
A0A142G3J2_E1B19K-      -----atggag-----------------ttgtggagtgagttacaaagtt
P10543_E1B19K-01        -----atggag-----------------ttgtggagtgagttacaaagtt
D3JIR7_E1B19K-01        -----atggag-----------------ttggaagctgtgctgcaaagtt
A0A076V686_E1B19K-      -----atggag-----------------ttggaagctgtgctgcaaagtt
P04492_E1B19K-01        -----atggag-----------------ttggaaactgtgctgcaaagtt
G1DE13_E1B19K-01        -----atggag-----------------ctagaagctgtgttgcaaagtt
D0Z5R9_E1B19K-01        -----atggag-----------------ctagaagctgtgttgcaaagtt
T1UEX7_E1B19K-01        -----atggag-----------------ctagaagctgtgttgcaaagtt
A0A2H5AI99_E1B19K-      -----atggat-----------------ctgttgaaagagctgagggatt
A0A0A1EUE4_E1B19K-      -----atggat-----------------ctgttggggaacttgcgggaat
A0MK43_E1B19K-01        -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AID8_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIL0_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIC5_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AI40_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AII9_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIN5_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIU0_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIS9_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
A0A2H5AIT6_E1B19K-      -----atggat-----------------ctcttggggaacttgagggaat
Q5C8R2_E1B19K-01        -----atggat-----------------ctgctaggagacctaagagaat
A0A2H5AI21_E1B19K-      -----atggat-----------------ctgctaggagacctgagagaat
A0A0M5L3Y4_E1B19K-      -----atggat-----------------ctgctaggagacctgagagaat
A0A0A1EUC8_E1B19K-      -----atggat-----------------ctgctaggagacctgagggaat
A0A2H5AI04_E1B19K-      -----atggat-----------------ctgctaggagacctgagggaat
A0A2H5AI72_E1B19K-      -----atggat-----------------ctgctaggagacctgagggaat
A0A2H5AIL3_E1B19K-      -----atggat-----------------ctgctaggagacctgagggaat
A0A0A1EUB2_E1B19K-      -----atggat-----------------ctgctaggagacctaagagaat
Q71BY5_E1B19K-01        -----atga-----------------------------------------
P06501_E1B19K-01        -----atggat-----------------ctccgaacggcgcttcagactt
A0A0M4N3Z1_E1B19K-      -----atggat-----------------ctccgaacggcgcttcagactt
Q8B6X5_E1B19K-01        -----atggat-----------------ctccgaacggcgcttcagactt
A0A0M4NHE0_E1B19K-      ccttcatggat-----------------ttgcgcgctgagttgcaaactt
H9AAD9_E1B19K-01        -----atggat-----------------ctgcgcgctgagctgcaaactt
H9AAK5_E1B19K-01        ccttcatggat-----------------ctgcgcgctgagctgcaaactt
H9AAH3_E1B19K-01        -----atggat-----------------ctgcgcgctgagctgcaaactt
F2WTJ7_E1B19K-01        -----atggat-----------------ctgcgagtggagctgcagactt
F2WTM9_E1B19K-01        -----atgaat-----------------ctgcgagtggagctgcagactt
A0A1C8EG46_E1B19K-      -----atggat-----------------ctgcgagtggagttgcagactt
H9AAA8_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcaaactt
H9AA76_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
H9AAN8_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
H9AAS0_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
H9AAV3_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
H9AAY5_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
M9YVA3_E1B19K-01        -----atggat-----------------ctgcgagtggagttgcagactt
M9YVF6_E1B19K-01        -----atggat-----------------ctcctaaggctgctcagcgatt
A0A0M3TH31_E1B19K-      -----atggat-----------------ctcctaaggctgctcagtgatt
M9YXY5_E1B19K-01        -----atggat-----------------ctcctaaggttgctcagtgatt
G0ZAH2_E1B19K-01        -----atggat-----------------ctcttgaagttcctggaagact
A0A1L3INW0_E1B19K-      -----atggac-----------------ttgtacaagagcttagaggatc
A0A2H4CJZ0_E1B19K-      -----atggag-----------------ttctggagtgagttgcagaact
H8PFZ1_E1B19K-01        -----atggag-----------------tactggagtgagctgcagaatt
F6KST6_E1B19K-01        -----atggac-----------------ttgtacgagagtttagagaatc
F2WTG5_E1B19K-01        -----atggac-----------------ttgtacgagagtctagagaatc
Q695T5_E1B19K-01        -----atggac-----------------ttgtacgagagcctagagaatc
H9TER0_E1B19K-01        -----atggac-----------------ttgtacgagagcctagagaatc
Q6WQ37_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
J9Z4N4_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
Q71BY5_E1B19K-02        -----atggag-----------------gcttgggagtgtttggaagatt
E1ARN8_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
P03246_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
Q6VGV8_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
A0A0G2R248_E1B19K-      -----atggag-----------------gcttgggagtgtttggaagatt
A0A291P1B2_E1B19K-      -----atggag-----------------acttgggagtgtttggaagatt
T1UG63_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
A0A1U9ALK7_E1B19K-      -----atggag-----------------gcttgggagtgtttggaagatt
P03247_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
J9Z5H0_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
J9Z4H6_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
A0A2H4PJ75_E1B19K-      -----atggag-----------------gcttgggagtgtttggaagatt
J7I6T8_E1B19K-01        -----atggag-----------------gcttgggagtgtttggaagatt
A0A384ZUF2_E1B19K-      -----atggagccaggacacccaactgagcaggggcta-catcctggact
A0A384ZUM9_E1B19K-      -----atggagccaggacacccaactgagcaggggcta-catcctggact
B9A5L5_E1B19K-01        -----atggat-----------------gtgtggagtattcttggggaat
T1UGY3_E1B19K-01        -----atggat-----------------gtgtggagtattcttggggaat
A0A1P7YYY5_E1B19K-      -----atggat-----------------gtgtggagtattcttggggaat
A0A1P7YWY2_E1B19K-      -----atggat-----------------gtgtggagtattcttggggaat
A0A1P7YWR9_E1B19K-      -----atggat-----------------gtgtggagtattcttggggaat
A0A1P7YXN8_E1B19K-      -----atggat-----------------gtgtggagtattcttggggaat
A0A1P8C849_E1B19K-      -----atggat-----------------gtgtggagtattcttggggaat
B9A5A7_E1B19K-01        -----atggat-----------------gtgtggagtattcttggggaat
T1UG22_E1B19K-01        -----atggat-----------------gtgtggagtattcttggggaat
M0QVG6_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
X4YVU5_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
M0QUS9_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
M0QU02_E1B19K-01        -----atggat-----------------gtgtggactatccttgcggact
A0A291B0H2_E1B19K-      -----atggat-----------------gtgtggactatccttggggact
M0QV87_E1B19K-01        -----atggat-----------------gtgtggactatccttggggatt
T1UKV6_E1B19K-01        -----atggat-----------------gtgtggactatccttggggatt
W8VNG2_E1B19K-01        -----atggag-----------------gtgtggactatccttggggact
F8UFP5_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
T1UGT5_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
T1UGX3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
W8CZB0_E1B19K-01        -----atggag-----------------gtgtggactatccttggagact
G3CK71_E1B19K-01        -----atggag-----------------gtgtggactatccttggagact
M0QTS5_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
M0QV08_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
G9JUV5_E1B19K-01        -----atggag-----------------gtgtggactatccttgcagact
G1FC01_E1B19K-01        -----atggag-----------------gtgtggactatccttggagact
A0A0G2UY10_E1B19K-      tcctgatggat-----------------gtgtggactatccttgcagact
A0A1J0MS84_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
M0QUJ3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
H0PPE7_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
T1UKP8_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
T1UHQ8_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
Q4KSL0_E1B19K-01        tcctgatggat-----------------gtgtggactatccttgcagact
T1UHG3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A384ZUF2_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
M0QUN2_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E1CIM6_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E1AI10_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
Q9YL99_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
K7ZLN6_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E1CIR1_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A1Y1BXT7_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
T1UHH6_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QVT4_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
T1ULJ8_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E9P585_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
D4N3H6_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
C4P207_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
T1ULP4_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A384ZUM9_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
X4Y9D2_E1B19K-01        tcctgatggat-----------------gtgtggactatccttgcagact
T1UHL7_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B9A5Q1_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QUB4_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QVK6_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A075TSZ1_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
F1DT57_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QUF3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E5RWD9_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
E5RWL1_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B6DU90_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B9A5T7_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B6C6W8_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B9A681_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A1Y1BYF1_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
T1UHZ2_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
B2VQE3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QU76_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
M0QVC7_E1B19K-01        tcctgatggat-----------------gtgtggactatccttgcagact
M0QU41_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
C5HDR2_E1B19K-01        tcctgatggat-----------------gtgtggactatccttgcagact
D3GBW3_E1B19K-01        -----atggat-----------------gtgtggactatccttgcagact
A0A097I4T0_E1B19K-      -----atggat-----------------gtgtggactatccttgcagact
T1UK99_E1B19K-01        -----atggag-----------------gtgtggactatccttggggact
G1FBW4_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
T1UKQ0_E1B19K-01        -----atggat-----------------gtgtggactatccttgcggact
M0QVP5_E1B19K-01        -----atggat-----------------gtgtggactatccttgcggact
H5T740_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
M0QUW8_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
E1CIJ0_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
T1UGU0_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact
M0QV47_E1B19K-01        -----atggag-----------------gtgtggactatccttgcggact

A0A097IW62_E1B19K-      a--caatagcttaa-----gaaaggttgta---------gaagaggc---
A0A0M3TH18_E1B19K-      a--taacagcttaa-----gaagggtttta---------gaagaggc---
A0A1W5PVU4_E1B19K-      a--taacagtttaa-----gaagggtttta---------gaagaggc---
Q6QPF3_E1B19K-01        t--tcaccagacta-----gacagttgcta---------gagaactc---
Q6QPB7_E1B19K-01        t--tcaccagacta-----gacagctgcta---------gagaactc---
Q6QPI9_E1B19K-01        t--tcaccagacta-----gacagctgcta---------gagaactc---
G9G841_E1B19K-01        t--tcacaagacta-----gacagctgcta---------gagaacgc---
Q2KSM8_E1B19K-02        t--ttacaagacta-----ggcagctgcta---------gagaacgc---
Q2KSG6_E1B19K-01        t--ttacaagacta-----ggcagctgcta---------gagaacgc---
Q2KSM8_E1B19K-01        t--ttacaagacta-----ggcagctgcta---------gagaacgc---
A0A2L1F3A2_E1B19K-      t--ttacaagacta-----ggcagctgcta---------gagaacgc---
A0A2R3WN16_E1B19K-      t--ttacaagacta-----ggcagctgcta---------gagaacgc---
Q2KSG6_E1B19K-02        t--ttacaagacta-----ggcagctgcta---------gagaacgc---
A0A2L1F392_E1B19K-      t--ttacaagacta-----ggcagctgcta---------gagaacgc---
Q8UY91_E1B19K-01        t--tcacaagacta-----gacagctgcta---------gagaacgc---
P10406_E1B19K-01        t--tcacaagacta-----ggcagctgcta---------gagaacgc---
Q5GFC7_E1B19K-01        t--tcacaagacta-----ggcagctgcta---------gagaacgc---
A0A2R3WN62_E1B19K-      t--tcacaagacta-----ggcagctgcta---------gagaacgc---
Q5GFC8_E1B19K-01        t--tcacaagacta-----ggcagctgcta---------gagaacgc---
Q6H1D7_E1B19K-01        t--tcacaagacta-----ggcagctgcta---------gagaacgc---
T1UJX4_E1B19K-01        t--taggaagacta-----ggcaactgttg---------gagaacgc---
Q7T951_E1B19K-01        t--taggaagacta-----ggcaactgtta---------gagagcgc---
T1UE63_E1B19K-01        t--taggaagacta-----ggcaactgtta---------gagagcgc---
Q7T8D8_E1B19K-01        t--taggaagacta-----ggcaactgtta---------gagaacgc---
Q5UW22_E1B19K-01        t--taggaagacta-----ggcaactgtta---------gagaacgc---
Q8B8U7_E1B19K-01        t--taggaagacta-----ggcaactgtta---------gagaacgc---
C7SRS7_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gagaacgc---
Q32UI6_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gagaacgc---
J7H4R9_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gagaacgc---
D2DM83_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gagaacgc---
J7I6W7_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gagaacgc---
W6EIX6_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gaggacgc---
A0A1L7NRH1_E1B19K-      t--tagaaagacta-----ggcaactgtta---------gaggacgc---
Q3ZL02_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gaggacgc---
T1UFS4_E1B19K-01        t--tagaaagacta-----ggcaactgtta---------gaggacgc---
T2CI10_E1B19K-01        t--taggcagacta-----ggcaactgcta---------gaaaacgc---
A0A0K0PX35_E1B19K-      t--tagacagacta-----ggctactgcta---------gaaaacgc---
A0A0K0PX99_E1B19K-      t--tagacagacta-----ggctactgcta---------gaaaacgc---
Q3ZKW2_E1B19K-01        t--gagacagacta-----ggctactgcta---------gaaaacgc---
Q2KRU2_E1B19K-01        t--gagacagacta-----ggctactgcta---------gaaaacgc---
K7NG43_E1B19K-01        t--gagacagacta-----ggctactgcta---------gaaaacgc---
Q2KS85_E1B19K-01        t--gagacagacta-----ggctactgcta---------gaaaacgc---
A0A0B4SJH1_E1B19K-      t--gaaacagacta-----ggctactgcta---------gaaaacgc---
A0A075IQ70_E1B19K-      t--gaaacagacta-----ggctactgcta---------gaaaacgc---
T1UIP3_E1B19K-01        t--gagacagacta-----ggctactgcta---------gaaaacgc---
R4HLE1_E1B19K-01        t--caggcagacta-----ggctactgcta---------gaaaacgc---
Q5EY83_E1B19K-01        t--cagacagacta-----ggctactacta---------gaaaacgc---
Q2Y0J3_E1B19K-01        t--cagacagacta-----agctactgcta---------gaaaacgc---
J7ID56_E1B19K-01        t--caaacagacta-----ggctactgcta---------gaaaacgc---
I6LEP5_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
R4HLJ6_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
R4HLA0_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
Q2KSL3_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
I6LES1_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
T1UF50_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
R4HMC6_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
I1V161_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
J7I6S4_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
A0A220VZ73_E1B19K-      t--cagacagacta-----ggctactgcta---------gaaaacgc---
P03248_E1B19K-02        t--cagacagacta-----ggctactgcta---------gaaaacgc---
Q6RK98_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
J7I6Q4_E1B19K-01        t--cagacagacta-----ggctactgcta---------gaaaacgc---
A0A1S6ELT2_E1B19K-      a--tcagagcctcc-----gacgcttgctg---------gagttggc---
F4ZCJ8_E1B19K-01        a--tcagagcctcc-----gacgcttgctg---------gagttggc---
B5SNR1_E1B19K-01        a--tcagagcctcc-----gacgcttgctg---------gagttggc---
P10544_E1B19K-01        a--tcagagcctcc-----gacgcttgctg---------gagttggc---
W0S1G8_E1B19K-01        a--tcagagcctcc-----gacgcttgctg---------gagttggc---
A0A142G3J2_E1B19K-      a--tcaaaacctcc-----gacgcttgctg---------gagttggc---
P10543_E1B19K-01        a--tcagaacctcc-----gacgcttgctg---------gagttggc---
D3JIR7_E1B19K-01        a--tcagggcgttc-----gtcagctctta---------cagtatac---
A0A076V686_E1B19K-      a--tcagagcattc-----gtcagctctta---------cagcatac---
P04492_E1B19K-01        t--tcagagcgttc-----gccagctcttg---------cagtatac---
G1DE13_E1B19K-01        t--tcagagcgttc-----gtcagcttctg---------cagtatac---
D0Z5R9_E1B19K-01        t--tcagagcgttc-----gtcagcttctg---------cagtatac---
T1UEX7_E1B19K-01        t--tcagagcgttc-----gtcagcttctg---------cagtatac---
A0A2H5AI99_E1B19K-      t--tgacgttgttc-----gccagttgctg---------gagtcggc---
A0A0A1EUE4_E1B19K-      t--tgacgtggttc-----gtcgcttgctg---------gagttggc---
A0MK43_E1B19K-01        t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AID8_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIL0_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIC5_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AI40_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AII9_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIN5_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIU0_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIS9_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
A0A2H5AIT6_E1B19K-      t--tgacgtggttc-----gccgcttgctg---------gagttggc---
Q5C8R2_E1B19K-01        t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A2H5AI21_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A0M5L3Y4_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A0A1EUC8_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A2H5AI04_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A2H5AI72_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A2H5AIL3_E1B19K-      t--tggcgtggttc-----ggcgcttgctg---------gagttggc---
A0A0A1EUB2_E1B19K-      t--tggcgtggttc-----ggcgcttgttg---------gagttggc---
Q71BY5_E1B19K-01        -------------------gacatattat---------------------
P06501_E1B19K-01        t--tgagagcaccc-----gccgcttgctg---------gagctctg---
A0A0M4N3Z1_E1B19K-      t--tgagagcaccc-----gccgcttgctg---------gagctctg---
Q8B6X5_E1B19K-01        t--tgagagcaccc-----gccgcttgctg---------gagctctg---
A0A0M4NHE0_E1B19K-      t--tgagagtaccc-----ggcgtttagta---------gagttgtg---
H9AAD9_E1B19K-01        t--tgagagtaccc-----ggcgtttagta---------gagttgtg---
H9AAK5_E1B19K-01        t--tgagagtaccc-----ggcgtttagta---------gagttgtg---
H9AAH3_E1B19K-01        t--tgagagtaccc-----ggcgtttagta---------gagttgtg---
F2WTJ7_E1B19K-01        t--tgagagtaccc-----ggtgcctgctg---------gagctgtg---
F2WTM9_E1B19K-01        t--tgagagtaccc-----ggtgcctgctg---------gagctgtg---
A0A1C8EG46_E1B19K-      t--tgagagtaccc-----ggtgcttgcta---------gagctgtg---
H9AAA8_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
H9AA76_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
H9AAN8_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
H9AAS0_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
H9AAV3_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
H9AAY5_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
M9YVA3_E1B19K-01        t--tgagagtaccc-----ggtgcttgctg---------gagctgtg---
M9YVF6_E1B19K-01        a--cgaggtgctgc-----gcaagttgctg---------gagacagc---
A0A0M3TH31_E1B19K-      a--cgaggtgctgc-----gcaagttgctg---------gagacagc---
M9YXY5_E1B19K-01        a--cgaggtgctgc-----gcaagttgctg---------gagacagc---
G0ZAH2_E1B19K-01        t--tgagaattgca-----gacaagttttg---------cagcaggc---
A0A1L3INW0_E1B19K-      g--cagcactttgc-----gacagctgctg---------gaggaggc---
A0A2H4CJZ0_E1B19K-      a--ccagagcctcc-----ggcacctgctg---------gagttggc---
H8PFZ1_E1B19K-01        a--ccagagcctcc-----ggcgcctgctg---------gagttggc---
F6KST6_E1B19K-01        t--tggctctttgc-----ggcgtttgcta---------gaggaggc---
F2WTG5_E1B19K-01        t--aagttctttgc-----gacgtctgctg---------gaggaggc---
Q695T5_E1B19K-01        t--aagttctttgc-----gacgtttgctg---------gaggaggc---
H9TER0_E1B19K-01        t--aagttctttgc-----gacgtttgctg---------gaggaggc---
Q6WQ37_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
J9Z4N4_E1B19K-01        tttctgctgtgcgtaacttgttg----------------gaacagag---
Q71BY5_E1B19K-02        tttctgctgtgcgtaacttgctg----------------gaacagag---
E1ARN8_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
P03246_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
Q6VGV8_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
A0A0G2R248_E1B19K-      tttctgctgtgcgtaacttgctg----------------gaacagag---
A0A291P1B2_E1B19K-      tttctgctgtgcgtaacttgctg----------------gaacagag---
T1UG63_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
A0A1U9ALK7_E1B19K-      tttctgctgtgcgtaacttgctg----------------gaacagag---
P03247_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
J9Z5H0_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
J9Z4H6_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
A0A2H4PJ75_E1B19K-      tttctgctgtgcgtaacttgctg----------------gaacagag---
J7I6T8_E1B19K-01        tttctgctgtgcgtaacttgctg----------------gaacagag---
A0A384ZUF2_E1B19K-      tcgcagccatgcacctgtggagggcctggatcaggcagcggggacagaga
A0A384ZUM9_E1B19K-      tcgcagccatgcacctgtggagggcctggatcaggcagcggggacagaga
B9A5L5_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
T1UGY3_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
A0A1P7YYY5_E1B19K-      t--taacaagacac-----gccggcttgtg---------gaggatag---
A0A1P7YWY2_E1B19K-      t--taacaagacac-----gccggcttgtg---------gaggatag---
A0A1P7YWR9_E1B19K-      t--taacaagacac-----gccggcttgtg---------gaggatag---
A0A1P7YXN8_E1B19K-      t--taacaagacac-----gccggcttgtg---------gaggatag---
A0A1P8C849_E1B19K-      t--taacaagacac-----gccggcttgtg---------gaggatag---
B9A5A7_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
T1UG22_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
M0QVG6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
X4YVU5_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QUS9_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
M0QU02_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
A0A291B0H2_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QV87_E1B19K-01        t--tgtcaagacac-----gccggcttgta---------gaggatag---
T1UKV6_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
W8VNG2_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
F8UFP5_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
T1UGT5_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
T1UGX3_E1B19K-01        t--tagccagacac-----gccggcttgta---------gaggatag---
W8CZB0_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
G3CK71_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
M0QTS5_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QV08_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
G9JUV5_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
G1FC01_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
A0A0G2UY10_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A1J0MS84_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QUJ3_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
H0PPE7_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UKP8_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UHQ8_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
Q4KSL0_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UHG3_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A384ZUF2_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QUN2_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
E1CIM6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
E1AI10_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
Q9YL99_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
K7ZLN6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
E1CIR1_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A1Y1BXT7_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UHH6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QVT4_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1ULJ8_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
E9P585_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
D4N3H6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
C4P207_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1ULP4_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A384ZUM9_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
X4Y9D2_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UHL7_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
B9A5Q1_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QUB4_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QVK6_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A075TSZ1_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
F1DT57_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QUF3_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
E5RWD9_E1B19K-01        t--tagcaagacac-----gccgacttgta---------gaggatag---
E5RWL1_E1B19K-01        t--tagcaagacac-----gccgacttgta---------gaggatag---
B6DU90_E1B19K-01        t--tagcaagacac-----gccgacttgta---------gaggatag---
B9A5T7_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
B6C6W8_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
B9A681_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A1Y1BYF1_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UHZ2_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
B2VQE3_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QU76_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QVC7_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
M0QU41_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
C5HDR2_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
D3GBW3_E1B19K-01        t--tagcaagacac-----gccggcttgta---------gaggatag---
A0A097I4T0_E1B19K-      t--tagcaagacac-----gccggcttgta---------gaggatag---
T1UK99_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
G1FBW4_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
T1UKQ0_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
M0QVP5_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
H5T740_E1B19K-01        t--taacaagacac-----gccggcttgta---------gaggatag---
M0QUW8_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
E1CIJ0_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
T1UGU0_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---
M0QV47_E1B19K-01        t--taacaagacac-----gccggcttgtg---------gaggatag---

A0A097IW62_E1B19K-      -------------------gtctgagcagacgtctgggtggt--------
A0A0M3TH18_E1B19K-      -------------------gtctgaagatacttcagtttggt--------
A0A1W5PVU4_E1B19K-      -------------------gtctgaggatacttcagtttggt--------
Q6QPF3_E1B19K-01        -------------------atcggagggagtctcttacctgt--------
Q6QPB7_E1B19K-01        -------------------atcggagggggtctcttacctgt--------
Q6QPI9_E1B19K-01        -------------------atcggagggagtctcttacctgt--------
G9G841_E1B19K-01        -------------------ctcgaacggagtctctcacctgt--------
Q2KSM8_E1B19K-02        -------------------ctcgaacggagtttcttacctgt--------
Q2KSG6_E1B19K-01        -------------------ctcgaacggagtttcttacctgt--------
Q2KSM8_E1B19K-01        -------------------ctcgaacggagtttcttacctgt--------
A0A2L1F3A2_E1B19K-      -------------------ctcgaacggagtttcttacctgt--------
A0A2R3WN16_E1B19K-      -------------------ctcgaacggagtttcttacctgt--------
Q2KSG6_E1B19K-02        -------------------ctcgaacggagtttcttacctgt--------
A0A2L1F392_E1B19K-      -------------------ctcgaacggagtttcttacctgt--------
Q8UY91_E1B19K-01        -------------------ctcgaacggagtctcttacctgt--------
P10406_E1B19K-01        -------------------ctcgaacggagtctctcacctgt--------
Q5GFC7_E1B19K-01        -------------------ctcgaacggagtctcttacctgt--------
A0A2R3WN62_E1B19K-      -------------------ctcgaacggagtctcttacctgt--------
Q5GFC8_E1B19K-01        -------------------ctcgaacggagtctcttacctgt--------
Q6H1D7_E1B19K-01        -------------------ctcgaacggagtctcttacctgt--------
T1UJX4_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
Q7T951_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
T1UE63_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
Q7T8D8_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
Q5UW22_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
Q8B8U7_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
C7SRS7_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
Q32UI6_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
J7H4R9_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
D2DM83_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
J7I6W7_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
W6EIX6_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
A0A1L7NRH1_E1B19K-      -------------------ttcggacggagtctccggttttt--------
Q3ZL02_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
T1UFS4_E1B19K-01        -------------------ttcggacggagtctccggttttt--------
T2CI10_E1B19K-01        -------------------ctcggacggagtctctggtcttt--------
A0A0K0PX35_E1B19K-      -------------------ctcggacggagtctctggccttt--------
A0A0K0PX99_E1B19K-      -------------------ctcggacggagtctctggccttt--------
Q3ZKW2_E1B19K-01        -------------------ctcggacggagtctctggctttt--------
Q2KRU2_E1B19K-01        -------------------ctcggacggagtctctggctttt--------
K7NG43_E1B19K-01        -------------------ctcggacggagtctctggctttt--------
Q2KS85_E1B19K-01        -------------------ctcggacggagtctctggctttt--------
A0A0B4SJH1_E1B19K-      -------------------ctcggacggagtctctggctttt--------
A0A075IQ70_E1B19K-      -------------------ctcggacggagtctctggctttt--------
T1UIP3_E1B19K-01        -------------------ctcggacggagtctctggctttt--------
R4HLE1_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
Q5EY83_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
Q2Y0J3_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
J7ID56_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
I6LEP5_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
R4HLJ6_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
R4HLA0_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
Q2KSL3_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
I6LES1_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
T1UF50_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
R4HMC6_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
I1V161_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
J7I6S4_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
A0A220VZ73_E1B19K-      -------------------ctcggacggagtctctggccttt--------
P03248_E1B19K-02        -------------------ctcggacggagtctctggccttt--------
Q6RK98_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
J7I6Q4_E1B19K-01        -------------------ctcggacggagtctctggccttt--------
A0A1S6ELT2_E1B19K-      -------------------ttctgccagaacttccagctgtt--------
F4ZCJ8_E1B19K-01        -------------------ttctgccagaacttccagctgtt--------
B5SNR1_E1B19K-01        -------------------ttctgccagaacttccagctgtt--------
P10544_E1B19K-01        -------------------ttctgccagaacttccagctgtt--------
W0S1G8_E1B19K-01        -------------------ttctgccagaacttccagctgtt--------
A0A142G3J2_E1B19K-      -------------------ttctgccagaacttccagctgtt--------
P10543_E1B19K-01        -------------------ttctgccagaacttccagctgtt--------
D3JIR7_E1B19K-01        -------------------ctctaaaaacacttcaggttttt--------
A0A076V686_E1B19K-      -------------------ctctagaaacacctcaggttttt--------
P04492_E1B19K-01        -------------------ctctaaaaacacttcaggttttt--------
G1DE13_E1B19K-01        -------------------ctctaaaaacacttcaggttttt--------
D0Z5R9_E1B19K-01        -------------------ctctaaaaacacttcaggttttt--------
T1UEX7_E1B19K-01        -------------------ctctaaaaacacttcaggttttt--------
A0A2H5AI99_E1B19K-      -------------------gtctgacaaaacttccaagtttt--------
A0A0A1EUE4_E1B19K-      -------------------ctccgacaaaacttccaggcttt--------
A0MK43_E1B19K-01        -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AID8_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIL0_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIC5_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AI40_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AII9_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIN5_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIU0_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIS9_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
A0A2H5AIT6_E1B19K-      -------------------ctctgacaaaacttccaggcttt--------
Q5C8R2_E1B19K-01        -------------------ctctgacagaacttccaagtttt--------
A0A2H5AI21_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A0M5L3Y4_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A0A1EUC8_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A2H5AI04_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A2H5AI72_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A2H5AIL3_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
A0A0A1EUB2_E1B19K-      -------------------ctctgacagaacttccaagtttt--------
Q71BY5_E1B19K-01        -------------------ttgccac------------------------
P06501_E1B19K-01        -------------------ttccaatagaacctcttttttgt--------
A0A0M4N3Z1_E1B19K-      -------------------ttccaatagaacctcttttttgt--------
Q8B6X5_E1B19K-01        -------------------ttccaatagaacctcttttttgt--------
A0A0M4NHE0_E1B19K-      -------------------ctccaacaggtcctcttggtttg--------
H9AAD9_E1B19K-01        -------------------ctccaacaggtcctcttggtttg--------
H9AAK5_E1B19K-01        -------------------ctccaacaggtcctcttggtttg--------
H9AAH3_E1B19K-01        -------------------ctccaacaggtcctcttggtttg--------
F2WTJ7_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
F2WTM9_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
A0A1C8EG46_E1B19K-      -------------------ctccaatcgagcctcttggtgga--------
H9AAA8_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
H9AA76_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
H9AAN8_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
H9AAS0_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
H9AAV3_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
H9AAY5_E1B19K-01        -------------------ctccaacagagcctcttggtgga--------
M9YVA3_E1B19K-01        -------------------ctccaacagagatccttggtgga--------
M9YVF6_E1B19K-01        -------------------ctgtgagaaaaatcgcagctgtt--------
A0A0M3TH31_E1B19K-      -------------------ctgtgagaaaacttccagctgtt--------
M9YXY5_E1B19K-01        -------------------ctgtgagaaaacttccagctgtt--------
G0ZAH2_E1B19K-01        -------------------gtccaagagga---ctgggggtt--------
A0A1L3INW0_E1B19K-      -------------------atccaactctacctcttactgct--------
A0A2H4CJZ0_E1B19K-      -------------------ctctgccagaacatccacctgct--------
H8PFZ1_E1B19K-01        -------------------ctctgccagaacatccacctgct--------
F6KST6_E1B19K-01        -------------------ttccgacagaacctcttactttt--------
F2WTG5_E1B19K-01        -------------------ttccgacagaacctcttacattt--------
Q695T5_E1B19K-01        -------------------ctccgacagaacctcttacattt--------
H9TER0_E1B19K-01        -------------------ctccgacagaacctcttacattt--------
Q6WQ37_E1B19K-01        -------------------ctctaacagtacctcttggttct--------
J9Z4N4_E1B19K-01        -------------------ctctaacagtacctcctggtttt--------
Q71BY5_E1B19K-02        -------------------ctctaacagtacctcctggtttt--------
E1ARN8_E1B19K-01        -------------------ctctaacagtacctcctggtttt--------
P03246_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
Q6VGV8_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
A0A0G2R248_E1B19K-      -------------------ctctaacagtacctcttggtttt--------
A0A291P1B2_E1B19K-      -------------------ctctaacagtacctcttggtttt--------
T1UG63_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
A0A1U9ALK7_E1B19K-      -------------------ctctaacagtacctcttggtttt--------
P03247_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
J9Z5H0_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
J9Z4H6_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
A0A2H4PJ75_E1B19K-      -------------------ctctaacagtacctcttggtttt--------
J7I6T8_E1B19K-01        -------------------ctctaacagtacctcttggtttt--------
A0A384ZUF2_E1B19K-      atcttgaattactggcttctacagccagcagctccggttcttcttcgtct
A0A384ZUM9_E1B19K-      atcttgagttactggcttctacagccagcagctccgggtcttcttcgtct
B9A5L5_E1B19K-01        -------------------ttcagacgggtgctccgggtttt--------
T1UGY3_E1B19K-01        -------------------ttcagacgggtgctccgggtttt--------
A0A1P7YYY5_E1B19K-      -------------------ttcagacgggtgctccgggtttt--------
A0A1P7YWY2_E1B19K-      -------------------ttcagacgggtgctccgggtttt--------
A0A1P7YWR9_E1B19K-      -------------------ttcagacgggtgctccgggtttt--------
A0A1P7YXN8_E1B19K-      -------------------ttcagacgggtgctccgggtttt--------
A0A1P8C849_E1B19K-      -------------------ttcagacgggtgctccgggtttt--------
B9A5A7_E1B19K-01        -------------------ttcagacgggtgctccgggtttt--------
T1UG22_E1B19K-01        -------------------ttcagacgggtgctccgggtttt--------
M0QVG6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
X4YVU5_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QUS9_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
M0QU02_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
A0A291B0H2_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
M0QV87_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1UKV6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
W8VNG2_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
F8UFP5_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1UGT5_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
T1UGX3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
W8CZB0_E1B19K-01        -------------------ttcagacgggtgctccgggtttt--------
G3CK71_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QTS5_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QV08_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
G9JUV5_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
G1FC01_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A0G2UY10_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
A0A1J0MS84_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
M0QUJ3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
H0PPE7_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1UKP8_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1UHQ8_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
Q4KSL0_E1B19K-01        -------------------ttcagacggatgctccgggttct--------
T1UHG3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A384ZUF2_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
M0QUN2_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E1CIM6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E1AI10_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
Q9YL99_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
K7ZLN6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E1CIR1_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A1Y1BXT7_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
T1UHH6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QVT4_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1ULJ8_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E9P585_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
D4N3H6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
C4P207_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1ULP4_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A384ZUM9_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
X4Y9D2_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
T1UHL7_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B9A5Q1_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QUB4_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QVK6_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A075TSZ1_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
F1DT57_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QUF3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E5RWD9_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
E5RWL1_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B6DU90_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B9A5T7_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B6C6W8_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B9A681_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A1Y1BYF1_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
T1UHZ2_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
B2VQE3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QU76_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QVC7_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
M0QU41_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
C5HDR2_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
D3GBW3_E1B19K-01        -------------------ttcagacgggtgctccgggttct--------
A0A097I4T0_E1B19K-      -------------------ttcagacgggtgctccgggttct--------
T1UK99_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
G1FBW4_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
T1UKQ0_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
M0QVP5_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
H5T740_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
M0QUW8_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
E1CIJ0_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
T1UGU0_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------
M0QV47_E1B19K-01        -------------------ttcagacgggtgctccggtttct--------

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      acacagacaaacatccatgttggaggaagaaatgaggcaggccatggacg
A0A384ZUM9_E1B19K-      acacagacaaacatccatgttggaggaagaaatgaggcaggccatggacg
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      ----------------------------------ggcgtaaact---ttt
A0A0M3TH18_E1B19K-      ----------------------------------ggcgcaagtt---gtt
A0A1W5PVU4_E1B19K-      ----------------------------------ggcgtaggct---gtt
Q6QPF3_E1B19K-01        ----------------------------------ggagattctg---ctt
Q6QPB7_E1B19K-01        ----------------------------------ggagattctg---ctt
Q6QPI9_E1B19K-01        ----------------------------------ggagattctg---ctt
G9G841_E1B19K-01        ----------------------------------ggagattctg---ctt
Q2KSM8_E1B19K-02        ----------------------------------ggagattttg---ctt
Q2KSG6_E1B19K-01        ----------------------------------ggagattttg---ctt
Q2KSM8_E1B19K-01        ----------------------------------ggagattttg---ctt
A0A2L1F3A2_E1B19K-      ----------------------------------ggagattttg---ctt
A0A2R3WN16_E1B19K-      ----------------------------------ggagattttg---ctt
Q2KSG6_E1B19K-02        ----------------------------------ggagattttg---ctt
A0A2L1F392_E1B19K-      ----------------------------------ggagattttg---ctt
Q8UY91_E1B19K-01        ----------------------------------ggagattctg---ctt
P10406_E1B19K-01        ----------------------------------ggagattctg---ctt
Q5GFC7_E1B19K-01        ----------------------------------ggagattctg---ctt
A0A2R3WN62_E1B19K-      ----------------------------------ggagattctg---ctt
Q5GFC8_E1B19K-01        ----------------------------------ggagattctg---ctt
Q6H1D7_E1B19K-01        ----------------------------------ggagattctg---ctt
T1UJX4_E1B19K-01        ----------------------------------ggagattctg---gtt
Q7T951_E1B19K-01        ----------------------------------ggagattctg---gtt
T1UE63_E1B19K-01        ----------------------------------ggagattctg---gtt
Q7T8D8_E1B19K-01        ----------------------------------ggagattctg---gtt
Q5UW22_E1B19K-01        ----------------------------------ggagattctg---gtt
Q8B8U7_E1B19K-01        ----------------------------------ggagattctg---gtt
C7SRS7_E1B19K-01        ----------------------------------ggagattctg---gtt
Q32UI6_E1B19K-01        ----------------------------------ggagattctg---gtt
J7H4R9_E1B19K-01        ----------------------------------ggagattctg---gtt
D2DM83_E1B19K-01        ----------------------------------ggagattctg---gtt
J7I6W7_E1B19K-01        ----------------------------------ggagattctg---gtt
W6EIX6_E1B19K-01        ----------------------------------ggagattctg---gtt
A0A1L7NRH1_E1B19K-      ----------------------------------ggagattctg---gtt
Q3ZL02_E1B19K-01        ----------------------------------ggagattctg---gtt
T1UFS4_E1B19K-01        ----------------------------------ggagattctg---gtt
T2CI10_E1B19K-01        ----------------------------------ggagattctg---gtt
A0A0K0PX35_E1B19K-      ----------------------------------ggagattctg---gtt
A0A0K0PX99_E1B19K-      ----------------------------------ggagattctg---gtt
Q3ZKW2_E1B19K-01        ----------------------------------ggagattctg---gtt
Q2KRU2_E1B19K-01        ----------------------------------ggagattctg---gtt
K7NG43_E1B19K-01        ----------------------------------ggagattctg---gtt
Q2KS85_E1B19K-01        ----------------------------------ggagattctg---gtt
A0A0B4SJH1_E1B19K-      ----------------------------------ggagattctg---gtt
A0A075IQ70_E1B19K-      ----------------------------------ggagattctg---gtt
T1UIP3_E1B19K-01        ----------------------------------ggagattctg---gtt
R4HLE1_E1B19K-01        ----------------------------------ggagattctg---gtt
Q5EY83_E1B19K-01        ----------------------------------ggagattctg---gtt
Q2Y0J3_E1B19K-01        ----------------------------------ggagattctg---gtt
J7ID56_E1B19K-01        ----------------------------------ggagattctg---gtt
I6LEP5_E1B19K-01        ----------------------------------ggagattctg---gtt
R4HLJ6_E1B19K-01        ----------------------------------ggagattctg---gtt
R4HLA0_E1B19K-01        ----------------------------------ggagattctg---gtt
Q2KSL3_E1B19K-01        ----------------------------------ggagattctg---gtt
I6LES1_E1B19K-01        ----------------------------------ggagattctg---gtt
T1UF50_E1B19K-01        ----------------------------------ggagattctg---gtt
R4HMC6_E1B19K-01        ----------------------------------ggagattctg---gtt
I1V161_E1B19K-01        ----------------------------------ggagattctg---gtt
J7I6S4_E1B19K-01        ----------------------------------ggagattctg---gtt
A0A220VZ73_E1B19K-      ----------------------------------ggagattctg---ctt
P03248_E1B19K-02        ----------------------------------ggagattctg---gtt
Q6RK98_E1B19K-01        ----------------------------------ggagattctg---gtt
J7I6Q4_E1B19K-01        ----------------------------------ggagattctg---gtt
A0A1S6ELT2_E1B19K-      ----------------------------------ggaggtttat---ttt
F4ZCJ8_E1B19K-01        ----------------------------------ggaggtttat---ttt
B5SNR1_E1B19K-01        ----------------------------------ggaggtttat---ttt
P10544_E1B19K-01        ----------------------------------ggaggtttat---ttt
W0S1G8_E1B19K-01        ----------------------------------ggaggtttat---ttt
A0A142G3J2_E1B19K-      ----------------------------------ggagaatcct---ttt
P10543_E1B19K-01        ----------------------------------ggagaatcct---ttt
D3JIR7_E1B19K-01        ----------------------------------ggagatatct---gtt
A0A076V686_E1B19K-      ----------------------------------ggagatatct---gtt
P04492_E1B19K-01        ----------------------------------ggaggtatct---gtt
G1DE13_E1B19K-01        ----------------------------------ggagatatct---gtt
D0Z5R9_E1B19K-01        ----------------------------------ggagatatct---gtt
T1UEX7_E1B19K-01        ----------------------------------ggagatatct---gtt
A0A2H5AI99_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A0A1EUE4_E1B19K-      ----------------------------------ggaggttttg---gtt
A0MK43_E1B19K-01        ----------------------------------ggaggttttg---gtt
A0A2H5AID8_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIL0_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIC5_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AI40_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AII9_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIN5_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIU0_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIS9_E1B19K-      ----------------------------------ggaggttttg---gtt
A0A2H5AIT6_E1B19K-      ----------------------------------ggaggttttg---gtt
Q5C8R2_E1B19K-01        ----------------------------------ggaggttttg---ttt
A0A2H5AI21_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A0M5L3Y4_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A0A1EUC8_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A2H5AI04_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A2H5AI72_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A2H5AIL3_E1B19K-      ----------------------------------ggaggttttg---ttt
A0A0A1EUB2_E1B19K-      ----------------------------------ggaggttttg---ttt
Q71BY5_E1B19K-01        ----------------------------------ggaggtgtta------
P06501_E1B19K-01        ----------------------------------ggaggtggtt---att
A0A0M4N3Z1_E1B19K-      ----------------------------------ggaggtggtt---att
Q8B6X5_E1B19K-01        ----------------------------------ggaggtggtt---att
A0A0M4NHE0_E1B19K-      ----------------------------------ggaggttcct---gtt
H9AAD9_E1B19K-01        ----------------------------------ggaggttcct---gtt
H9AAK5_E1B19K-01        ----------------------------------ggaggttcct---gtt
H9AAH3_E1B19K-01        ----------------------------------ggaggttcct---gtt
F2WTJ7_E1B19K-01        ----------------------------------agaggctttt---gtt
F2WTM9_E1B19K-01        ----------------------------------agaggctttt---gtt
A0A1C8EG46_E1B19K-      ----------------------------------aaaggctttt---gtt
H9AAA8_E1B19K-01        ----------------------------------aaaggctttt---gtt
H9AA76_E1B19K-01        ----------------------------------agaggctttt---gtt
H9AAN8_E1B19K-01        ----------------------------------agaggctttt---gtt
H9AAS0_E1B19K-01        ----------------------------------agaggctttt---gtt
H9AAV3_E1B19K-01        ----------------------------------agaggctttt---gtt
H9AAY5_E1B19K-01        ----------------------------------agaggctttt---gtt
M9YVA3_E1B19K-01        ----------------------------------agaggctttt---gtt
M9YVF6_E1B19K-01        ----------------------------------ggaggttttt---ctt
A0A0M3TH31_E1B19K-      ----------------------------------ggaggttttt---ctt
M9YXY5_E1B19K-01        ----------------------------------ggaggttttt---ctt
G0ZAH2_E1B19K-01        ----------------------------------ggagccgctggctgct
A0A1L3INW0_E1B19K-      ----------------------------------ggaggttttt---gtt
A0A2H4CJZ0_E1B19K-      ----------------------------------ggaggttctg---ttt
H8PFZ1_E1B19K-01        ----------------------------------ggaggttctg---ttt
F6KST6_E1B19K-01        ----------------------------------ggaggtttct---gtg
F2WTG5_E1B19K-01        ----------------------------------ggaggtttct---gtt
Q695T5_E1B19K-01        ----------------------------------ggaggtttct---gtt
H9TER0_E1B19K-01        ----------------------------------ggaggtttct---gtt
Q6WQ37_E1B19K-01        ----------------------------------ggaggtttct---gtg
J9Z4N4_E1B19K-01        ----------------------------------ggaggtttct---gtg
Q71BY5_E1B19K-02        ----------------------------------ggaggtttct---gtg
E1ARN8_E1B19K-01        ----------------------------------ggaggtttct---gtg
P03246_E1B19K-01        ----------------------------------ggaggtttct---gtg
Q6VGV8_E1B19K-01        ----------------------------------ggaggtttct---gtg
A0A0G2R248_E1B19K-      ----------------------------------ggaggtttct---gtg
A0A291P1B2_E1B19K-      ----------------------------------ggaggtttct---gtg
T1UG63_E1B19K-01        ----------------------------------ggaggtttct---gtg
A0A1U9ALK7_E1B19K-      ----------------------------------ggaggtttct---gtg
P03247_E1B19K-01        ----------------------------------ggaggtttct---gtg
J9Z5H0_E1B19K-01        ----------------------------------ggaggtttct---gtg
J9Z4H6_E1B19K-01        ----------------------------------ggaggtttct---gtg
A0A2H4PJ75_E1B19K-      ----------------------------------ggaggtttct---gtg
J7I6T8_E1B19K-01        ----------------------------------ggaggtttct---gtg
A0A384ZUF2_E1B19K-      agaacccgaggagcggcctggaccctccgtcggaagaggagctg---gat
A0A384ZUM9_E1B19K-      agaacccgaggagcggcctggaccctccgtcggaagaggagctg---gat
B9A5L5_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UGY3_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A1P7YYY5_E1B19K-      ----------------------------------ggagacactg---gtt
A0A1P7YWY2_E1B19K-      ----------------------------------ggagacactg---gtt
A0A1P7YWR9_E1B19K-      ----------------------------------ggagacactg---gtt
A0A1P7YXN8_E1B19K-      ----------------------------------ggagacactg---gtt
A0A1P8C849_E1B19K-      ----------------------------------ggagacactg---gtt
B9A5A7_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UG22_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QVG6_E1B19K-01        ----------------------------------ggagacactg---gtt
X4YVU5_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QUS9_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QU02_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A291B0H2_E1B19K-      ----------------------------------ggagacactg---gtt
M0QV87_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UKV6_E1B19K-01        ----------------------------------ggagacactg---gtt
W8VNG2_E1B19K-01        ----------------------------------ggagacactg---gtt
F8UFP5_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UGT5_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UGX3_E1B19K-01        ----------------------------------ggagacactg---gtt
W8CZB0_E1B19K-01        ----------------------------------ggagacactg---gtt
G3CK71_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QTS5_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QV08_E1B19K-01        ----------------------------------ggagacactg---gtt
G9JUV5_E1B19K-01        ----------------------------------ggagacactg---gtt
G1FC01_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A0G2UY10_E1B19K-      ----------------------------------ggagacactg---gtt
A0A1J0MS84_E1B19K-      ----------------------------------ggagacactg---gtt
M0QUJ3_E1B19K-01        ----------------------------------ggagacactg---gtt
H0PPE7_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UKP8_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UHQ8_E1B19K-01        ----------------------------------ggagacactg---gtt
Q4KSL0_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UHG3_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A384ZUF2_E1B19K-      ----------------------------------ggagacactg---gtt
M0QUN2_E1B19K-01        ----------------------------------ggagacactg---gtt
E1CIM6_E1B19K-01        ----------------------------------ggagacactg---gtt
E1AI10_E1B19K-01        ----------------------------------ggagacactg---gtt
Q9YL99_E1B19K-01        ----------------------------------ggagacactg---gtt
K7ZLN6_E1B19K-01        ----------------------------------ggagacactg---gtt
E1CIR1_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A1Y1BXT7_E1B19K-      ----------------------------------ggagacactg---gtt
T1UHH6_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QVT4_E1B19K-01        ----------------------------------ggagacactg---gtt
T1ULJ8_E1B19K-01        ----------------------------------ggagacactg---gtt
E9P585_E1B19K-01        ----------------------------------ggagacactg---gtt
D4N3H6_E1B19K-01        ----------------------------------ggagacactg---gtt
C4P207_E1B19K-01        ----------------------------------ggagacactg---gtt
T1ULP4_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A384ZUM9_E1B19K-      ----------------------------------ggagacactg---gtt
X4Y9D2_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UHL7_E1B19K-01        ----------------------------------ggagacactg---gtt
B9A5Q1_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QUB4_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QVK6_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A075TSZ1_E1B19K-      ----------------------------------ggagacactg---gtt
F1DT57_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QUF3_E1B19K-01        ----------------------------------ggagacactg---gtt
E5RWD9_E1B19K-01        ----------------------------------ggagacactg---gtt
E5RWL1_E1B19K-01        ----------------------------------ggagacactg---gtt
B6DU90_E1B19K-01        ----------------------------------ggagacactg---gtt
B9A5T7_E1B19K-01        ----------------------------------ggagacactg---gtt
B6C6W8_E1B19K-01        ----------------------------------ggagacactg---gtt
B9A681_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A1Y1BYF1_E1B19K-      ----------------------------------ggagacactg---gtt
T1UHZ2_E1B19K-01        ----------------------------------ggagacactg---gtt
B2VQE3_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QU76_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QVC7_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QU41_E1B19K-01        ----------------------------------ggagacactg---gtt
C5HDR2_E1B19K-01        ----------------------------------ggagacactg---gtt
D3GBW3_E1B19K-01        ----------------------------------ggagacactg---gtt
A0A097I4T0_E1B19K-      ----------------------------------ggagacactg---gtt
T1UK99_E1B19K-01        ----------------------------------ggagacactg---gtt
G1FBW4_E1B19K-01        ----------------------------------ggaggcactg---gtt
T1UKQ0_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QVP5_E1B19K-01        ----------------------------------ggagacactg---gtt
H5T740_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QUW8_E1B19K-01        ----------------------------------ggagacactg---gtt
E1CIJ0_E1B19K-01        ----------------------------------ggagacactg---gtt
T1UGU0_E1B19K-01        ----------------------------------ggagacactg---gtt
M0QV47_E1B19K-01        ----------------------------------ggagacactg---gtt

A0A097IW62_E1B19K-      tgggtgtaggttaagttgctt------------------ggtggtgcaa-
A0A0M3TH18_E1B19K-      tgggtgtagagttagtcagtt------------------agtagttcag-
A0A1W5PVU4_E1B19K-      tgggtgtagggttagtcagtt------------------agtagtgcag-
Q6QPF3_E1B19K-01        cggtgggcctctagctaagct------------------agtctatagg-
Q6QPB7_E1B19K-01        cggtgggcctctagctaagct------------------agtctatagg-
Q6QPI9_E1B19K-01        cggtgggcctctagctaagct------------------agtctatagg-
G9G841_E1B19K-01        cggtggcgacctagctaagct------------------agtctatagg-
Q2KSM8_E1B19K-02        cggtggcgacctagctaagct------------------agtctatagg-
Q2KSG6_E1B19K-01        cggtggcgacctagctaagct------------------agtctatagg-
Q2KSM8_E1B19K-01        cggtggcgacctagctaagct------------------agtctatagg-
A0A2L1F3A2_E1B19K-      cggtggcgacctagctaagct------------------agtctatagg-
A0A2R3WN16_E1B19K-      cggtggcgacctagctaagct------------------agtctatagg-
Q2KSG6_E1B19K-02        cggtggcgacctagctaagct------------------agtctatagg-
A0A2L1F392_E1B19K-      cggtggcgacctagctaagct------------------agtctatagg-
Q8UY91_E1B19K-01        cggtggcgacctagctaggct------------------agtctacagg-
P10406_E1B19K-01        cggcggtgacctagctaagct------------------agtctatagg-
Q5GFC7_E1B19K-01        cggcggtgacctagctaagct------------------agtctatagg-
A0A2R3WN62_E1B19K-      cggcggtgacctagctaagct------------------agtctatagg-
Q5GFC8_E1B19K-01        cggcggtgacctagctaagct------------------agtctatagg-
Q6H1D7_E1B19K-01        cggcggtgacctagctaagct------------------agtctatagg-
T1UJX4_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
Q7T951_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
T1UE63_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
Q7T8D8_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
Q5UW22_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
Q8B8U7_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
C7SRS7_E1B19K-01        cgctagtgaaatagctagggt------------------agtttttagg-
Q32UI6_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
J7H4R9_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
D2DM83_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
J7I6W7_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
W6EIX6_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
A0A1L7NRH1_E1B19K-      cgctagtgaattagctagggt------------------agtttttagg-
Q3ZL02_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
T1UFS4_E1B19K-01        cgctagtgaattagctagggt------------------agtttttagg-
T2CI10_E1B19K-01        cggtggtgatctggctagact------------------agtctttaga-
A0A0K0PX35_E1B19K-      cggtggtgatctagctaggct------------------agtctttagg-
A0A0K0PX99_E1B19K-      cggtggtgatctagctaggct------------------agtctttagg-
Q3ZKW2_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
Q2KRU2_E1B19K-01        cggtggcgatctagctaggct------------------agtgtttagg-
K7NG43_E1B19K-01        cggaggtgatctagctaggct------------------agtgtttagg-
Q2KS85_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
A0A0B4SJH1_E1B19K-      cggtggtgatctagctaggct------------------agtgtttagg-
A0A075IQ70_E1B19K-      cggtggtgatctagctaggct------------------agtgtttagg-
T1UIP3_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
R4HLE1_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
Q5EY83_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
Q2Y0J3_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
J7ID56_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
I6LEP5_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
R4HLJ6_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
R4HLA0_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
Q2KSL3_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
I6LES1_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
T1UF50_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
R4HMC6_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
I1V161_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
J7I6S4_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
A0A220VZ73_E1B19K-      cggtggtgatctagctaggct------------------agtgtttagg-
P03248_E1B19K-02        cggtggtgatctagctaggct------------------agtgtttagg-
Q6RK98_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
J7I6Q4_E1B19K-01        cggtggtgatctagctaggct------------------agtgtttagg-
A0A1S6ELT2_E1B19K-      tggttcaaccttaactaatgt------------------aatttataga-
F4ZCJ8_E1B19K-01        tggttcaaccttaactaatgt------------------aatttataga-
B5SNR1_E1B19K-01        tggttcaaccttaactaatgt------------------aatttataga-
P10544_E1B19K-01        tggttcaaccttaactaatgt------------------aatttataga-
W0S1G8_E1B19K-01        tggttcaaccttaactaatgt------------------aatttataga-
A0A142G3J2_E1B19K-      tggctcaactttagctaatgt------------------gatttataga-
P10543_E1B19K-01        tggctcaactttaactaatgt------------------aatctataga-
D3JIR7_E1B19K-01        tgggtctactttatgcaaagt------------------ggtacatagg-
A0A076V686_E1B19K-      tgggtctactttaagcaaagt------------------ggtacatagg-
P04492_E1B19K-01        tggctctaccttaagcaaggt------------------ggtaaatagg-
G1DE13_E1B19K-01        tggttctactttcagcaaggt------------------ggtacatagg-
D0Z5R9_E1B19K-01        tggttctactttaagcaaggt------------------ggtacatagg-
T1UEX7_E1B19K-01        tggttctactttaagcaaggt------------------ggtacatagg-
A0A2H5AI99_E1B19K-      tggctcgacccttagcaacgt------------------ggtgtacagg-
A0A0A1EUE4_E1B19K-      tggctcaacgcttagcagcgt------------------agtgtacagg-
A0MK43_E1B19K-01        tggctcaacgcttagcagcgt------------------agtttatagg-
A0A2H5AID8_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIL0_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIC5_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AI40_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AII9_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIN5_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIU0_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIS9_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
A0A2H5AIT6_E1B19K-      tggctcaacgcttagcagcgt------------------agtttataga-
Q5C8R2_E1B19K-01        tggctcaacgcttagcaacgt------------------gctatatagg-
A0A2H5AI21_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A0M5L3Y4_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A0A1EUC8_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A2H5AI04_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A2H5AI72_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A2H5AIL3_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
A0A0A1EUB2_E1B19K-      tggctcaacgcttagcaacgt------------------gctatatagg-
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        tggaactccgctcagccggct------------------ggttaggcag-
A0A0M4N3Z1_E1B19K-      tggaactccgctcagtcggct------------------ggttaggcag-
Q8B6X5_E1B19K-01        tggaactccgctcagtcggct------------------ggttaggcag-
A0A0M4NHE0_E1B19K-      tggaagcaccctctgccgggt------------------ggtaaggcag-
H9AAD9_E1B19K-01        tggaagcactctctgccgggt------------------ggtaaggcag-
H9AAK5_E1B19K-01        tggaagcactctctgccgggt------------------ggtaaggcag-
H9AAH3_E1B19K-01        tggaagcactctctgccgggt------------------ggtaaggcag-
F2WTJ7_E1B19K-01        tggtacttctctgtgccggtt------------------agtgaggcag-
F2WTM9_E1B19K-01        tggtacttctctgtgccggtt------------------agtgaggcag-
A0A1C8EG46_E1B19K-      tggtacttctctctgccggtt------------------agtgaggcag-
H9AAA8_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
H9AA76_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
H9AAN8_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
H9AAS0_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
H9AAV3_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
H9AAY5_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
M9YVA3_E1B19K-01        tggtacttctctctgccggtt------------------agtgaggcag-
M9YVF6_E1B19K-01        tggctctactcttagcaacgt------------------ggtgcacaga-
A0A0M3TH31_E1B19K-      tggctctactcttagcaacgt------------------ggtgcacaga-
M9YXY5_E1B19K-01        tggctctactcttagcaacgt------------------ggtgcacaga-
G0ZAH2_E1B19K-01        tggcaatcagctggttcgcac------------------ggtcgctcag-
A0A1L3INW0_E1B19K-      tggatcccctctgggtcgctt------------------tttgtaccgg-
A0A2H4CJZ0_E1B19K-      tggctcgactcttagtaacgt------------------ggtgtatcgg-
H8PFZ1_E1B19K-01        tggctcgactctcagtaacgt------------------ggtgtatcgg-
F6KST6_E1B19K-01        cggttctcctctaagccgctt------------------tttaaaccgg-
F2WTG5_E1B19K-01        cggttcccctctgagtcgctt------------------tttgtaccgg-
Q695T5_E1B19K-01        cggttcccctctgagtcgctt------------------tctttaccgg-
H9TER0_E1B19K-01        cggttcccctctgagtcgctt------------------tttgcaccgg-
Q6WQ37_E1B19K-01        gggctcatcccaggcaaagtt------------------agtctgcaga-
J9Z4N4_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
Q71BY5_E1B19K-02        gggctcctcccaagcaaagtt------------------agtctgcaga-
E1ARN8_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
P03246_E1B19K-01        gggctcatcccaggcaaagtt------------------agtctgcaga-
Q6VGV8_E1B19K-01        gggctcatcccaggcaaagtt------------------agtctgcaga-
A0A0G2R248_E1B19K-      gggctcatcccaggcaaagtt------------------agtctgcaga-
A0A291P1B2_E1B19K-      gggctcctcccaggcaaagtt------------------agtctgcaga-
T1UG63_E1B19K-01        gggctcctcccaggcaaagtt------------------agtttgcaga-
A0A1U9ALK7_E1B19K-      gggctcctcccaggcaaagtt------------------agtctgcaga-
P03247_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
J9Z5H0_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
J9Z4H6_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
A0A2H4PJ75_E1B19K-      gggctcctcccaggcaaagtt------------------agtctgcaga-
J7I6T8_E1B19K-01        gggctcctcccaggcaaagtt------------------agtctgcaga-
A0A384ZUF2_E1B19K-      tgaa--tcaggtatccagcctgtacccagagcttagcaaggtgctgacat
A0A384ZUM9_E1B19K-      tgaa--tcaggtagccagcctgtacccagagcttagcaaggtgctgacat
B9A5L5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UGY3_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1P7YYY5_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1P7YWY2_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1P7YWR9_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1P7YXN8_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1P8C849_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
B9A5A7_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UG22_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QVG6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
X4YVU5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QUS9_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QU02_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A291B0H2_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
M0QV87_E1B19K-01        tggaactcctttatctcgcct------------------ggtgtacaca-
T1UKV6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
W8VNG2_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
F8UFP5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UGT5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtataca-
T1UGX3_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
W8CZB0_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
G3CK71_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QTS5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QV08_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
G9JUV5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
G1FC01_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A0G2UY10_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1J0MS84_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
M0QUJ3_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
H0PPE7_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UKP8_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UHQ8_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
Q4KSL0_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UHG3_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A384ZUF2_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
M0QUN2_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
E1CIM6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
E1AI10_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
Q9YL99_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
K7ZLN6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
E1CIR1_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A1Y1BXT7_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
T1UHH6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QVT4_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1ULJ8_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
E9P585_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
D4N3H6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtataca-
C4P207_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1ULP4_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A384ZUM9_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
X4Y9D2_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
T1UHL7_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
B9A5Q1_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QUB4_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QVK6_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A075TSZ1_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
F1DT57_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
M0QUF3_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
E5RWD9_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
E5RWL1_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
B6DU90_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
B9A5T7_E1B19K-01        tggaactcctctatctcgact------------------ggtgtacaca-
B6C6W8_E1B19K-01        tggaactcctctatctcgact------------------ggtgtacaca-
B9A681_E1B19K-01        tggaactcctctatctcgact------------------ggtgtacaca-
A0A1Y1BYF1_E1B19K-      tggaactcctctatctcgact------------------ggtgtacaca-
T1UHZ2_E1B19K-01        tggaactcctctatctcgact------------------ggtgtacaca-
B2VQE3_E1B19K-01        tggaactcctctatctcgact------------------ggtgtacaca-
M0QU76_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
M0QVC7_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
M0QU41_E1B19K-01        tggaactcctctatctcgtct------------------ggtgtacaca-
C5HDR2_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
D3GBW3_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
A0A097I4T0_E1B19K-      tggaactcctctatctcgcct------------------ggtgtacaca-
T1UK99_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacact-
G1FBW4_E1B19K-01        tggatctcctctatctcgcct------------------ggtgtacact-
T1UKQ0_E1B19K-01        tggatctcctctatctcgcct------------------ggtgtacact-
M0QVP5_E1B19K-01        tggaactcctctatctcgcct------------------ggtgtacaca-
H5T740_E1B19K-01        tggaactcctctagctcgcct------------------ggtgtacact-
M0QUW8_E1B19K-01        tggaactcctctagctcgcct------------------ggtgtacaca-
E1CIJ0_E1B19K-01        tggaactcctctagctcgtct------------------ggtgtacaca-
T1UGU0_E1B19K-01        tggaactcctctagctcgtct------------------ggtgtacaca-
M0QV47_E1B19K-01        tggaactcctctagctcgcct------------------ggtgtacaca-

A0A097IW62_E1B19K-      --------------gcaaagt-----------------------------
A0A0M3TH18_E1B19K-      --------------gctaaag-----------------------------
A0A1W5PVU4_E1B19K-      --------------gctaaag-----------------------------
Q6QPF3_E1B19K-01        --------------gccaaac-----------------------------
Q6QPB7_E1B19K-01        --------------gccaaac-----------------------------
Q6QPI9_E1B19K-01        --------------gccaagc-----------------------------
G9G841_E1B19K-01        --------------gccaaac-----------------------------
Q2KSM8_E1B19K-02        --------------accaaac-----------------------------
Q2KSG6_E1B19K-01        --------------accaaac-----------------------------
Q2KSM8_E1B19K-01        --------------accaaac-----------------------------
A0A2L1F3A2_E1B19K-      --------------accaaac-----------------------------
A0A2R3WN16_E1B19K-      --------------accaaac-----------------------------
Q2KSG6_E1B19K-02        --------------accaaac-----------------------------
A0A2L1F392_E1B19K-      --------------accaaac-----------------------------
Q8UY91_E1B19K-01        --------------gccaaac-----------------------------
P10406_E1B19K-01        --------------gccaaac-----------------------------
Q5GFC7_E1B19K-01        --------------gccaaac-----------------------------
A0A2R3WN62_E1B19K-      --------------gccaaac-----------------------------
Q5GFC8_E1B19K-01        --------------gccaaac-----------------------------
Q6H1D7_E1B19K-01        --------------gccaaac-----------------------------
T1UJX4_E1B19K-01        --------------ataaaac-----------------------------
Q7T951_E1B19K-01        --------------ataaaac-----------------------------
T1UE63_E1B19K-01        --------------ataaaac-----------------------------
Q7T8D8_E1B19K-01        --------------ataaaac-----------------------------
Q5UW22_E1B19K-01        --------------ataaaac-----------------------------
Q8B8U7_E1B19K-01        --------------ataaaac-----------------------------
C7SRS7_E1B19K-01        --------------ataaaac-----------------------------
Q32UI6_E1B19K-01        --------------ataaaac-----------------------------
J7H4R9_E1B19K-01        --------------ataaaac-----------------------------
D2DM83_E1B19K-01        --------------ataaaac-----------------------------
J7I6W7_E1B19K-01        --------------ataaaac-----------------------------
W6EIX6_E1B19K-01        --------------ataaaac-----------------------------
A0A1L7NRH1_E1B19K-      --------------ataaaac-----------------------------
Q3ZL02_E1B19K-01        --------------ataaaac-----------------------------
T1UFS4_E1B19K-01        --------------ataaaac-----------------------------
T2CI10_E1B19K-01        --------------ataaaac-----------------------------
A0A0K0PX35_E1B19K-      --------------ataaaac-----------------------------
A0A0K0PX99_E1B19K-      --------------ataaaac-----------------------------
Q3ZKW2_E1B19K-01        --------------ataaaac-----------------------------
Q2KRU2_E1B19K-01        --------------ataaaac-----------------------------
K7NG43_E1B19K-01        --------------ataaaac-----------------------------
Q2KS85_E1B19K-01        --------------ataaaac-----------------------------
A0A0B4SJH1_E1B19K-      --------------ataaaac-----------------------------
A0A075IQ70_E1B19K-      --------------ataaaac-----------------------------
T1UIP3_E1B19K-01        --------------ataaaac-----------------------------
R4HLE1_E1B19K-01        --------------ataaaac-----------------------------
Q5EY83_E1B19K-01        --------------ataaaac-----------------------------
Q2Y0J3_E1B19K-01        --------------ataaaac-----------------------------
J7ID56_E1B19K-01        --------------ataaaac-----------------------------
I6LEP5_E1B19K-01        --------------ataaaac-----------------------------
R4HLJ6_E1B19K-01        --------------ataaaac-----------------------------
R4HLA0_E1B19K-01        --------------ataaaac-----------------------------
Q2KSL3_E1B19K-01        --------------ataaaac-----------------------------
I6LES1_E1B19K-01        --------------ataaaac-----------------------------
T1UF50_E1B19K-01        --------------ataaaac-----------------------------
R4HMC6_E1B19K-01        --------------ataaaac-----------------------------
I1V161_E1B19K-01        --------------ataaaac-----------------------------
J7I6S4_E1B19K-01        --------------ataaaac-----------------------------
A0A220VZ73_E1B19K-      --------------ataaaac-----------------------------
P03248_E1B19K-02        --------------ataaaac-----------------------------
Q6RK98_E1B19K-01        --------------ataaaac-----------------------------
J7I6Q4_E1B19K-01        --------------ataaaac-----------------------------
A0A1S6ELT2_E1B19K-      --------------gccaaag-----------------------------
F4ZCJ8_E1B19K-01        --------------gccaaag-----------------------------
B5SNR1_E1B19K-01        --------------gctaaag-----------------------------
P10544_E1B19K-01        --------------gctaaag-----------------------------
W0S1G8_E1B19K-01        --------------gctaaag-----------------------------
A0A142G3J2_E1B19K-      --------------gctaagg-----------------------------
P10543_E1B19K-01        --------------gctaagg-----------------------------
D3JIR7_E1B19K-01        --------------gtaaaag-----------------------------
A0A076V686_E1B19K-      --------------gtaaagg-----------------------------
P04492_E1B19K-01        --------------gtgaaag-----------------------------
G1DE13_E1B19K-01        --------------gtgaagg-----------------------------
D0Z5R9_E1B19K-01        --------------gtgaagg-----------------------------
T1UEX7_E1B19K-01        --------------gtgaagg-----------------------------
A0A2H5AI99_E1B19K-      --------------gtaaaaa-----------------------------
A0A0A1EUE4_E1B19K-      --------------gtcaaga-----------------------------
A0MK43_E1B19K-01        --------------gtaaaaa-----------------------------
A0A2H5AID8_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIL0_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIC5_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AI40_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AII9_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIN5_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIU0_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIS9_E1B19K-      --------------gtaaaaa-----------------------------
A0A2H5AIT6_E1B19K-      --------------gtaaaaa-----------------------------
Q5C8R2_E1B19K-01        --------------gtcaaga-----------------------------
A0A2H5AI21_E1B19K-      --------------gtcaaga-----------------------------
A0A0M5L3Y4_E1B19K-      --------------gtcaaga-----------------------------
A0A0A1EUC8_E1B19K-      --------------gtcaaga-----------------------------
A0A2H5AI04_E1B19K-      --------------gtcaaga-----------------------------
A0A2H5AI72_E1B19K-      --------------gtcaaga-----------------------------
A0A2H5AIL3_E1B19K-      --------------gtcaaga-----------------------------
A0A0A1EUB2_E1B19K-      --------------gtcaaga-----------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------gtgaaat-----------------------------
A0A0M4N3Z1_E1B19K-      --------------gtgaaat-----------------------------
Q8B6X5_E1B19K-01        --------------gtgaaat-----------------------------
A0A0M4NHE0_E1B19K-      --------------gtgaagg-----------------------------
H9AAD9_E1B19K-01        --------------gtgaagg-----------------------------
H9AAK5_E1B19K-01        --------------gtgaagg-----------------------------
H9AAH3_E1B19K-01        --------------gtgaagg-----------------------------
F2WTJ7_E1B19K-01        --------------gtgaagg-----------------------------
F2WTM9_E1B19K-01        --------------gtgaagg-----------------------------
A0A1C8EG46_E1B19K-      --------------gtgaagg-----------------------------
H9AAA8_E1B19K-01        --------------gtaaagg-----------------------------
H9AA76_E1B19K-01        --------------gtgaagg-----------------------------
H9AAN8_E1B19K-01        --------------gtgaagg-----------------------------
H9AAS0_E1B19K-01        --------------gtgaagg-----------------------------
H9AAV3_E1B19K-01        --------------gtgaagg-----------------------------
H9AAY5_E1B19K-01        --------------gtgaagg-----------------------------
M9YVA3_E1B19K-01        --------------gtgaagg-----------------------------
M9YVF6_E1B19K-01        --------------gtcaagc-----------------------------
A0A0M3TH31_E1B19K-      --------------gtcaagc-----------------------------
M9YXY5_E1B19K-01        --------------gtcaagc-----------------------------
G0ZAH2_E1B19K-01        --------------gtcaaga-----------------------------
A0A1L3INW0_E1B19K-      --------------gttaaga-----------------------------
A0A2H4CJZ0_E1B19K-      --------------gtgaagc-----------------------------
H8PFZ1_E1B19K-01        --------------gtgaagc-----------------------------
F6KST6_E1B19K-01        --------------gtaaagc-----------------------------
F2WTG5_E1B19K-01        --------------gtgaagc-----------------------------
Q695T5_E1B19K-01        --------------gtgaagc-----------------------------
H9TER0_E1B19K-01        --------------gtgaagc-----------------------------
Q6WQ37_E1B19K-01        --------------attaagg-----------------------------
J9Z4N4_E1B19K-01        --------------attaagg-----------------------------
Q71BY5_E1B19K-02        --------------attaagg-----------------------------
E1ARN8_E1B19K-01        --------------attaagg-----------------------------
P03246_E1B19K-01        --------------attaagg-----------------------------
Q6VGV8_E1B19K-01        --------------attaagg-----------------------------
A0A0G2R248_E1B19K-      --------------attaagg-----------------------------
A0A291P1B2_E1B19K-      --------------attaagg-----------------------------
T1UG63_E1B19K-01        --------------attaagg-----------------------------
A0A1U9ALK7_E1B19K-      --------------attaagg-----------------------------
P03247_E1B19K-01        --------------attaagg-----------------------------
J9Z5H0_E1B19K-01        --------------attaagg-----------------------------
J9Z4H6_E1B19K-01        --------------attaagg-----------------------------
A0A2H4PJ75_E1B19K-      --------------attaagg-----------------------------
J7I6T8_E1B19K-01        --------------attaagg-----------------------------
A0A384ZUF2_E1B19K-      ccatggccaggggagttaagagggagaggagcgatgggggtaataccggg
A0A384ZUM9_E1B19K-      ccatggccaggggagtgaagagggagaggagcgatgggggcaataccggg
B9A5L5_E1B19K-01        --------------gttaaga-----------------------------
T1UGY3_E1B19K-01        --------------gttaaaa-----------------------------
A0A1P7YYY5_E1B19K-      --------------gttaaga-----------------------------
A0A1P7YWY2_E1B19K-      --------------gttaaga-----------------------------
A0A1P7YWR9_E1B19K-      --------------gttaaga-----------------------------
A0A1P7YXN8_E1B19K-      --------------gttaaga-----------------------------
A0A1P8C849_E1B19K-      --------------gttaaga-----------------------------
B9A5A7_E1B19K-01        --------------gttaaga-----------------------------
T1UG22_E1B19K-01        --------------gttaaga-----------------------------
M0QVG6_E1B19K-01        --------------gttaaga-----------------------------
X4YVU5_E1B19K-01        --------------gttaaga-----------------------------
M0QUS9_E1B19K-01        --------------gttaaga-----------------------------
M0QU02_E1B19K-01        --------------gtaaaga-----------------------------
A0A291B0H2_E1B19K-      --------------gttaaga-----------------------------
M0QV87_E1B19K-01        --------------gttaaga-----------------------------
T1UKV6_E1B19K-01        --------------gttaaga-----------------------------
W8VNG2_E1B19K-01        --------------gttaaga-----------------------------
F8UFP5_E1B19K-01        --------------gttaaga-----------------------------
T1UGT5_E1B19K-01        --------------gttaaga-----------------------------
T1UGX3_E1B19K-01        --------------gttaaga-----------------------------
W8CZB0_E1B19K-01        --------------gttaaga-----------------------------
G3CK71_E1B19K-01        --------------gttaaga-----------------------------
M0QTS5_E1B19K-01        --------------gttaaga-----------------------------
M0QV08_E1B19K-01        --------------gttaaga-----------------------------
G9JUV5_E1B19K-01        --------------gttaaga-----------------------------
G1FC01_E1B19K-01        --------------gttaaga-----------------------------
A0A0G2UY10_E1B19K-      --------------gttaaga-----------------------------
A0A1J0MS84_E1B19K-      --------------gttaaga-----------------------------
M0QUJ3_E1B19K-01        --------------gttaaga-----------------------------
H0PPE7_E1B19K-01        --------------gttaaga-----------------------------
T1UKP8_E1B19K-01        --------------gttaaga-----------------------------
T1UHQ8_E1B19K-01        --------------gttaaaa-----------------------------
Q4KSL0_E1B19K-01        --------------gttaaga-----------------------------
T1UHG3_E1B19K-01        --------------gttaaga-----------------------------
A0A384ZUF2_E1B19K-      --------------gttaaga-----------------------------
M0QUN2_E1B19K-01        --------------gttaaga-----------------------------
E1CIM6_E1B19K-01        --------------gttaaga-----------------------------
E1AI10_E1B19K-01        --------------gttaaga-----------------------------
Q9YL99_E1B19K-01        --------------gttaaga-----------------------------
K7ZLN6_E1B19K-01        --------------gttaaga-----------------------------
E1CIR1_E1B19K-01        --------------gttaaga-----------------------------
A0A1Y1BXT7_E1B19K-      --------------gttaaga-----------------------------
T1UHH6_E1B19K-01        --------------gttaaga-----------------------------
M0QVT4_E1B19K-01        --------------gttaaga-----------------------------
T1ULJ8_E1B19K-01        --------------gttaaga-----------------------------
E9P585_E1B19K-01        --------------gttaaga-----------------------------
D4N3H6_E1B19K-01        --------------gttaaga-----------------------------
C4P207_E1B19K-01        --------------gttaaga-----------------------------
T1ULP4_E1B19K-01        --------------gttaaga-----------------------------
A0A384ZUM9_E1B19K-      --------------gttaaga-----------------------------
X4Y9D2_E1B19K-01        --------------gttaaga-----------------------------
T1UHL7_E1B19K-01        --------------gttaaga-----------------------------
B9A5Q1_E1B19K-01        --------------gttaaga-----------------------------
M0QUB4_E1B19K-01        --------------gttaaga-----------------------------
M0QVK6_E1B19K-01        --------------gttaaga-----------------------------
A0A075TSZ1_E1B19K-      --------------gttaaga-----------------------------
F1DT57_E1B19K-01        --------------gttaaaa-----------------------------
M0QUF3_E1B19K-01        --------------gttaaga-----------------------------
E5RWD9_E1B19K-01        --------------gttaaga-----------------------------
E5RWL1_E1B19K-01        --------------gttaaga-----------------------------
B6DU90_E1B19K-01        --------------gttaaga-----------------------------
B9A5T7_E1B19K-01        --------------gttaaga-----------------------------
B6C6W8_E1B19K-01        --------------gttaaga-----------------------------
B9A681_E1B19K-01        --------------gttaaga-----------------------------
A0A1Y1BYF1_E1B19K-      --------------gttaaga-----------------------------
T1UHZ2_E1B19K-01        --------------gttaaga-----------------------------
B2VQE3_E1B19K-01        --------------gttaaga-----------------------------
M0QU76_E1B19K-01        --------------gttaaga-----------------------------
M0QVC7_E1B19K-01        --------------gttaaga-----------------------------
M0QU41_E1B19K-01        --------------gttaaga-----------------------------
C5HDR2_E1B19K-01        --------------gttaaga-----------------------------
D3GBW3_E1B19K-01        --------------gttaaga-----------------------------
A0A097I4T0_E1B19K-      --------------gttaaga-----------------------------
T1UK99_E1B19K-01        --------------gttaaga-----------------------------
G1FBW4_E1B19K-01        --------------gttaaga-----------------------------
T1UKQ0_E1B19K-01        --------------gttaaga-----------------------------
M0QVP5_E1B19K-01        --------------gttaaga-----------------------------
H5T740_E1B19K-01        --------------gttaaga-----------------------------
M0QUW8_E1B19K-01        --------------gttaaga-----------------------------
E1CIJ0_E1B19K-01        --------------gttaaga-----------------------------
T1UGU0_E1B19K-01        --------------gttaaga-----------------------------
M0QV47_E1B19K-01        --------------gttaaga-----------------------------

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      atgatgaccgagctgacggccagcctgatgaatcggaagcgcccagagcg
A0A384ZUM9_E1B19K-      atgatgaccgagttgacggccagcctgatgaatcgtaagcgcccagagcg
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      -----------------------ttgagtacagggaagaatt--------
A0A0M3TH18_E1B19K-      -----------------------ttgaatataaggaagaatt--------
A0A1W5PVU4_E1B19K-      -----------------------ttgaatataaggaagaatt--------
Q6QPF3_E1B19K-01        -----------------------aggattataaggaacaatt--------
Q6QPB7_E1B19K-01        -----------------------aggattataaggatcaatt--------
Q6QPI9_E1B19K-01        -----------------------aggattataaggatcaatt--------
G9G841_E1B19K-01        -----------------------aggattatagcgaacaatt--------
Q2KSM8_E1B19K-02        -----------------------aggattataaggaacaatt--------
Q2KSG6_E1B19K-01        -----------------------aggattataaggaacaatt--------
Q2KSM8_E1B19K-01        -----------------------aggattataaggaacaatt--------
A0A2L1F3A2_E1B19K-      -----------------------aggattataaggaacaatt--------
A0A2R3WN16_E1B19K-      -----------------------aggattataaggaacaatt--------
Q2KSG6_E1B19K-02        -----------------------aggattataaggaacaatt--------
A0A2L1F392_E1B19K-      -----------------------aggattataaggaacaatt--------
Q8UY91_E1B19K-01        -----------------------aggattatagtgaacaatt--------
P10406_E1B19K-01        -----------------------aggattatagggaacaatt--------
Q5GFC7_E1B19K-01        -----------------------aggattatagggaacaatt--------
A0A2R3WN62_E1B19K-      -----------------------aggattatagggaacaatt--------
Q5GFC8_E1B19K-01        -----------------------aggattatagggaacaatt--------
Q6H1D7_E1B19K-01        -----------------------aggattatagggaacaatt--------
T1UJX4_E1B19K-01        -----------------------aggactataaagaagaatt--------
Q7T951_E1B19K-01        -----------------------aggactataaacaagaatt--------
T1UE63_E1B19K-01        -----------------------aggactataaacaagaatt--------
Q7T8D8_E1B19K-01        -----------------------aggactataaacaagaatt--------
Q5UW22_E1B19K-01        -----------------------aggactataaacaagaatt--------
Q8B8U7_E1B19K-01        -----------------------aggactataaccaagaatt--------
C7SRS7_E1B19K-01        -----------------------aggactataaagaagaatt--------
Q32UI6_E1B19K-01        -----------------------aggactataaagaagaatt--------
J7H4R9_E1B19K-01        -----------------------aggactataaagaagaatt--------
D2DM83_E1B19K-01        -----------------------aggactataaagaagaatt--------
J7I6W7_E1B19K-01        -----------------------aggactataaagaagaatt--------
W6EIX6_E1B19K-01        -----------------------aggactataaagaagaatt--------
A0A1L7NRH1_E1B19K-      -----------------------aggactataaagaagaatt--------
Q3ZL02_E1B19K-01        -----------------------aggactataaagaagaatt--------
T1UFS4_E1B19K-01        -----------------------aggactataaagaagaatt--------
T2CI10_E1B19K-01        -----------------------aggattacaggcaagaatt--------
A0A0K0PX35_E1B19K-      -----------------------aggactacagggaagaatt--------
A0A0K0PX99_E1B19K-      -----------------------aggactacagggaagaatt--------
Q3ZKW2_E1B19K-01        -----------------------aggactacagggaagaatt--------
Q2KRU2_E1B19K-01        -----------------------aggactatagggaagaatt--------
K7NG43_E1B19K-01        -----------------------aggactacagggaagaatt--------
Q2KS85_E1B19K-01        -----------------------aggactacagggaagaatt--------
A0A0B4SJH1_E1B19K-      -----------------------aggactacagggaagaatt--------
A0A075IQ70_E1B19K-      -----------------------aggactacagggaagaatt--------
T1UIP3_E1B19K-01        -----------------------aggactacagggaagaatt--------
R4HLE1_E1B19K-01        -----------------------aggactacagggaagaatt--------
Q5EY83_E1B19K-01        -----------------------aggactacagggaagaatt--------
Q2Y0J3_E1B19K-01        -----------------------aggactacagggaagaatt--------
J7ID56_E1B19K-01        -----------------------aggactacagggaagaatt--------
I6LEP5_E1B19K-01        -----------------------aggactacagggaagaatt--------
R4HLJ6_E1B19K-01        -----------------------aggactacagggaagaatt--------
R4HLA0_E1B19K-01        -----------------------aggactacagggaagaatt--------
Q2KSL3_E1B19K-01        -----------------------aggactacagggaagaatt--------
I6LES1_E1B19K-01        -----------------------aggactacagggaagaatt--------
T1UF50_E1B19K-01        -----------------------aggactacagggaagaatt--------
R4HMC6_E1B19K-01        -----------------------aggactacagcgtagaatt--------
I1V161_E1B19K-01        -----------------------aggactacagcgtagaatt--------
J7I6S4_E1B19K-01        -----------------------aggactacagcgtagaatt--------
A0A220VZ73_E1B19K-      -----------------------aggactacagcgtagaatt--------
P03248_E1B19K-02        -----------------------aggactacagcgtagaatt--------
Q6RK98_E1B19K-01        -----------------------aggactacagcgtagaatt--------
J7I6Q4_E1B19K-01        -----------------------aggactacagcgtagaatt--------
A0A1S6ELT2_E1B19K-      -----------------------aggactactcttcgcgatt--------
F4ZCJ8_E1B19K-01        -----------------------aggactactcttcgcgatt--------
B5SNR1_E1B19K-01        -----------------------aggactactcttcgcgatt--------
P10544_E1B19K-01        -----------------------aggactactcttcgcgatt--------
W0S1G8_E1B19K-01        -----------------------aggactactcttcgcgatt--------
A0A142G3J2_E1B19K-      -----------------------aggagtactcttcgcggtt--------
P10543_E1B19K-01        -----------------------aggagtactcttcgcggtt--------
D3JIR7_E1B19K-01        -----------------------aagactacaggaaggaatt--------
A0A076V686_E1B19K-      -----------------------aagactacaggaacgaatt--------
P04492_E1B19K-01        -----------------------aagactatagagaggaatt--------
G1DE13_E1B19K-01        -----------------------aagattacagagaggaatt--------
D0Z5R9_E1B19K-01        -----------------------aagattacagagaggaatt--------
T1UEX7_E1B19K-01        -----------------------aagattacagagaggaatt--------
A0A2H5AI99_E1B19K-      -----------------------aggagcaagctgaacagtt--------
A0A0A1EUE4_E1B19K-      -----------------------aggagcaggaggggcaatt--------
A0MK43_E1B19K-01        -----------------------gagagcaggaggcgcagtt--------
A0A2H5AID8_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIL0_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIC5_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AI40_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AII9_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIN5_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIU0_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIS9_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
A0A2H5AIT6_E1B19K-      -----------------------gagagcaggaggcgcagtt--------
Q5C8R2_E1B19K-01        -----------------------aggagcaggagacgcagtt--------
A0A2H5AI21_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A0M5L3Y4_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A0A1EUC8_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A2H5AI04_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A2H5AI72_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A2H5AIL3_E1B19K-      -----------------------aggagcaggagacgcagtt--------
A0A0A1EUB2_E1B19K-      -----------------------aggagcaggagacgcagtt--------
Q71BY5_E1B19K-01        -----------------------------ttaccgaagaaat--------
P06501_E1B19K-01        -----------------------tagaatacgagaaggattt--------
A0A0M4N3Z1_E1B19K-      -----------------------tagaatacgagaaggattt--------
Q8B6X5_E1B19K-01        -----------------------tagaatacgagaaggattt--------
A0A0M4NHE0_E1B19K-      -----------------------aggagtatcagagcgagtt--------
H9AAD9_E1B19K-01        -----------------------aggagtatcagagcgagtt--------
H9AAK5_E1B19K-01        -----------------------aggagtatcagagcgagtt--------
H9AAH3_E1B19K-01        -----------------------aggagtatcagagcgagtt--------
F2WTJ7_E1B19K-01        -----------------------aagagtacgagagcgagtt--------
F2WTM9_E1B19K-01        -----------------------aagagtacgagagcgagtt--------
A0A1C8EG46_E1B19K-      -----------------------aagagtaccagagcgagtt--------
H9AAA8_E1B19K-01        -----------------------aagagtaccaaagcgagtt--------
H9AA76_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
H9AAN8_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
H9AAS0_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
H9AAV3_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
H9AAY5_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
M9YVA3_E1B19K-01        -----------------------aagagtaccagagcgagtt--------
M9YVF6_E1B19K-01        -----------------------gagagcacagtgaagaatt--------
A0A0M3TH31_E1B19K-      -----------------------gagagcacagtgaggaatt--------
M9YXY5_E1B19K-01        -----------------------gagagcacagtgaggaatt--------
G0ZAH2_E1B19K-01        -----------------------cagactatagcgagcattt--------
A0A1L3INW0_E1B19K-      -----------------------aggatcatcaggaggaatt--------
A0A2H4CJZ0_E1B19K-      -----------------------aagagtacagctcgcgctt--------
H8PFZ1_E1B19K-01        -----------------------aagagtacagctcgcgctt--------
F6KST6_E1B19K-01        -----------------------gagaacaccgagctgaatt--------
F2WTG5_E1B19K-01        -----------------------gagagcacctgacggaatt--------
Q695T5_E1B19K-01        -----------------------gagagcacctgacggaatt--------
H9TER0_E1B19K-01        -----------------------gagagcacctgacggaatt--------
Q6WQ37_E1B19K-01        -----------------------aggattacaagtgggaatt--------
J9Z4N4_E1B19K-01        -----------------------aggattacaagtgggaatt--------
Q71BY5_E1B19K-02        -----------------------aggattacaagtgggaatt--------
E1ARN8_E1B19K-01        -----------------------aggattacaagtgggaatt--------
P03246_E1B19K-01        -----------------------aggattacaagtgggaatt--------
Q6VGV8_E1B19K-01        -----------------------aggattacaagtgggaatt--------
A0A0G2R248_E1B19K-      -----------------------aggattacaagtgggaatt--------
A0A291P1B2_E1B19K-      -----------------------aggattacaagtgggaatt--------
T1UG63_E1B19K-01        -----------------------aggattacaagtgggaatt--------
A0A1U9ALK7_E1B19K-      -----------------------aggattacaagtgggaatt--------
P03247_E1B19K-01        -----------------------aggattacaagtgggaatt--------
J9Z5H0_E1B19K-01        -----------------------aggattacaagtgggaatt--------
J9Z4H6_E1B19K-01        -----------------------aggattacaagtgggaatt--------
A0A2H4PJ75_E1B19K-      -----------------------aggattacaagtgggaatt--------
J7I6T8_E1B19K-01        -----------------------aggattacaagtgggaatt--------
A0A384ZUF2_E1B19K-      ccttacctggtacgagctacagcaggagtgcagggatgagttgggcctga
A0A384ZUM9_E1B19K-      cattacctggcacgagctacagcaggagtgcagggatgagataggcttga
B9A5L5_E1B19K-01        -----------------------aggattatagcgaggaatt--------
T1UGY3_E1B19K-01        -----------------------aggattatagcgaggaatt--------
A0A1P7YYY5_E1B19K-      -----------------------aggattatagcgaggaatt--------
A0A1P7YWY2_E1B19K-      -----------------------aggattatagcgaggaatt--------
A0A1P7YWR9_E1B19K-      -----------------------aggattatagcgaggaatt--------
A0A1P7YXN8_E1B19K-      -----------------------aggattatagcgaggaatt--------
A0A1P8C849_E1B19K-      -----------------------aggattatagcgaggaatt--------
B9A5A7_E1B19K-01        -----------------------aggattatagcgaggaatt--------
T1UG22_E1B19K-01        -----------------------aggattatagcgaggaatt--------
M0QVG6_E1B19K-01        -----------------------aggattataacgaggaatt--------
X4YVU5_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QUS9_E1B19K-01        -----------------------aggattataaagaggaatt--------
M0QU02_E1B19K-01        -----------------------aggattatcaggaggaatt--------
A0A291B0H2_E1B19K-      -----------------------aggattatagcgaggaatt--------
M0QV87_E1B19K-01        -----------------------aggattatagcgaggaatt--------
T1UKV6_E1B19K-01        -----------------------aggattatagcgaggaatt--------
W8VNG2_E1B19K-01        -----------------------aggattatagcgaggaatt--------
F8UFP5_E1B19K-01        -----------------------aggattatagcgaggaatt--------
T1UGT5_E1B19K-01        -----------------------aggattataacgaggaatt--------
T1UGX3_E1B19K-01        -----------------------aggattataaagaggaatt--------
W8CZB0_E1B19K-01        -----------------------aggattataacgaggaatt--------
G3CK71_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QTS5_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QV08_E1B19K-01        -----------------------aggattataacgaggaatt--------
G9JUV5_E1B19K-01        -----------------------aggattataacgaggaatt--------
G1FC01_E1B19K-01        -----------------------aggattataacgaggaatt--------
A0A0G2UY10_E1B19K-      -----------------------aggattataacgaggaatt--------
A0A1J0MS84_E1B19K-      -----------------------aggattataacgaggaatt--------
M0QUJ3_E1B19K-01        -----------------------aggattataaagaggaatt--------
H0PPE7_E1B19K-01        -----------------------aggattataaagaggaatt--------
T1UKP8_E1B19K-01        -----------------------aggattataacgaggaatt--------
T1UHQ8_E1B19K-01        -----------------------aggattataacgaggaatt--------
Q4KSL0_E1B19K-01        -----------------------aggattataacgaggaatt--------
T1UHG3_E1B19K-01        -----------------------aggattataaagaggaatt--------
A0A384ZUF2_E1B19K-      -----------------------aggattataaagaggaatt--------
M0QUN2_E1B19K-01        -----------------------aggattataaagaggaatt--------
E1CIM6_E1B19K-01        -----------------------aggattataaagaggaatt--------
E1AI10_E1B19K-01        -----------------------aggattataaagaggaatt--------
Q9YL99_E1B19K-01        -----------------------aggattataaagaggaatt--------
K7ZLN6_E1B19K-01        -----------------------aggattataaagaggaatt--------
E1CIR1_E1B19K-01        -----------------------aggattataaagaggaatt--------
A0A1Y1BXT7_E1B19K-      -----------------------aggattataaagaggaatt--------
T1UHH6_E1B19K-01        -----------------------aggattataaagaggaatt--------
M0QVT4_E1B19K-01        -----------------------aggattataaagaggaatt--------
T1ULJ8_E1B19K-01        -----------------------aggattataaagaggaatt--------
E9P585_E1B19K-01        -----------------------aggattataaagaggaatt--------
D4N3H6_E1B19K-01        -----------------------aggattataaagaggaatt--------
C4P207_E1B19K-01        -----------------------aggattataaagaggaatt--------
T1ULP4_E1B19K-01        -----------------------aggattataaagaggaatt--------
A0A384ZUM9_E1B19K-      -----------------------aggattataaagaggaatt--------
X4Y9D2_E1B19K-01        -----------------------aggattataacgaggaatt--------
T1UHL7_E1B19K-01        -----------------------aggattataacgaggaatt--------
B9A5Q1_E1B19K-01        -----------------------aggattataaagaggaatt--------
M0QUB4_E1B19K-01        -----------------------aggattataaagaggaatt--------
M0QVK6_E1B19K-01        -----------------------aggattataaagaggaatt--------
A0A075TSZ1_E1B19K-      -----------------------aggattataaagaggaatt--------
F1DT57_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QUF3_E1B19K-01        -----------------------aggattataacgaggaatt--------
E5RWD9_E1B19K-01        -----------------------aggattataacgaggaatt--------
E5RWL1_E1B19K-01        -----------------------aggattataacgaggaatt--------
B6DU90_E1B19K-01        -----------------------aggattataacgaggaatt--------
B9A5T7_E1B19K-01        -----------------------aggattataacgaggaatt--------
B6C6W8_E1B19K-01        -----------------------aggattataacgaggaatt--------
B9A681_E1B19K-01        -----------------------aggattataacgaggaatt--------
A0A1Y1BYF1_E1B19K-      -----------------------aggattataacgaggaatt--------
T1UHZ2_E1B19K-01        -----------------------aggattataacgaggaatt--------
B2VQE3_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QU76_E1B19K-01        -----------------------aggattataacgaggaaat--------
M0QVC7_E1B19K-01        -----------------------aggattataacgaggaatt--------
M0QU41_E1B19K-01        -----------------------aggattataacgaggaatt--------
C5HDR2_E1B19K-01        -----------------------aggattataacgaggaatt--------
D3GBW3_E1B19K-01        -----------------------aggattataacgaggaatt--------
A0A097I4T0_E1B19K-      -----------------------aggattataacgaggaatt--------
T1UK99_E1B19K-01        -----------------------aggattatcaggaggaatt--------
G1FBW4_E1B19K-01        -----------------------aggattatcaggaggaatt--------
T1UKQ0_E1B19K-01        -----------------------aggattatcaggaggaatt--------
M0QVP5_E1B19K-01        -----------------------aggattatcaggaggaatt--------
H5T740_E1B19K-01        -----------------------aggattatcaggacgaatt--------
M0QUW8_E1B19K-01        -----------------------aggattatcaggaggaatt--------
E1CIJ0_E1B19K-01        -----------------------aggattatcaggaggaatt--------
T1UGU0_E1B19K-01        -----------------------aggattatcaggaggaatt--------
M0QV47_E1B19K-01        -----------------------aggattatcaggaggaatt--------

A0A097IW62_E1B19K-      ---------------------------tgagaggttatttgcg-------
A0A0M3TH18_E1B19K-      ---------------------------tgagaaacttttttca-------
A0A1W5PVU4_E1B19K-      ---------------------------tgagaaacttttttcg-------
Q6QPF3_E1B19K-01        ---------------------------tgaggatattttgaga-------
Q6QPB7_E1B19K-01        ---------------------------tgaggatattttgaga-------
Q6QPI9_E1B19K-01        ---------------------------tgaggatattttgaga-------
G9G841_E1B19K-01        ---------------------------tgaggttattttgaga-------
Q2KSM8_E1B19K-02        ---------------------------tgatgatattttaaaa-------
Q2KSG6_E1B19K-01        ---------------------------tgatgatattttaaaa-------
Q2KSM8_E1B19K-01        ---------------------------tgatgatattttaaaa-------
A0A2L1F3A2_E1B19K-      ---------------------------tgatgatattttaaaa-------
A0A2R3WN16_E1B19K-      ---------------------------tgatgatattttaaaa-------
Q2KSG6_E1B19K-02        ---------------------------tgatgatattttaaaa-------
A0A2L1F392_E1B19K-      ---------------------------tgatgatattttaaaa-------
Q8UY91_E1B19K-01        ---------------------------tgaggttattttgaga-------
P10406_E1B19K-01        ---------------------------tgaggatattttgaga-------
Q5GFC7_E1B19K-01        ---------------------------tgaggatattttgaga-------
A0A2R3WN62_E1B19K-      ---------------------------tgaggatattttgaga-------
Q5GFC8_E1B19K-01        ---------------------------tgaggatattttgaga-------
Q6H1D7_E1B19K-01        ---------------------------tgaggatattttgaga-------
T1UJX4_E1B19K-01        ---------------------------tgaaaagttgttggta-------
Q7T951_E1B19K-01        ---------------------------tgaaaagttgttggta-------
T1UE63_E1B19K-01        ---------------------------tgaaaagttgttggta-------
Q7T8D8_E1B19K-01        ---------------------------tgaaaagttgttggta-------
Q5UW22_E1B19K-01        ---------------------------tgaaaagttgttggta-------
Q8B8U7_E1B19K-01        ---------------------------tgaaaagttgttggta-------
C7SRS7_E1B19K-01        ---------------------------tgaaaagttgttggta-------
Q32UI6_E1B19K-01        ---------------------------tgaaaagttgttggta-------
J7H4R9_E1B19K-01        ---------------------------tgaaaagttgttggta-------
D2DM83_E1B19K-01        ---------------------------tgaaaagttgttggta-------
J7I6W7_E1B19K-01        ---------------------------tgaaaagttgttggta-------
W6EIX6_E1B19K-01        ---------------------------tgaaaagttgttgcta-------
A0A1L7NRH1_E1B19K-      ---------------------------tgaaaagttgttgcta-------
Q3ZL02_E1B19K-01        ---------------------------tgaaaagttgttggta-------
T1UFS4_E1B19K-01        ---------------------------tgaaaagttgttggta-------
T2CI10_E1B19K-01        ---------------------------tgaaaagttattggac-------
A0A0K0PX35_E1B19K-      ---------------------------tgaaaagttattggac-------
A0A0K0PX99_E1B19K-      ---------------------------tgaaaagttattggac-------
Q3ZKW2_E1B19K-01        ---------------------------tgaaaagttattggac-------
Q2KRU2_E1B19K-01        ---------------------------tgaaaagttattggac-------
K7NG43_E1B19K-01        ---------------------------tgaaaagttattggac-------
Q2KS85_E1B19K-01        ---------------------------tgaaaagttattggac-------
A0A0B4SJH1_E1B19K-      ---------------------------tgaaaagttattggac-------
A0A075IQ70_E1B19K-      ---------------------------tgaaaagttattggac-------
T1UIP3_E1B19K-01        ---------------------------tgaaaagttattggac-------
R4HLE1_E1B19K-01        ---------------------------tgaaaagttattggac-------
Q5EY83_E1B19K-01        ---------------------------tgaaaagttattggac-------
Q2Y0J3_E1B19K-01        ---------------------------tgaaaagttattggac-------
J7ID56_E1B19K-01        ---------------------------tgaaaagttattggac-------
I6LEP5_E1B19K-01        ---------------------------tgaaaagttattggac-------
R4HLJ6_E1B19K-01        ---------------------------tgaaaagttattggac-------
R4HLA0_E1B19K-01        ---------------------------tgaaaagttattggac-------
Q2KSL3_E1B19K-01        ---------------------------tgaaaagttattggac-------
I6LES1_E1B19K-01        ---------------------------tgaaaagttattggac-------
T1UF50_E1B19K-01        ---------------------------tgaaaagttattggac-------
R4HMC6_E1B19K-01        ---------------------------tgaaaagttattggac-------
I1V161_E1B19K-01        ---------------------------tgaaaagttattggac-------
J7I6S4_E1B19K-01        ---------------------------tgaaaagttattggac-------
A0A220VZ73_E1B19K-      ---------------------------tgaaaagttattggac-------
P03248_E1B19K-02        ---------------------------tgaaaagttattggac-------
Q6RK98_E1B19K-01        ---------------------------tgaaaagttattggac-------
J7I6Q4_E1B19K-01        ---------------------------tgaaaagttattggac-------
A0A1S6ELT2_E1B19K-      ---------------------------tgctgagcttttgtct-------
F4ZCJ8_E1B19K-01        ---------------------------tgctgagcttttgtct-------
B5SNR1_E1B19K-01        ---------------------------tgctgagcttttgtct-------
P10544_E1B19K-01        ---------------------------tgctgagcttttgtct-------
W0S1G8_E1B19K-01        ---------------------------tgctgagcttttgtct-------
A0A142G3J2_E1B19K-      ---------------------------tgctgaccttttgtcg-------
P10543_E1B19K-01        ---------------------------tgctgaccttttgtcg-------
D3JIR7_E1B19K-01        ---------------------------tgaaaacatactggcc-------
A0A076V686_E1B19K-      ---------------------------tgaaaacatactggct-------
P04492_E1B19K-01        ---------------------------tgaaaacatattggcc-------
G1DE13_E1B19K-01        ---------------------------tgaaaacatattgacc-------
D0Z5R9_E1B19K-01        ---------------------------tgaaaacatattggcc-------
T1UEX7_E1B19K-01        ---------------------------tgaaaacatattggcc-------
A0A2H5AI99_E1B19K-      ---------------------------ttctaggctgttggct-------
A0A0A1EUE4_E1B19K-      ---------------------------ttctaggctgttggct-------
A0MK43_E1B19K-01        ---------------------------tgctaggctgttggcc-------
A0A2H5AID8_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIL0_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIC5_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AI40_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AII9_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIN5_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIU0_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIS9_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIT6_E1B19K-      ---------------------------tgctaggctgttggcc-------
Q5C8R2_E1B19K-01        ---------------------------tgctaggctgttggcc-------
A0A2H5AI21_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A0M5L3Y4_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A0A1EUC8_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AI04_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AI72_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A2H5AIL3_E1B19K-      ---------------------------tgctaggctgttggcc-------
A0A0A1EUB2_E1B19K-      ---------------------------tgctaggctgttggcc-------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        ---------------------------tgaaagaattttagat-------
A0A0M4N3Z1_E1B19K-      ---------------------------tgaaagaattttagat-------
Q8B6X5_E1B19K-01        ---------------------------tgaaagaattttagat-------
A0A0M4NHE0_E1B19K-      ---------------------------tgaacacattctttcc-------
H9AAD9_E1B19K-01        ---------------------------tgaacacattctttcc-------
H9AAK5_E1B19K-01        ---------------------------tgaacacattctttcc-------
H9AAH3_E1B19K-01        ---------------------------tgaacacattctttcc-------
F2WTJ7_E1B19K-01        ---------------------------tgagcatattctctcg-------
F2WTM9_E1B19K-01        ---------------------------tgagcatattctctcg-------
A0A1C8EG46_E1B19K-      ---------------------------tgagcatattctctcc-------
H9AAA8_E1B19K-01        ---------------------------tgagcacattctctcc-------
H9AA76_E1B19K-01        ---------------------------tgagcatattctctcc-------
H9AAN8_E1B19K-01        ---------------------------tgagcatattctttcc-------
H9AAS0_E1B19K-01        ---------------------------tgagcatattctttcc-------
H9AAV3_E1B19K-01        ---------------------------tgagcatattctttcc-------
H9AAY5_E1B19K-01        ---------------------------tgagcatattctttcc-------
M9YVA3_E1B19K-01        ---------------------------tgagcatattctttcc-------
M9YVF6_E1B19K-01        ---------------------------ttctagactagtggca-------
A0A0M3TH31_E1B19K-      ---------------------------ttctagactagtggca-------
M9YXY5_E1B19K-01        ---------------------------ttctagactagtggca-------
G0ZAH2_E1B19K-01        ---------------------------cgagcagcttttgcaggagcag-
A0A1L3INW0_E1B19K-      ---------------------------tgatcagttaattggt-------
A0A2H4CJZ0_E1B19K-      ---------------------------ttctgagctgttggcc-------
H8PFZ1_E1B19K-01        ---------------------------ttctgagctgttggcc-------
F6KST6_E1B19K-01        ---------------------------tgatgaacttttagag-------
F2WTG5_E1B19K-01        ---------------------------tgatgggcttttagag-------
Q695T5_E1B19K-01        ---------------------------tgatgggcttttagag-------
H9TER0_E1B19K-01        ---------------------------tgatgggcttttagag-------
Q6WQ37_E1B19K-01        ---------------------------cgaagagcttttgaag-------
J9Z4N4_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
Q71BY5_E1B19K-02        ---------------------------tgaagagcttttgaaa-------
E1ARN8_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
P03246_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
Q6VGV8_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
A0A0G2R248_E1B19K-      ---------------------------tgaagagcttttgaaa-------
A0A291P1B2_E1B19K-      ---------------------------tgaagagcttttgaaa-------
T1UG63_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
A0A1U9ALK7_E1B19K-      ---------------------------tgaagagcttttgaaa-------
P03247_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
J9Z5H0_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
J9Z4H6_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
A0A2H4PJ75_E1B19K-      ---------------------------tgaagagcttttgaaa-------
J7I6T8_E1B19K-01        ---------------------------tgaagagcttttgaaa-------
A0A384ZUF2_E1B19K-      tgcaggataaatatggcctggagcagataaaaacccattggttgaaccca
A0A384ZUM9_E1B19K-      tgcaggataaatatggcctggagcagataaaaacccattggttgaaccca
B9A5L5_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
T1UGY3_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
A0A1P7YYY5_E1B19K-      ---------------------------tgaaaatctttttgcc-------
A0A1P7YWY2_E1B19K-      ---------------------------tgaaaatatttttgcc-------
A0A1P7YWR9_E1B19K-      ---------------------------tgaaaatatttttgcc-------
A0A1P7YXN8_E1B19K-      ---------------------------tgaaaatatttttgcc-------
A0A1P8C849_E1B19K-      ---------------------------tgaaaatctttttgcc-------
B9A5A7_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
T1UG22_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QVG6_E1B19K-01        ---------------------------tgaaaatctttttgtc-------
X4YVU5_E1B19K-01        ---------------------------tgaaaatctttttgtc-------
M0QUS9_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QU02_E1B19K-01        ---------------------------tgaaaatctttttgct-------
A0A291B0H2_E1B19K-      ---------------------------tgaaaatcttttttcc-------
M0QV87_E1B19K-01        ---------------------------tgaaaatcttttttcc-------
T1UKV6_E1B19K-01        ---------------------------tgaaaatcttttttcc-------
W8VNG2_E1B19K-01        ---------------------------tgaaaatcttttttcc-------
F8UFP5_E1B19K-01        ---------------------------tgaaaatcttttttcc-------
T1UGT5_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
T1UGX3_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
W8CZB0_E1B19K-01        ---------------------------tgaaaatctttttgct-------
G3CK71_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QTS5_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QV08_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
G9JUV5_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
G1FC01_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
A0A0G2UY10_E1B19K-      ---------------------------tgaaaatctttttgct-------
A0A1J0MS84_E1B19K-      ---------------------------tgaaaatctttttgct-------
M0QUJ3_E1B19K-01        ---------------------------tgaaaatatttttgct-------
H0PPE7_E1B19K-01        ---------------------------tgaaaatatttttgct-------
T1UKP8_E1B19K-01        ---------------------------tgaaaatctttttgct-------
T1UHQ8_E1B19K-01        ---------------------------tgaaaatctttttgct-------
Q4KSL0_E1B19K-01        ---------------------------tgaaaatctttttgct-------
T1UHG3_E1B19K-01        ---------------------------tgaaaatatttttgct-------
A0A384ZUF2_E1B19K-      ---------------------------tgaaaatatttttgct-------
M0QUN2_E1B19K-01        ---------------------------tgaaaatatttttgct-------
E1CIM6_E1B19K-01        ---------------------------tgaaaatatttttgct-------
E1AI10_E1B19K-01        ---------------------------tgaaaatatttttgct-------
Q9YL99_E1B19K-01        ---------------------------tgaaaatatttttgct-------
K7ZLN6_E1B19K-01        ---------------------------tgaaaatatttttgct-------
E1CIR1_E1B19K-01        ---------------------------tgaaaatatttttgct-------
A0A1Y1BXT7_E1B19K-      ---------------------------tgaaaatatttttgct-------
T1UHH6_E1B19K-01        ---------------------------tgaaaatatttttgct-------
M0QVT4_E1B19K-01        ---------------------------tgaaaatctttttgct-------
T1ULJ8_E1B19K-01        ---------------------------tgaaaatctttttgct-------
E9P585_E1B19K-01        ---------------------------tgaaaatctttttgct-------
D4N3H6_E1B19K-01        ---------------------------tgaaaatctttttgct-------
C4P207_E1B19K-01        ---------------------------tgaaaatctttttgct-------
T1ULP4_E1B19K-01        ---------------------------tgaaaatctttttgct-------
A0A384ZUM9_E1B19K-      ---------------------------tgaaaatctttttgct-------
X4Y9D2_E1B19K-01        ---------------------------tgaaaatctttttgct-------
T1UHL7_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B9A5Q1_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QUB4_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QVK6_E1B19K-01        ---------------------------tgaaaatctttttgct-------
A0A075TSZ1_E1B19K-      ---------------------------tgaaaatctttttgct-------
F1DT57_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QUF3_E1B19K-01        ---------------------------tgaaaatctttttgct-------
E5RWD9_E1B19K-01        ---------------------------tgaaaatctttttgct-------
E5RWL1_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B6DU90_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B9A5T7_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B6C6W8_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B9A681_E1B19K-01        ---------------------------tgaaaatctttttgct-------
A0A1Y1BYF1_E1B19K-      ---------------------------tgaaaatctttttgct-------
T1UHZ2_E1B19K-01        ---------------------------tgaaaatctttttgct-------
B2VQE3_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QU76_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QVC7_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QU41_E1B19K-01        ---------------------------tgaaaatctttttgct-------
C5HDR2_E1B19K-01        ---------------------------tgaaaatctttttgct-------
D3GBW3_E1B19K-01        ---------------------------tgaaaatctttttgct-------
A0A097I4T0_E1B19K-      ---------------------------tgaaaatctttttgct-------
T1UK99_E1B19K-01        ---------------------------tgaaaatctttttgct-------
G1FBW4_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
T1UKQ0_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QVP5_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
H5T740_E1B19K-01        ---------------------------tgaaaatctttttgct-------
M0QUW8_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
E1CIJ0_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
T1UGU0_E1B19K-01        ---------------------------tgaaaatctttttgcc-------
M0QV47_E1B19K-01        ---------------------------tgaaaatctttttgcc-------

A0A097IW62_E1B19K-      --------------------------------------gaggtgcctgga
A0A0M3TH18_E1B19K-      --------------------------------------gaggtgcctgga
A0A1W5PVU4_E1B19K-      --------------------------------------gaagtgcctgga
Q6QPF3_E1B19K-01        --------------------------------------gagtgtcctggt
Q6QPB7_E1B19K-01        --------------------------------------gagtgtcctggt
Q6QPI9_E1B19K-01        --------------------------------------gagtgtcctggt
G9G841_E1B19K-01        --------------------------------------gagtgtccgggt
Q2KSM8_E1B19K-02        --------------------------------------gagtgtcctggt
Q2KSG6_E1B19K-01        --------------------------------------gagtgtcctggt
Q2KSM8_E1B19K-01        --------------------------------------gagtgtcctggt
A0A2L1F3A2_E1B19K-      --------------------------------------gagtgtcctggt
A0A2R3WN16_E1B19K-      --------------------------------------gagtgtcctggt
Q2KSG6_E1B19K-02        --------------------------------------gagtgtcctggt
A0A2L1F392_E1B19K-      --------------------------------------gagtgtcctggt
Q8UY91_E1B19K-01        --------------------------------------gagtgttctggt
P10406_E1B19K-01        --------------------------------------gagtgtcctagt
Q5GFC7_E1B19K-01        --------------------------------------gagtgtcctggt
A0A2R3WN62_E1B19K-      --------------------------------------gagtgtcctggt
Q5GFC8_E1B19K-01        --------------------------------------gagtgtcctggt
Q6H1D7_E1B19K-01        --------------------------------------gagtgtcctggt
T1UJX4_E1B19K-01        --------------------------------------gattgcccagga
Q7T951_E1B19K-01        --------------------------------------gattgcccagga
T1UE63_E1B19K-01        --------------------------------------gattgcccagga
Q7T8D8_E1B19K-01        --------------------------------------gattgcccagga
Q5UW22_E1B19K-01        --------------------------------------gattgcccagga
Q8B8U7_E1B19K-01        --------------------------------------gattgcccagga
C7SRS7_E1B19K-01        --------------------------------------gattgcccagga
Q32UI6_E1B19K-01        --------------------------------------gattgtccagga
J7H4R9_E1B19K-01        --------------------------------------gattgcccagga
D2DM83_E1B19K-01        --------------------------------------gattgcccagga
J7I6W7_E1B19K-01        --------------------------------------gattgcccagga
W6EIX6_E1B19K-01        --------------------------------------gattgcccagga
A0A1L7NRH1_E1B19K-      --------------------------------------gattgcccagga
Q3ZL02_E1B19K-01        --------------------------------------gattgcccagga
T1UFS4_E1B19K-01        --------------------------------------gattgcccagga
T2CI10_E1B19K-01        --------------------------------------gactgtccagga
A0A0K0PX35_E1B19K-      --------------------------------------gacagtccagga
A0A0K0PX99_E1B19K-      --------------------------------------gacagtccagga
Q3ZKW2_E1B19K-01        --------------------------------------gacagtccagga
Q2KRU2_E1B19K-01        --------------------------------------gacagtccagga
K7NG43_E1B19K-01        --------------------------------------gacagtccagga
Q2KS85_E1B19K-01        --------------------------------------gacagtccagga
A0A0B4SJH1_E1B19K-      --------------------------------------gacagtccagga
A0A075IQ70_E1B19K-      --------------------------------------gacagtccagga
T1UIP3_E1B19K-01        --------------------------------------gacagtccagga
R4HLE1_E1B19K-01        --------------------------------------aacagtccagga
Q5EY83_E1B19K-01        --------------------------------------gacattccagga
Q2Y0J3_E1B19K-01        --------------------------------------gatagtccggga
J7ID56_E1B19K-01        --------------------------------------gacagtccagga
I6LEP5_E1B19K-01        --------------------------------------gacagtccagga
R4HLJ6_E1B19K-01        --------------------------------------gacagtccagga
R4HLA0_E1B19K-01        --------------------------------------gacagtccagga
Q2KSL3_E1B19K-01        --------------------------------------gacagtccagga
I6LES1_E1B19K-01        --------------------------------------gacagtccagga
T1UF50_E1B19K-01        --------------------------------------gacagtccagga
R4HMC6_E1B19K-01        --------------------------------------gacagtccagga
I1V161_E1B19K-01        --------------------------------------gacagtccagga
J7I6S4_E1B19K-01        --------------------------------------gacagtccagga
A0A220VZ73_E1B19K-      --------------------------------------gacagtccagga
P03248_E1B19K-02        --------------------------------------gacagtccagga
Q6RK98_E1B19K-01        --------------------------------------gacagtccagga
J7I6Q4_E1B19K-01        --------------------------------------gacagtccagga
A0A1S6ELT2_E1B19K-      --------------------------------------tttaaccctgga
F4ZCJ8_E1B19K-01        --------------------------------------tttaaccctgga
B5SNR1_E1B19K-01        --------------------------------------tttaaccctgga
P10544_E1B19K-01        --------------------------------------tttaaccctgga
W0S1G8_E1B19K-01        --------------------------------------tttaaccctgga
A0A142G3J2_E1B19K-      --------------------------------------cataaccctgga
P10543_E1B19K-01        --------------------------------------cataaccctgga
D3JIR7_E1B19K-01        --------------------------------------ggctgtccaggg
A0A076V686_E1B19K-      --------------------------------------ggctgtccaggg
P04492_E1B19K-01        --------------------------------------gactgtccaggg
G1DE13_E1B19K-01        --------------------------------------gactgtccaggg
D0Z5R9_E1B19K-01        --------------------------------------gactgtccaggg
T1UEX7_E1B19K-01        --------------------------------------gactgtccaggg
A0A2H5AI99_E1B19K-      --------------------------------------gaaatccccgga
A0A0A1EUE4_E1B19K-      --------------------------------------gatattcctgga
A0MK43_E1B19K-01        --------------------------------------gatactcctgga
A0A2H5AID8_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIL0_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIC5_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AI40_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AII9_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIN5_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIU0_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIS9_E1B19K-      --------------------------------------gagactcctgga
A0A2H5AIT6_E1B19K-      --------------------------------------gagactcctgga
Q5C8R2_E1B19K-01        --------------------------------------gatactcctgga
A0A2H5AI21_E1B19K-      --------------------------------------gatactcctgga
A0A0M5L3Y4_E1B19K-      --------------------------------------gatactcctgga
A0A0A1EUC8_E1B19K-      --------------------------------------gatactcctgga
A0A2H5AI04_E1B19K-      --------------------------------------gatactcctgga
A0A2H5AI72_E1B19K-      --------------------------------------gatactcctgga
A0A2H5AIL3_E1B19K-      --------------------------------------gatactcctgga
A0A0A1EUB2_E1B19K-      --------------------------------------gatactcctgga
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------cagtgtcccggg
A0A0M4N3Z1_E1B19K-      --------------------------------------caatgtcccggg
Q8B6X5_E1B19K-01        --------------------------------------caatgtcccggg
A0A0M4NHE0_E1B19K-      --------------------------------------aactgccctggg
H9AAD9_E1B19K-01        --------------------------------------aactgccctggg
H9AAK5_E1B19K-01        --------------------------------------aactgccctggg
H9AAH3_E1B19K-01        --------------------------------------aactgccctggg
F2WTJ7_E1B19K-01        --------------------------------------acctgccagggg
F2WTM9_E1B19K-01        --------------------------------------acctgccagggg
A0A1C8EG46_E1B19K-      --------------------------------------acctgccagggg
H9AAA8_E1B19K-01        --------------------------------------acctgccagggg
H9AA76_E1B19K-01        --------------------------------------acctgccagggg
H9AAN8_E1B19K-01        --------------------------------------acttgccagggg
H9AAS0_E1B19K-01        --------------------------------------acttgccagggg
H9AAV3_E1B19K-01        --------------------------------------acttgccagggg
H9AAY5_E1B19K-01        --------------------------------------acttgccagggg
M9YVA3_E1B19K-01        --------------------------------------acttgccagggg
M9YVF6_E1B19K-01        --------------------------------------gatgttcccggg
A0A0M3TH31_E1B19K-      --------------------------------------gatgttcccggg
M9YXY5_E1B19K-01        --------------------------------------gatgttcccggg
G0ZAH2_E1B19K-01        --------------------------------------aaccgactt---
A0A1L3INW0_E1B19K-      --------------------------------------ctttttcctact
A0A2H4CJZ0_E1B19K-      --------------------------------------cgctacccggct
H8PFZ1_E1B19K-01        --------------------------------------cgctacccggct
F6KST6_E1B19K-01        --------------------------------------catttacctggg
F2WTG5_E1B19K-01        --------------------------------------cagctgcctggg
Q695T5_E1B19K-01        --------------------------------------cagctgcctggg
H9TER0_E1B19K-01        --------------------------------------cagctgcctgga
Q6WQ37_E1B19K-01        --------------------------------------tcctgtggtgag
J9Z4N4_E1B19K-01        --------------------------------------tcctgtggtgag
Q71BY5_E1B19K-02        --------------------------------------tcctgtggtgag
E1ARN8_E1B19K-01        --------------------------------------tcctgtggtgag
P03246_E1B19K-01        --------------------------------------tcctgtggtgag
Q6VGV8_E1B19K-01        --------------------------------------tcctgtggtgag
A0A0G2R248_E1B19K-      --------------------------------------tcctgtggtgag
A0A291P1B2_E1B19K-      --------------------------------------tcctgtggtgag
T1UG63_E1B19K-01        --------------------------------------tcctgtggtgag
A0A1U9ALK7_E1B19K-      --------------------------------------tcctgtggtgag
P03247_E1B19K-01        --------------------------------------tcctgtggtgag
J9Z5H0_E1B19K-01        --------------------------------------tcctgtggtgag
J9Z4H6_E1B19K-01        --------------------------------------tcctgtggtgag
A0A2H4PJ75_E1B19K-      --------------------------------------tcctgtggtgag
J7I6T8_E1B19K-01        --------------------------------------tcctgtggtgag
A0A384ZUF2_E1B19K-      gatgaggattgggaggaggctattaagaagtatgccaagatagccctg--
A0A384ZUM9_E1B19K-      gatgaggattgggaggaggccattaagaagtatgccaagatagccctg--
B9A5L5_E1B19K-01        --------------------------------------gactgttctggc
T1UGY3_E1B19K-01        --------------------------------------gactgctctggc
A0A1P7YYY5_E1B19K-      --------------------------------------gactgctctggc
A0A1P7YWY2_E1B19K-      --------------------------------------gactgctcttgc
A0A1P7YWR9_E1B19K-      --------------------------------------gactgctctggc
A0A1P7YXN8_E1B19K-      --------------------------------------gactgctcttgc
A0A1P8C849_E1B19K-      --------------------------------------gactgctctggc
B9A5A7_E1B19K-01        --------------------------------------gactgctctggc
T1UG22_E1B19K-01        --------------------------------------gactgctctggc
M0QVG6_E1B19K-01        --------------------------------------gactgctctggc
X4YVU5_E1B19K-01        --------------------------------------gactgctctggc
M0QUS9_E1B19K-01        --------------------------------------gactgctctggc
M0QU02_E1B19K-01        --------------------------------------gactgctctggc
A0A291B0H2_E1B19K-      --------------------------------------gactgctctggc
M0QV87_E1B19K-01        --------------------------------------gactgctctggc
T1UKV6_E1B19K-01        --------------------------------------gactgctctggc
W8VNG2_E1B19K-01        --------------------------------------gactgctctggc
F8UFP5_E1B19K-01        --------------------------------------gactgctctggc
T1UGT5_E1B19K-01        --------------------------------------gactgctctggc
T1UGX3_E1B19K-01        --------------------------------------gactgctctggc
W8CZB0_E1B19K-01        --------------------------------------gactgctctggc
G3CK71_E1B19K-01        --------------------------------------gactgctctggc
M0QTS5_E1B19K-01        --------------------------------------gactgctctggc
M0QV08_E1B19K-01        --------------------------------------gactgctctggc
G9JUV5_E1B19K-01        --------------------------------------gactgctctggc
G1FC01_E1B19K-01        --------------------------------------gactgctctggc
A0A0G2UY10_E1B19K-      --------------------------------------gactgctctggc
A0A1J0MS84_E1B19K-      --------------------------------------gactgctctggc
M0QUJ3_E1B19K-01        --------------------------------------gactgctctggc
H0PPE7_E1B19K-01        --------------------------------------gactgctctggc
T1UKP8_E1B19K-01        --------------------------------------gactgctctggc
T1UHQ8_E1B19K-01        --------------------------------------gattgctctggc
Q4KSL0_E1B19K-01        --------------------------------------gactgctctggc
T1UHG3_E1B19K-01        --------------------------------------gactgctctggc
A0A384ZUF2_E1B19K-      --------------------------------------gactgctctggc
M0QUN2_E1B19K-01        --------------------------------------gactgctctggc
E1CIM6_E1B19K-01        --------------------------------------gactgctctggc
E1AI10_E1B19K-01        --------------------------------------gactgctctggc
Q9YL99_E1B19K-01        --------------------------------------gactgctctggc
K7ZLN6_E1B19K-01        --------------------------------------gactgctctggc
E1CIR1_E1B19K-01        --------------------------------------gactgctctggc
A0A1Y1BXT7_E1B19K-      --------------------------------------gactgctctggc
T1UHH6_E1B19K-01        --------------------------------------gactgctctggt
M0QVT4_E1B19K-01        --------------------------------------gactgctctggc
T1ULJ8_E1B19K-01        --------------------------------------gactgctctggt
E9P585_E1B19K-01        --------------------------------------gactgctctggt
D4N3H6_E1B19K-01        --------------------------------------gactgctctggt
C4P207_E1B19K-01        --------------------------------------gactgctctggt
T1ULP4_E1B19K-01        --------------------------------------gactgctctggt
A0A384ZUM9_E1B19K-      --------------------------------------gactgctctggc
X4Y9D2_E1B19K-01        --------------------------------------gactgctctggc
T1UHL7_E1B19K-01        --------------------------------------gactgctctggc
B9A5Q1_E1B19K-01        --------------------------------------gactgctctggc
M0QUB4_E1B19K-01        --------------------------------------gactgctctggc
M0QVK6_E1B19K-01        --------------------------------------gactgctctggc
A0A075TSZ1_E1B19K-      --------------------------------------gactgctctggc
F1DT57_E1B19K-01        --------------------------------------gattgctctggc
M0QUF3_E1B19K-01        --------------------------------------gattgctctggc
E5RWD9_E1B19K-01        --------------------------------------gattgctctggc
E5RWL1_E1B19K-01        --------------------------------------gattgctctggc
B6DU90_E1B19K-01        --------------------------------------gattgctctggc
B9A5T7_E1B19K-01        --------------------------------------gattgctctggc
B6C6W8_E1B19K-01        --------------------------------------gattgctctggc
B9A681_E1B19K-01        --------------------------------------gattgctctggc
A0A1Y1BYF1_E1B19K-      --------------------------------------gattgctctggc
T1UHZ2_E1B19K-01        --------------------------------------gattgctctggc
B2VQE3_E1B19K-01        --------------------------------------gattgctctggc
M0QU76_E1B19K-01        --------------------------------------gattgctctggc
M0QVC7_E1B19K-01        --------------------------------------gattgctctggc
M0QU41_E1B19K-01        --------------------------------------gattgctctggc
C5HDR2_E1B19K-01        --------------------------------------gattgctctggc
D3GBW3_E1B19K-01        --------------------------------------gattgctctggc
A0A097I4T0_E1B19K-      --------------------------------------gattgctctggc
T1UK99_E1B19K-01        --------------------------------------gactgctctggc
G1FBW4_E1B19K-01        --------------------------------------gattgctctggc
T1UKQ0_E1B19K-01        --------------------------------------gattgctctggc
M0QVP5_E1B19K-01        --------------------------------------gactgttctggc
H5T740_E1B19K-01        --------------------------------------gactgttctggc
M0QUW8_E1B19K-01        --------------------------------------gattgctctggc
E1CIJ0_E1B19K-01        --------------------------------------gactgttctggc
T1UGU0_E1B19K-01        --------------------------------------gactgttctggc
M0QV47_E1B19K-01        --------------------------------------gactgttctggc

A0A097IW62_E1B19K-      cttttagaat---------------------ctttaaatttttgcca--t
A0A0M3TH18_E1B19K-      cttgtggact---------------------ctctaaatttttgcca--t
A0A1W5PVU4_E1B19K-      cttgtggact---------------------ctttgaatttttgcca--t
Q6QPF3_E1B19K-01        atttttgact---------------------ctctcaacttgggcca--t
Q6QPB7_E1B19K-01        atttttgact---------------------ctctcaacttgggcca--t
Q6QPI9_E1B19K-01        atttttgact---------------------ctctcaacttgggcca--t
G9G841_E1B19K-01        ctttttgacg---------------------ctcttaatttgggtca--t
Q2KSM8_E1B19K-02        ctttttgacg---------------------ctcttaacttgggcca--t
Q2KSG6_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
Q2KSM8_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
A0A2L1F3A2_E1B19K-      ctttttgacg---------------------ctcttaacttgggcca--t
A0A2R3WN16_E1B19K-      ctttttgacg---------------------ctcttaacttgggcca--t
Q2KSG6_E1B19K-02        ctttttgacg---------------------ctcttaacttgggcca--t
A0A2L1F392_E1B19K-      ctttttgacg---------------------ctcttaacttgggcca--t
Q8UY91_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
P10406_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
Q5GFC7_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
A0A2R3WN62_E1B19K-      ctttttgacg---------------------ctcttaacttgggcca--t
Q5GFC8_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
Q6H1D7_E1B19K-01        ctttttgacg---------------------ctcttaacttgggcca--t
T1UJX4_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--c
Q7T951_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
T1UE63_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
Q7T8D8_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
Q5UW22_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
Q8B8U7_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
C7SRS7_E1B19K-01        ctttttgaag---------------------ctcttaatttgggtca--t
Q32UI6_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
J7H4R9_E1B19K-01        ctttttgaag---------------------ctcttaatttgggtca--t
D2DM83_E1B19K-01        ctttttgaag---------------------ctcttaatttgggtca--t
J7I6W7_E1B19K-01        ctttttgaag---------------------ctcttaatttgggtca--t
W6EIX6_E1B19K-01        ctttttgaag---------------------ctcttaatttgggtca--t
A0A1L7NRH1_E1B19K-      ctttttgaag---------------------ctcttaatttgggtca--t
Q3ZL02_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
T1UFS4_E1B19K-01        ctttttgaag---------------------ctcttaatttgggcca--t
T2CI10_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--c
A0A0K0PX35_E1B19K-      ctttttgaag---------------------ctcttaacttgggcca--t
A0A0K0PX99_E1B19K-      ctttttgaag---------------------ctcttaacttgggtca--t
Q3ZKW2_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--t
Q2KRU2_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--t
K7NG43_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--t
Q2KS85_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--c
A0A0B4SJH1_E1B19K-      ctttttgaag---------------------ctcttaacttgggcca--t
A0A075IQ70_E1B19K-      ctttttgaag---------------------ctcttaacttgggcca--t
T1UIP3_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--t
R4HLE1_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
Q5EY83_E1B19K-01        ctttttgaag---------------------ctcttaacttgggcca--t
Q2Y0J3_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
J7ID56_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
I6LEP5_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
R4HLJ6_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
R4HLA0_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
Q2KSL3_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
I6LES1_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
T1UF50_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
R4HMC6_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
I1V161_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
J7I6S4_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
A0A220VZ73_E1B19K-      ctttttgaag---------------------ctcttaacttgggtca--t
P03248_E1B19K-02        ctttttgaag---------------------ctcttaacttgggtca--t
Q6RK98_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
J7I6Q4_E1B19K-01        ctttttgaag---------------------ctcttaacttgggtca--t
A0A1S6ELT2_E1B19K-      atatttgcat---------------------ctttaaatttgggcca--c
F4ZCJ8_E1B19K-01        atttttgcat---------------------ctttaaatttgggcca--c
B5SNR1_E1B19K-01        atttttgcat---------------------ctttaaatttgggcca--c
P10544_E1B19K-01        atttttgcat---------------------ctttaaatttgggcca--c
W0S1G8_E1B19K-01        atttttgcat---------------------ctttaaatttgggcca--c
A0A142G3J2_E1B19K-      atttttgctt---------------------ctttgaatttggggca--t
P10543_E1B19K-01        atttttgctt---------------------ctttgaatttggggca--t
D3JIR7_E1B19K-01        cttttggcat---------------------ctttagatctttgcca--c
A0A076V686_E1B19K-      cttttggcat---------------------ccttagatctttgtca--c
P04492_E1B19K-01        cttttggctt---------------------cactagacttgtgtta--c
G1DE13_E1B19K-01        cttttagctt---------------------cattagatctttgcca--c
D0Z5R9_E1B19K-01        cttttagctt---------------------cattagatctttgcca--c
T1UEX7_E1B19K-01        cttttagctt---------------------cattagatctttgcca--c
A0A2H5AI99_E1B19K-      gtttttgttg---------------------ctctggatttaggcca--c
A0A0A1EUE4_E1B19K-      gtttttgtgg---------------------ctctggatttaggcca--t
A0MK43_E1B19K-01        gtttttgtgg---------------------ctctggatctaggcca--t
A0A2H5AID8_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIL0_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIC5_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AI40_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AII9_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIN5_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIU0_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIS9_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIT6_E1B19K-      gttcttgtgg---------------------ctctggatctaggcca--t
Q5C8R2_E1B19K-01        gtttttgtgg---------------------ctctggatctaggcca--t
A0A2H5AI21_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A0M5L3Y4_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A0A1EUC8_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A2H5AI04_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A2H5AI72_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A2H5AIL3_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
A0A0A1EUB2_E1B19K-      gtttttgtgg---------------------ctctggatctaggcca--t
Q71BY5_E1B19K-01        ------------------------------------------ggccg--c
P06501_E1B19K-01        gtgtttgagt---------------------ccctggagctgggcta--t
A0A0M4N3Z1_E1B19K-      gtgtttgagt---------------------ccctggagttgggcta--t
Q8B6X5_E1B19K-01        gtgtttgagt---------------------ccctggagttgggcta--t
A0A0M4NHE0_E1B19K-      ctttttgtgt---------------------ctctggatctgggcca--c
H9AAD9_E1B19K-01        ctttttgtgt---------------------ctttggatctgggcca--c
H9AAK5_E1B19K-01        ctttttgtgt---------------------ctttggatctgggcca--c
H9AAH3_E1B19K-01        ctttttgtgt---------------------ctttggatctgggcca--c
F2WTJ7_E1B19K-01        cttttcgagt---------------------ctctggagttgggaca--c
F2WTM9_E1B19K-01        cttttcgagt---------------------ctctggagttgggaca--c
A0A1C8EG46_E1B19K-      ctttttgagt---------------------ctctggagttgggaca--c
H9AAA8_E1B19K-01        cttttcgagt---------------------ctctggagttgggaca--c
H9AA76_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
H9AAN8_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
H9AAS0_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
H9AAV3_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
H9AAY5_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
M9YVA3_E1B19K-01        cttttcgagt---------------------ctctggagttgggtca--c
M9YVF6_E1B19K-01        ctttttgttt---------------------ctttagatttaggaca--t
A0A0M3TH31_E1B19K-      ctttttgttt---------------------ctttagacttaggaca--t
M9YXY5_E1B19K-01        ctttttgttt---------------------ctttagacttaggaca--t
G0ZAH2_E1B19K-01        ctgctgaaca---------------------acttggaactcggtcacac
A0A1L3INW0_E1B19K-      attttcgagt---------------------ctcttaacctcggtca--c
A0A2H4CJZ0_E1B19K-      gtttttgctt---------------------ctctggatctaggcca--t
H8PFZ1_E1B19K-01        gtttttgttt---------------------ctctggatctaggcca--t
F6KST6_E1B19K-01        ctttttgatt---------------------ctttgaatctaggcca--t
F2WTG5_E1B19K-01        ctgtttgatt---------------------ctttgaatctcggcca--c
Q695T5_E1B19K-01        ctgtttgatt---------------------ctttgaatctcggcca--c
H9TER0_E1B19K-01        ctgtttgatt---------------------ctttgaatctcggcca--c
Q6WQ37_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
J9Z4N4_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
Q71BY5_E1B19K-02        ctgtttgatt---------------------ctttgaatctgggtca--c
E1ARN8_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
P03246_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
Q6VGV8_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
A0A0G2R248_E1B19K-      ctgtttgatt---------------------ctttgaatctgggtca--c
A0A291P1B2_E1B19K-      ctgtttgatt---------------------ctttgaatctgggtca--c
T1UG63_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
A0A1U9ALK7_E1B19K-      ctgtttgatt---------------------ctttgaatctgggtca--c
P03247_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
J9Z5H0_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
J9Z4H6_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
A0A2H4PJ75_E1B19K-      ctgtttgatt---------------------ctttgaatctgggtca--c
J7I6T8_E1B19K-01        ctgtttgatt---------------------ctttgaatctgggtca--c
A0A384ZUF2_E1B19K-      cgcccagattgcaagtacatagtgaccaagaccgtgaatatcagacatgc
A0A384ZUM9_E1B19K-      cgcccagattgcaagtacatagtgaccaagaccgtgaatatcagacatgc
B9A5L5_E1B19K-01        ctgctagatt---------------------ctttaaattttggcca--c
T1UGY3_E1B19K-01        ctgctagatt---------------------ctttaaattttggtca--c
A0A1P7YYY5_E1B19K-      ctgctagatt---------------------ctttaaattttggcca--c
A0A1P7YWY2_E1B19K-      ctgctagatt---------------------ctttaaattttggcca--c
A0A1P7YWR9_E1B19K-      ctgctagatt---------------------ctttaaattttggcca--c
A0A1P7YXN8_E1B19K-      ctgctagatt---------------------ctttaaattttggcca--c
A0A1P8C849_E1B19K-      ctgctagatt---------------------ctttaaattttggcca--c
B9A5A7_E1B19K-01        ctgctagatt---------------------ctttaaattttggcca--c
T1UG22_E1B19K-01        ctgctagatt---------------------ctttaaattttggcca--c
M0QVG6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
X4YVU5_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
M0QUS9_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
M0QU02_E1B19K-01        ctgcttgatt---------------------ctctgaatttcggcca--c
A0A291B0H2_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
M0QV87_E1B19K-01        ctgctagatt---------------------ctctgaattttggcca--c
T1UKV6_E1B19K-01        ctgctagatt---------------------ctctgaattttggcca--c
W8VNG2_E1B19K-01        ctgcttgatt---------------------cactgaattttggcca--c
F8UFP5_E1B19K-01        ctgcttgatt---------------------cactgaattttggcca--c
T1UGT5_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
T1UGX3_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
W8CZB0_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
G3CK71_E1B19K-01        ctgcttgatt---------------------ctttgaattttggcca--c
M0QTS5_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
M0QV08_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
G9JUV5_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
G1FC01_E1B19K-01        ctgcttgatt---------------------ctctgaattttggcca--c
A0A0G2UY10_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
A0A1J0MS84_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
M0QUJ3_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
H0PPE7_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
T1UKP8_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
T1UHQ8_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
Q4KSL0_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
T1UHG3_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
A0A384ZUF2_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
M0QUN2_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
E1CIM6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
E1AI10_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
Q9YL99_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
K7ZLN6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
E1CIR1_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
A0A1Y1BXT7_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
T1UHH6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
M0QVT4_E1B19K-01        ctgttagatt---------------------ctctgaatcttggcca--c
T1ULJ8_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
E9P585_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
D4N3H6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
C4P207_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
T1ULP4_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
A0A384ZUM9_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
X4Y9D2_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
T1UHL7_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
B9A5Q1_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
M0QUB4_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
M0QVK6_E1B19K-01        ctgctagatt---------------------ctctgaatcttggcca--c
A0A075TSZ1_E1B19K-      ctgctagatt---------------------ctctgaatcttggcca--c
F1DT57_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
M0QUF3_E1B19K-01        ctgctagatt---------------------ctctaaatctcggcca--c
E5RWD9_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
E5RWL1_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
B6DU90_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
B9A5T7_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
B6C6W8_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
B9A681_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
A0A1Y1BYF1_E1B19K-      ctgctagatt---------------------ctctgaatctcggcca--c
T1UHZ2_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
B2VQE3_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
M0QU76_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
M0QVC7_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
M0QU41_E1B19K-01        ctgctagatt---------------------ctctgaatctcggcca--c
C5HDR2_E1B19K-01        ctactagatt---------------------ctctgaatctcggcca--c
D3GBW3_E1B19K-01        ctactagatt---------------------ctctgaatctcggcca--c
A0A097I4T0_E1B19K-      ctactagatt---------------------ctctgaatctcggcca--c
T1UK99_E1B19K-01        ctgctagatt---------------------ctctgaatttcggcca--c
G1FBW4_E1B19K-01        ctgcttgatt---------------------cactgaatctcggcca--c
T1UKQ0_E1B19K-01        ctgcttgatt---------------------cactgaatctcggcca--c
M0QVP5_E1B19K-01        ctgcttgatt---------------------cactgaatctcggcca--c
H5T740_E1B19K-01        cttcttgatt---------------------cactgaatctcggcca--c
M0QUW8_E1B19K-01        ctgctcgatt---------------------cactgaatctcggcca--c
E1CIJ0_E1B19K-01        cttcttgatt---------------------cactgaatcttggcca--c
T1UGU0_E1B19K-01        cttcttgatt---------------------cactgaatcttggcca--c
M0QV47_E1B19K-01        cttcttgatt---------------------cactgaatctcggcca--c

A0A097IW62_E1B19K-      cacgctgtgttttatgagaa----------aataatttgctcttt-----
A0A0M3TH18_E1B19K-      cacgcttttttttacgagaa----------ggttatttgcggctt-----
A0A1W5PVU4_E1B19K-      cacgcttttttttacgagaa----------ggttatttgcggctt-----
Q6QPF3_E1B19K-01        cagtctcactttaaccagag----------tattctgagagccct-----
Q6QPB7_E1B19K-01        cagtctcactttaaccagag----------tattctgagagccct-----
Q6QPI9_E1B19K-01        cagtctcactttaaccagag----------tattctgagagccct-----
G9G841_E1B19K-01        cagactcactttaaccagag----------gattgtaagagccct-----
Q2KSM8_E1B19K-02        cagtctcactttaaccagag----------aatttcaagagccct-----
Q2KSG6_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
Q2KSM8_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
A0A2L1F3A2_E1B19K-      cagtctcactttaaccagag----------aatttcaagagccct-----
A0A2R3WN16_E1B19K-      cagtctcactttaaccagag----------aatttcaagagccct-----
Q2KSG6_E1B19K-02        cagtctcactttaaccagag----------aatttcaagagccct-----
A0A2L1F392_E1B19K-      cagtctcactttaaccagag----------aatttcaagagccct-----
Q8UY91_E1B19K-01        cagtctcactttaaccagag----------gatttcgagagccct-----
P10406_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
Q5GFC7_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
A0A2R3WN62_E1B19K-      cagtctcactttaaccagag----------aatttcaagagccct-----
Q5GFC8_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
Q6H1D7_E1B19K-01        cagtctcactttaaccagag----------aatttcaagagccct-----
T1UJX4_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
Q7T951_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
T1UE63_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
Q7T8D8_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
Q5UW22_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
Q8B8U7_E1B19K-01        caggttcactttaaagaaaa----------agttttatcagtttt-----
C7SRS7_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
Q32UI6_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
J7H4R9_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
D2DM83_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
J7I6W7_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
W6EIX6_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
A0A1L7NRH1_E1B19K-      caagttcactttaaagaaaa----------agttttatcagtttt-----
Q3ZL02_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
T1UFS4_E1B19K-01        caagttcactttaaagaaaa----------agttttatcagtttt-----
T2CI10_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A0K0PX35_E1B19K-      caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A0K0PX99_E1B19K-      caggctcattttaaggagaa----------ggttttatcagtttt-----
Q3ZKW2_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q2KRU2_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
K7NG43_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q2KS85_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A0B4SJH1_E1B19K-      caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A075IQ70_E1B19K-      caggctcattttaaggagaa----------ggttttatcagtttt-----
T1UIP3_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
R4HLE1_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q5EY83_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q2Y0J3_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
J7ID56_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
I6LEP5_E1B19K-01        cgggctcattttaaggagaa----------ggttttatcagtttt-----
R4HLJ6_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
R4HLA0_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q2KSL3_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
I6LES1_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
T1UF50_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
R4HMC6_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
I1V161_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
J7I6S4_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A220VZ73_E1B19K-      caggctcattttaaggagaa----------ggttttatcagtttt-----
P03248_E1B19K-02        caggctcattttaaggagaa----------ggttttatcagtttt-----
Q6RK98_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
J7I6Q4_E1B19K-01        caggctcattttaaggagaa----------ggttttatcagtttt-----
A0A1S6ELT2_E1B19K-      cactcatttttccaggaaat----------tgtgatcaaaaactt-----
F4ZCJ8_E1B19K-01        cactcatttttccaggaaat----------tgtgatcaaaaactt-----
B5SNR1_E1B19K-01        cactcatttttccaggaaat----------tgtgatcaaaaactt-----
P10544_E1B19K-01        cactcatttttccaggaaat----------tgtgatcaaaaactt-----
W0S1G8_E1B19K-01        cactcatttttccaggaaat----------tgtgatcaaaaactt-----
A0A142G3J2_E1B19K-      cactcattttttcaagaaat----------tgtgatcagaaattt-----
P10543_E1B19K-01        cactcattttttcaagaaat----------tgtgatcagaaattt-----
D3JIR7_E1B19K-01        cactcgatttttcaagagaa----------agtggtcaaatcttt-----
A0A076V686_E1B19K-      cactcgatttttcaagaaaa----------agtggtcagatcttt-----
P04492_E1B19K-01        cacttggtgtttcaggaaaa----------agtggtcagatcctt-----
G1DE13_E1B19K-01        cactctgtttttcaggaaag----------agtggtcagatcttt-----
D0Z5R9_E1B19K-01        cactctgtttttcaggaaag----------agtggtcagatcttt-----
T1UEX7_E1B19K-01        cactctgtttttcaggaaag----------agtggtcagatcttt-----
A0A2H5AI99_E1B19K-      cacgctctttttcaagaaaa----------agttattaaaagctt-----
A0A0A1EUE4_E1B19K-      cacagtctttttcaagagaa----------aattgtcaaaagctt-----
A0MK43_E1B19K-01        cactctcttttccaagagaa----------aatcatcaaaaactt-----
A0A2H5AID8_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIL0_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIC5_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AI40_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AII9_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIN5_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIU0_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIS9_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
A0A2H5AIT6_E1B19K-      cactctctttttcaagaaaa----------aatcatcagaaactt-----
Q5C8R2_E1B19K-01        cactctcttttccaagagaa----------aattatcaaaaacct-----
A0A2H5AI21_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A0M5L3Y4_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A0A1EUC8_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A2H5AI04_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A2H5AI72_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A2H5AIL3_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaactt-----
A0A0A1EUB2_E1B19K-      cactctcttttccaagagaa----------aattatcaaaaacct-----
Q71BY5_E1B19K-01        cagtc----ttttggaccag------------------------------
P06501_E1B19K-01        cataaggtttttgaggagaa----------gattgtaaaggagtt-----
A0A0M4N3Z1_E1B19K-      cataaggtttttgaggataa----------gattgtaaaggagtt-----
Q8B6X5_E1B19K-01        cataaggtttttgaggataa----------gattgtaaaggagtt-----
A0A0M4NHE0_E1B19K-      catacggtgtttcaggagaa----------gattgtgaaggcttt-----
H9AAD9_E1B19K-01        catacggtgtttcaggagaa----------gattgtgaaggcttt-----
H9AAK5_E1B19K-01        catacggtgtttcaggagaa----------gattgtgaaggcttt-----
H9AAH3_E1B19K-01        catacggtgtttcaggagaa----------gattgtgaaggcttt-----
F2WTJ7_E1B19K-01        cacacggtgtttcaggagaa----------gattgtgaaggcttt-----
F2WTM9_E1B19K-01        cacacggtgtttcaggagaa----------gattgtgaaggcttt-----
A0A1C8EG46_E1B19K-      cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AAA8_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AA76_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AAN8_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AAS0_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AAV3_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
H9AAY5_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
M9YVA3_E1B19K-01        cacacggtgtttcaggagaa----------aattgtgaaggcttt-----
M9YVF6_E1B19K-01        cactcttactttcaggagaa----------gattgtcaagggtct-----
A0A0M3TH31_E1B19K-      cactcttactttcaggagaa----------aattgtaaagggtct-----
M9YXY5_E1B19K-01        cactcttactttcaggagaa----------aattgtaaagggtct-----
G0ZAH2_E1B19K-01        cagggcact-----gaacgg----------tgtgctgagggaact-----
A0A1L3INW0_E1B19K-      aaaactcttctcgaggataa----------gctcctggtgcagtt-----
A0A2H4CJZ0_E1B19K-      cacgtttattttcaagaagc----------ggtggtcagatattt-----
H8PFZ1_E1B19K-01        cacgtttatttccaagaagc----------tgtagtcagatattt-----
F6KST6_E1B19K-01        cgggtattgcttgaggaaagg---------ctttttccacaatt------
F2WTG5_E1B19K-01        cggacgctgctagaggagagg---------ctttttccacaatt------
Q695T5_E1B19K-01        cggacgctgctagaggagagg---------ctttttccacaatt------
H9TER0_E1B19K-01        cggacgctgctagaggagagg---------ctttttccacaatt------
Q6WQ37_E1B19K-01        caggcgcttctccaagagaa----------ggtcatcaagacttt-----
J9Z4N4_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
Q71BY5_E1B19K-02        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
E1ARN8_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
P03246_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
Q6VGV8_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
A0A0G2R248_E1B19K-      caggcgcttttccaagagaa----------ggtcatcaagacttt-----
A0A291P1B2_E1B19K-      caggcgcttttccaagagaa----------ggtcattaagacttt-----
T1UG63_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
A0A1U9ALK7_E1B19K-      caggcgcttttccaagagaa----------ggtcatcaagacttt-----
P03247_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
J9Z5H0_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
J9Z4H6_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
A0A2H4PJ75_E1B19K-      caggcgcttttccaagagaa----------ggtcatcaagacttt-----
J7I6T8_E1B19K-01        caggcgcttttccaagagaa----------ggtcatcaagacttt-----
A0A384ZUF2_E1B19K-      ctgctacatctcggggaacggggcagaggtggtcatcgataccctggaca
A0A384ZUM9_E1B19K-      ctgctacatctcggggaacggggcagaggtggtcatcgataccctggaca
B9A5L5_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UGY3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1P7YYY5_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1P7YWY2_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1P7YWR9_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1P7YXN8_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1P8C849_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
B9A5A7_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UG22_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QVG6_E1B19K-01        caggctctattccaggaaag----------ggtactccacagcct-----
X4YVU5_E1B19K-01        caggctctattccaggaaag----------ggtactccacagcct-----
M0QUS9_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----
M0QU02_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
A0A291B0H2_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QV87_E1B19K-01        cagtcccttttccaggaaag----------ggtccttcacagcct-----
T1UKV6_E1B19K-01        cagtcccttttccaggaaag----------ggtccttcacagcct-----
W8VNG2_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
F8UFP5_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
T1UGT5_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
T1UGX3_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
W8CZB0_E1B19K-01        cagtcccttttccaggaaag----------ggtcctgcacagcct-----
G3CK71_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
M0QTS5_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
M0QV08_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
G9JUV5_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
G1FC01_E1B19K-01        cagtcccttttccaggaaag----------ggtcctccacagcct-----
A0A0G2UY10_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagtct-----
A0A1J0MS84_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagtct-----
M0QUJ3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
H0PPE7_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UKP8_E1B19K-01        cagtcccttttccaggaaag----------ggtacttcacagcct-----
T1UHQ8_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
Q4KSL0_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UHG3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A384ZUF2_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QUN2_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
E1CIM6_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
E1AI10_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
Q9YL99_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
K7ZLN6_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
E1CIR1_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1Y1BXT7_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UHH6_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QVT4_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1ULJ8_E1B19K-01        caggctctattccaggaaag----------ggtactccacagcct-----
E9P585_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
D4N3H6_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
C4P207_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1ULP4_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A384ZUM9_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
X4Y9D2_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UHL7_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B9A5Q1_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QUB4_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QVK6_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A075TSZ1_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
F1DT57_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QUF3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
E5RWD9_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
E5RWL1_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B6DU90_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B9A5T7_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B6C6W8_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B9A681_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A1Y1BYF1_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UHZ2_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
B2VQE3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QU76_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QVC7_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
M0QU41_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
C5HDR2_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
D3GBW3_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
A0A097I4T0_E1B19K-      cagtcccttttccaggaaag----------ggtactccacagcct-----
T1UK99_E1B19K-01        cagtcccttttccaggaaag----------ggtactccacagcct-----
G1FBW4_E1B19K-01        caggctcttttccaggaaag----------ggtactccacagcct-----
T1UKQ0_E1B19K-01        caggctcttttccaggaaag----------ggtactccacagcct-----
M0QVP5_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----
H5T740_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----
M0QUW8_E1B19K-01        caggctcttttccaggaaag----------ggtcctccacagcct-----
E1CIJ0_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----
T1UGU0_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----
M0QV47_E1B19K-01        caggctctattccaggaaag----------ggtcctccacagcct-----

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      aggccgccttcaggtgttgcatgatgggaatgagagcaggagtgatgaat
A0A384ZUM9_E1B19K-      agtcagccttcaggtgttgcatgatgggaatgagagccggagtgatgaat
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      ----------agattttt--------------------------------
A0A0M3TH18_E1B19K-      ----------ggattttt--------------------------------
A0A1W5PVU4_E1B19K-      ----------ggattttt--------------------------------
Q6QPF3_E1B19K-01        ----------tgactttt--------------------------------
Q6QPB7_E1B19K-01        ----------tgactttt--------------------------------
Q6QPI9_E1B19K-01        ----------tgactttt--------------------------------
G9G841_E1B19K-01        ----------tgatttta--------------------------------
Q2KSM8_E1B19K-02        ----------tgacttta--------------------------------
Q2KSG6_E1B19K-01        ----------tgacttta--------------------------------
Q2KSM8_E1B19K-01        ----------tgacttta--------------------------------
A0A2L1F3A2_E1B19K-      ----------tgacttta--------------------------------
A0A2R3WN16_E1B19K-      ----------tgacttta--------------------------------
Q2KSG6_E1B19K-02        ----------tgacttta--------------------------------
A0A2L1F392_E1B19K-      ----------tgacttta--------------------------------
Q8UY91_E1B19K-01        ----------tgatttta--------------------------------
P10406_E1B19K-01        ----------tgacttta--------------------------------
Q5GFC7_E1B19K-01        ----------tgacttta--------------------------------
A0A2R3WN62_E1B19K-      ----------tgacttta--------------------------------
Q5GFC8_E1B19K-01        ----------tgacttta--------------------------------
Q6H1D7_E1B19K-01        ----------tgacttta--------------------------------
T1UJX4_E1B19K-01        ----------agactttt--------------------------------
Q7T951_E1B19K-01        ----------agactttt--------------------------------
T1UE63_E1B19K-01        ----------agactttt--------------------------------
Q7T8D8_E1B19K-01        ----------agactttt--------------------------------
Q5UW22_E1B19K-01        ----------agactttt--------------------------------
Q8B8U7_E1B19K-01        ----------agactttt--------------------------------
C7SRS7_E1B19K-01        ----------agactttt--------------------------------
Q32UI6_E1B19K-01        ----------agactttt--------------------------------
J7H4R9_E1B19K-01        ----------agactttt--------------------------------
D2DM83_E1B19K-01        ----------agactttt--------------------------------
J7I6W7_E1B19K-01        ----------agactttt--------------------------------
W6EIX6_E1B19K-01        ----------agactttt--------------------------------
A0A1L7NRH1_E1B19K-      ----------agactttt--------------------------------
Q3ZL02_E1B19K-01        ----------agactttt--------------------------------
T1UFS4_E1B19K-01        ----------agactttt--------------------------------
T2CI10_E1B19K-01        ----------ggattttt--------------------------------
A0A0K0PX35_E1B19K-      ----------agattttt--------------------------------
A0A0K0PX99_E1B19K-      ----------agattttt--------------------------------
Q3ZKW2_E1B19K-01        ----------agattttt--------------------------------
Q2KRU2_E1B19K-01        ----------agattttt--------------------------------
K7NG43_E1B19K-01        ----------agattttt--------------------------------
Q2KS85_E1B19K-01        ----------agattttt--------------------------------
A0A0B4SJH1_E1B19K-      ----------agattttt--------------------------------
A0A075IQ70_E1B19K-      ----------agattttt--------------------------------
T1UIP3_E1B19K-01        ----------agattttt--------------------------------
R4HLE1_E1B19K-01        ----------agattttt--------------------------------
Q5EY83_E1B19K-01        ----------agattttt--------------------------------
Q2Y0J3_E1B19K-01        ----------agattttt--------------------------------
J7ID56_E1B19K-01        ----------agattttt--------------------------------
I6LEP5_E1B19K-01        ----------agattttt--------------------------------
R4HLJ6_E1B19K-01        ----------agattttt--------------------------------
R4HLA0_E1B19K-01        ----------agattttt--------------------------------
Q2KSL3_E1B19K-01        ----------agattttt--------------------------------
I6LES1_E1B19K-01        ----------agattttt--------------------------------
T1UF50_E1B19K-01        ----------agattttt--------------------------------
R4HMC6_E1B19K-01        ----------agattttt--------------------------------
I1V161_E1B19K-01        ----------agattttt--------------------------------
J7I6S4_E1B19K-01        ----------agattttt--------------------------------
A0A220VZ73_E1B19K-      ----------agattttt--------------------------------
P03248_E1B19K-02        ----------agattttt--------------------------------
Q6RK98_E1B19K-01        ----------agattttt--------------------------------
J7I6Q4_E1B19K-01        ----------agattttt--------------------------------
A0A1S6ELT2_E1B19K-      ----------agattttt--------------------------------
F4ZCJ8_E1B19K-01        ----------agattttt--------------------------------
B5SNR1_E1B19K-01        ----------agattttt--------------------------------
P10544_E1B19K-01        ----------agattttt--------------------------------
W0S1G8_E1B19K-01        ----------agattttt--------------------------------
A0A142G3J2_E1B19K-      ----------agattttt--------------------------------
P10543_E1B19K-01        ----------agattttt--------------------------------
D3JIR7_E1B19K-01        ----------ggattttt--------------------------------
A0A076V686_E1B19K-      ----------ggattttt--------------------------------
P04492_E1B19K-01        ----------agattttt--------------------------------
G1DE13_E1B19K-01        ----------agattttt--------------------------------
D0Z5R9_E1B19K-01        ----------agattttt--------------------------------
T1UEX7_E1B19K-01        ----------agattttt--------------------------------
A0A2H5AI99_E1B19K-      ----------aacttttt--------------------------------
A0A0A1EUE4_E1B19K-      ----------aactttct--------------------------------
A0MK43_E1B19K-01        ----------aactttta--------------------------------
A0A2H5AID8_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIL0_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIC5_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AI40_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AII9_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIN5_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIU0_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIS9_E1B19K-      ----------aacttttt--------------------------------
A0A2H5AIT6_E1B19K-      ----------aacttttt--------------------------------
Q5C8R2_E1B19K-01        ----------aactttta--------------------------------
A0A2H5AI21_E1B19K-      ----------aactttta--------------------------------
A0A0M5L3Y4_E1B19K-      ----------aactttta--------------------------------
A0A0A1EUC8_E1B19K-      ----------aactttta--------------------------------
A0A2H5AI04_E1B19K-      ----------aactttta--------------------------------
A0A2H5AI72_E1B19K-      ----------aactttta--------------------------------
A0A2H5AIL3_E1B19K-      ----------aactttta--------------------------------
A0A0A1EUB2_E1B19K-      ----------aactttta--------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        ----------ggattttt--------------------------------
A0A0M4N3Z1_E1B19K-      ----------ggattttt--------------------------------
Q8B6X5_E1B19K-01        ----------ggattttt--------------------------------
A0A0M4NHE0_E1B19K-      ----------agattttt--------------------------------
H9AAD9_E1B19K-01        ----------agattttt--------------------------------
H9AAK5_E1B19K-01        ----------agattttt--------------------------------
H9AAH3_E1B19K-01        ----------agattttt--------------------------------
F2WTJ7_E1B19K-01        ----------ggattttt--------------------------------
F2WTM9_E1B19K-01        ----------ggattttt--------------------------------
A0A1C8EG46_E1B19K-      ----------ggattttt--------------------------------
H9AAA8_E1B19K-01        ----------ggattttt--------------------------------
H9AA76_E1B19K-01        ----------ggattttt--------------------------------
H9AAN8_E1B19K-01        ----------ggattttt--------------------------------
H9AAS0_E1B19K-01        ----------ggattttt--------------------------------
H9AAV3_E1B19K-01        ----------ggattttt--------------------------------
H9AAY5_E1B19K-01        ----------ggattttt--------------------------------
M9YVA3_E1B19K-01        ----------ggattttt--------------------------------
M9YVF6_E1B19K-01        -----------agtgttt--------------------------------
A0A0M3TH31_E1B19K-      -----------agtgttt--------------------------------
M9YXY5_E1B19K-01        -----------agtgttt--------------------------------
G0ZAH2_E1B19K-01        ----------ggactttg--------------------------------
A0A1L3INW0_E1B19K-      ----------ggattttt--------------------------------
A0A2H4CJZ0_E1B19K-      ----------ggattttt--------------------------------
H8PFZ1_E1B19K-01        ----------ggattttt--------------------------------
F6KST6_E1B19K-01        ----------ggactttt--------------------------------
F2WTG5_E1B19K-01        ----------ggacttct--------------------------------
Q695T5_E1B19K-01        ----------ggactttt--------------------------------
H9TER0_E1B19K-01        ----------ggactttt--------------------------------
Q6WQ37_E1B19K-01        ----------ggattttt--------------------------------
J9Z4N4_E1B19K-01        ----------ggattttt--------------------------------
Q71BY5_E1B19K-02        ----------ggattttt--------------------------------
E1ARN8_E1B19K-01        ----------ggattttt--------------------------------
P03246_E1B19K-01        ----------ggattttt--------------------------------
Q6VGV8_E1B19K-01        ----------ggattttt--------------------------------
A0A0G2R248_E1B19K-      ----------ggattttt--------------------------------
A0A291P1B2_E1B19K-      ----------ggattttt--------------------------------
T1UG63_E1B19K-01        ----------ggattttt--------------------------------
A0A1U9ALK7_E1B19K-      ----------ggattttt--------------------------------
P03247_E1B19K-01        ----------ggattttt--------------------------------
J9Z5H0_E1B19K-01        ----------ggattttt--------------------------------
J9Z4H6_E1B19K-01        ----------ggattttt--------------------------------
A0A2H4PJ75_E1B19K-      ----------ggattttt--------------------------------
J7I6T8_E1B19K-01        ----------ggattttt--------------------------------
A0A384ZUF2_E1B19K-      atgaattccatgatcttcatgaacatgaagttcaatggagagaagtttaa
A0A384ZUM9_E1B19K-      atgaattccatgatctttatgaatatgaagttcaatggagagaagtttaa
B9A5L5_E1B19K-01        ----------tgattttt--------------------------------
T1UGY3_E1B19K-01        ----------tgattttt--------------------------------
A0A1P7YYY5_E1B19K-      ----------tgattttt--------------------------------
A0A1P7YWY2_E1B19K-      ----------tgattttt--------------------------------
A0A1P7YWR9_E1B19K-      ----------tgattttt--------------------------------
A0A1P7YXN8_E1B19K-      ----------tgattttt--------------------------------
A0A1P8C849_E1B19K-      ----------tgattttt--------------------------------
B9A5A7_E1B19K-01        ----------tgattttt--------------------------------
T1UG22_E1B19K-01        ----------tgattttt--------------------------------
M0QVG6_E1B19K-01        ----------tgattttt--------------------------------
X4YVU5_E1B19K-01        ----------tgattttt--------------------------------
M0QUS9_E1B19K-01        ----------tgattttt--------------------------------
M0QU02_E1B19K-01        ----------tgattttt--------------------------------
A0A291B0H2_E1B19K-      ----------tgattttt--------------------------------
M0QV87_E1B19K-01        ----------tgattttt--------------------------------
T1UKV6_E1B19K-01        ----------tgattttt--------------------------------
W8VNG2_E1B19K-01        ----------tgattttt--------------------------------
F8UFP5_E1B19K-01        ----------tgattttt--------------------------------
T1UGT5_E1B19K-01        ----------tgattttt--------------------------------
T1UGX3_E1B19K-01        ----------tgattttt--------------------------------
W8CZB0_E1B19K-01        ----------tgattttt--------------------------------
G3CK71_E1B19K-01        ----------tgattttt--------------------------------
M0QTS5_E1B19K-01        ----------tgattttt--------------------------------
M0QV08_E1B19K-01        ----------tgattttt--------------------------------
G9JUV5_E1B19K-01        ----------tgattttt--------------------------------
G1FC01_E1B19K-01        ----------tgattttt--------------------------------
A0A0G2UY10_E1B19K-      ----------tgattttt--------------------------------
A0A1J0MS84_E1B19K-      ----------tgattttt--------------------------------
M0QUJ3_E1B19K-01        ----------tgattttt--------------------------------
H0PPE7_E1B19K-01        ----------tgattttt--------------------------------
T1UKP8_E1B19K-01        ----------tgattttt--------------------------------
T1UHQ8_E1B19K-01        ----------tgattttt--------------------------------
Q4KSL0_E1B19K-01        ----------tgattttt--------------------------------
T1UHG3_E1B19K-01        ----------tgattttt--------------------------------
A0A384ZUF2_E1B19K-      ----------tgattttt--------------------------------
M0QUN2_E1B19K-01        ----------tgattttt--------------------------------
E1CIM6_E1B19K-01        ----------tgattttt--------------------------------
E1AI10_E1B19K-01        ----------tgattttt--------------------------------
Q9YL99_E1B19K-01        ----------tgattttt--------------------------------
K7ZLN6_E1B19K-01        ----------tgattttt--------------------------------
E1CIR1_E1B19K-01        ----------tgattttt--------------------------------
A0A1Y1BXT7_E1B19K-      ----------tgattttt--------------------------------
T1UHH6_E1B19K-01        ----------tgattttt--------------------------------
M0QVT4_E1B19K-01        ----------tgattttt--------------------------------
T1ULJ8_E1B19K-01        ----------tgattttt--------------------------------
E9P585_E1B19K-01        ----------tgattttt--------------------------------
D4N3H6_E1B19K-01        ----------tgattttt--------------------------------
C4P207_E1B19K-01        ----------tgattttt--------------------------------
T1ULP4_E1B19K-01        ----------tgattttt--------------------------------
A0A384ZUM9_E1B19K-      ----------tgattttt--------------------------------
X4Y9D2_E1B19K-01        ----------tgattttt--------------------------------
T1UHL7_E1B19K-01        ----------tgattttt--------------------------------
B9A5Q1_E1B19K-01        ----------tgattttt--------------------------------
M0QUB4_E1B19K-01        ----------tgattttt--------------------------------
M0QVK6_E1B19K-01        ----------tgattttt--------------------------------
A0A075TSZ1_E1B19K-      ----------tgattttt--------------------------------
F1DT57_E1B19K-01        ----------tgattttt--------------------------------
M0QUF3_E1B19K-01        ----------tgattttt--------------------------------
E5RWD9_E1B19K-01        ----------tgattttt--------------------------------
E5RWL1_E1B19K-01        ----------tgattttt--------------------------------
B6DU90_E1B19K-01        ----------tgattttt--------------------------------
B9A5T7_E1B19K-01        ----------tgattttt--------------------------------
B6C6W8_E1B19K-01        ----------tgattttt--------------------------------
B9A681_E1B19K-01        ----------tgattttt--------------------------------
A0A1Y1BYF1_E1B19K-      ----------tgattttt--------------------------------
T1UHZ2_E1B19K-01        ----------tgattttt--------------------------------
B2VQE3_E1B19K-01        ----------tgattttt--------------------------------
M0QU76_E1B19K-01        ----------tgattttt--------------------------------
M0QVC7_E1B19K-01        ----------tgattttt--------------------------------
M0QU41_E1B19K-01        ----------tgattttt--------------------------------
C5HDR2_E1B19K-01        ----------tgattttt--------------------------------
D3GBW3_E1B19K-01        ----------tgattttt--------------------------------
A0A097I4T0_E1B19K-      ----------tgattttt--------------------------------
T1UK99_E1B19K-01        ----------tgattttt--------------------------------
G1FBW4_E1B19K-01        ----------tgattttt--------------------------------
T1UKQ0_E1B19K-01        ----------tgattttt--------------------------------
M0QVP5_E1B19K-01        ----------tgattttt--------------------------------
H5T740_E1B19K-01        ----------tgattttt--------------------------------
M0QUW8_E1B19K-01        ----------tgattttt--------------------------------
E1CIJ0_E1B19K-01        ----------tgattttt--------------------------------
T1UGU0_E1B19K-01        ----------tgattttt--------------------------------
M0QV47_E1B19K-01        ----------tgattttt--------------------------------

A0A097IW62_E1B19K-      --------------------gcaccc-cgggacggactattgcagctttg
A0A0M3TH18_E1B19K-      --------------------gcactc-ccggacgcactattgcagctttg
A0A1W5PVU4_E1B19K-      --------------------gtactc-ctggacgcactattgcagctttg
Q6QPF3_E1B19K-01        --------------------ctactc-ctggcagaactaccgccgcggta
Q6QPB7_E1B19K-01        --------------------ctactc-ctggcagaactaccgccgcggta
Q6QPI9_E1B19K-01        --------------------ctactc-ctggcagaactaccgccgcggta
G9G841_E1B19K-01        --------------------ctactc-ccggcagatccactgcggcagta
Q2KSM8_E1B19K-02        --------------------ctactc-ctggcagaaccactgcagcagta
Q2KSG6_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
Q2KSM8_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
A0A2L1F3A2_E1B19K-      --------------------ctactc-ctggcagaaccactgcagcagta
A0A2R3WN16_E1B19K-      --------------------ctactc-ctggcagaaccactgcagcagta
Q2KSG6_E1B19K-02        --------------------ctactc-ctggcagaaccactgcagcagta
A0A2L1F392_E1B19K-      --------------------ctactc-ctggcagaaccactgcagcagta
Q8UY91_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
P10406_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
Q5GFC7_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
A0A2R3WN62_E1B19K-      --------------------ctactc-ctggcagaaccactgcagcagta
Q5GFC8_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
Q6H1D7_E1B19K-01        --------------------ctactc-ctggcagaaccactgcagcagta
T1UJX4_E1B19K-01        --------------------caaccc-caggtagaactgccgctgctgtg
Q7T951_E1B19K-01        --------------------caaccc-caggtagaactgctgctgctgtg
T1UE63_E1B19K-01        --------------------caaccc-caggtagaactgctgctgctgtg
Q7T8D8_E1B19K-01        --------------------caaccc-caggtagaactgctgctgctgtg
Q5UW22_E1B19K-01        --------------------caaccc-caggtagaactgctgctgctgtg
Q8B8U7_E1B19K-01        --------------------caaccc-caggtagaactgctgctgctgtg
C7SRS7_E1B19K-01        --------------------cgaccc-caggtagaactgctgctgctgtg
Q32UI6_E1B19K-01        --------------------cgaccc-caggtagaactgccgctgctgtg
J7H4R9_E1B19K-01        --------------------cgaccc-caggtagaactgccgctgctgtg
D2DM83_E1B19K-01        --------------------cgaccc-caggtagaactgccgctgctgtg
J7I6W7_E1B19K-01        --------------------cgaccc-caggtagaactgccgctgctgtg
W6EIX6_E1B19K-01        --------------------caaccc-caggtagaactgccgctgctgtg
A0A1L7NRH1_E1B19K-      --------------------caaccc-caggtagaactgccgctgctgtg
Q3ZL02_E1B19K-01        --------------------caaccc-caggtagaactgccgctgctgtg
T1UFS4_E1B19K-01        --------------------caaccc-caggtagaactgccgctgctgtg
T2CI10_E1B19K-01        --------------------ctaccc-ctggtagaactgctgctgctgta
A0A0K0PX35_E1B19K-      --------------------ctactc-ctggtagaactgctgctgctgta
A0A0K0PX99_E1B19K-      --------------------ctactc-ctggtagaactgctgctgctgta
Q3ZKW2_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
Q2KRU2_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
K7NG43_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
Q2KS85_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
A0A0B4SJH1_E1B19K-      --------------------ctactc-ctggtagaactgctgctgctgta
A0A075IQ70_E1B19K-      --------------------ctactc-ctggtagaactgctgctgctgta
T1UIP3_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
R4HLE1_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
Q5EY83_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
Q2Y0J3_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
J7ID56_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
I6LEP5_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
R4HLJ6_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
R4HLA0_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
Q2KSL3_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
I6LES1_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
T1UF50_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
R4HMC6_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
I1V161_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
J7I6S4_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
A0A220VZ73_E1B19K-      --------------------ctactc-ctggtagaactgctgctgctgta
P03248_E1B19K-02        --------------------ctactc-ctggtagaactgctgctgctgta
Q6RK98_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
J7I6Q4_E1B19K-01        --------------------ctactc-ctggtagaactgctgctgctgta
A0A1S6ELT2_E1B19K-      --------------------cttccc-ccggccgtacggtttctgggctt
F4ZCJ8_E1B19K-01        --------------------cttccc-ccggccgtacggtttctgggctt
B5SNR1_E1B19K-01        --------------------cttccc-ccggccgtacggtttctgggctt
P10544_E1B19K-01        --------------------cttccc-ccggccgtacggtttctgggctt
W0S1G8_E1B19K-01        --------------------cttccc-ccggccgtacggtttctgggctt
A0A142G3J2_E1B19K-      --------------------cttctc-ctggccgtacggtttctgggctt
P10543_E1B19K-01        --------------------cttctc-ctggccgtacggtttctgggctt
D3JIR7_E1B19K-01        --------------------catctg-cagggcgaacggttgcttctatt
A0A076V686_E1B19K-      --------------------catctg-cagggcgaacggttgcttctatt
P04492_E1B19K-01        --------------------catctg-tgggacgaacggttgcttctatt
G1DE13_E1B19K-01        --------------------catctt-ctggccgaacggttgcttctatt
D0Z5R9_E1B19K-01        --------------------catctt-ctggccgaacggttgcttctatt
T1UEX7_E1B19K-01        --------------------catctt-ctggccgaacggttgcttctatt
A0A2H5AI99_E1B19K-      --------------------cttcac-ctggtcgcgtggttacctctttg
A0A0A1EUE4_E1B19K-      --------------------cgtctc-ctggccgcacggttgtttcagca
A0MK43_E1B19K-01        --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A2H5AID8_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIL0_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIC5_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AI40_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AII9_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIN5_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIU0_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIS9_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
A0A2H5AIT6_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgca
Q5C8R2_E1B19K-01        --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A2H5AI21_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A0M5L3Y4_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A0A1EUC8_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A2H5AI04_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A2H5AI72_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A2H5AIL3_E1B19K-      --------------------cgtctc-ctggtcgcacggttgcttccgct
A0A0A1EUB2_E1B19K-      --------------------cgtctc-ctggccgcacggttgcttccgct
Q71BY5_E1B19K-01        --------------------ctaatc-gaagaggtcctgtgtctgaacct
P06501_E1B19K-01        --------------------cttctc-ccggtcgggcggtcgcggctgtg
A0A0M4N3Z1_E1B19K-      --------------------cttctc-ccggtcgggcggttgcggctgta
Q8B6X5_E1B19K-01        --------------------cttctc-ccggtcgggcggttgcggctgta
A0A0M4NHE0_E1B19K-      --------------------cttctc-cgggcagagccgttgcggctatt
H9AAD9_E1B19K-01        --------------------cttctc-cgggcagagccgttgcggctatt
H9AAK5_E1B19K-01        --------------------cttctc-cgggcagagccgttgcggctatt
H9AAH3_E1B19K-01        --------------------cttctc-cgggcagagccgttgcggctatt
F2WTJ7_E1B19K-01        --------------------cctctc-cgggcagggcagttgcggccatt
F2WTM9_E1B19K-01        --------------------cctctc-cgggcagggcagttgcggccatt
A0A1C8EG46_E1B19K-      --------------------cctctc-cgggcagggcagttgcggccatt
H9AAA8_E1B19K-01        --------------------cctctc-cgggcagggcagttgcggccatc
H9AA76_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatc
H9AAN8_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatt
H9AAS0_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatt
H9AAV3_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatt
H9AAY5_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatt
M9YVA3_E1B19K-01        --------------------cctctc-cgggcagggcagtcgcggccatt
M9YVF6_E1B19K-01        --------------------gagtcaactggccgcacggttgtgtctgtg
A0A0M3TH31_E1B19K-      --------------------gagtcaactggccgcacggttgtgtccgtg
M9YXY5_E1B19K-01        --------------------gagtcaactggccgcacggttgtgtccgtg
G0ZAH2_E1B19K-01        --------------------agaata-cgggacgggtggtagctggtctt
A0A1L3INW0_E1B19K-      --------------------caactc-caggacgcgcctgttcaggtctt
A0A2H4CJZ0_E1B19K-      --------------------ctactc-ccggtcgcacggtttctgcgctt
H8PFZ1_E1B19K-01        --------------------ctactc-ccgggcgtgcggtttctgcgatt
F6KST6_E1B19K-01        --------------------cttctc-ccggtcgtctgtgttcagctctt
F2WTG5_E1B19K-01        --------------------cctctc-caggccgtctgtgttcagcgctt
Q695T5_E1B19K-01        --------------------cctctc-caggccgtctgtgttccgcgctt
H9TER0_E1B19K-01        --------------------cctctc-caggccgtctgtgttcagcgctt
Q6WQ37_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
J9Z4N4_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
Q71BY5_E1B19K-02        --------------------ccacac-cggggcgcgctgcggctgctgtt
E1ARN8_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
P03246_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
Q6VGV8_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
A0A0G2R248_E1B19K-      --------------------ccacac-cggggcgcgctgcggctgctgtt
A0A291P1B2_E1B19K-      --------------------ccacac-cggggcgcgctgcggctgctgtt
T1UG63_E1B19K-01        --------------------ccacac-cggggcgcactgcggctgctgtt
A0A1U9ALK7_E1B19K-      --------------------ccacac-cggggcgcgctgcggctgctgtt
P03247_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
J9Z5H0_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
J9Z4H6_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
A0A2H4PJ75_E1B19K-      --------------------ccacac-cggggcgcgctgcggctgctgtt
J7I6T8_E1B19K-01        --------------------ccacac-cggggcgcgctgcggctgctgtt
A0A384ZUF2_E1B19K-      tggggtgctgttcatggccaacagccacatgaccctgcatggctgcagtt
A0A384ZUM9_E1B19K-      tggggtgctgttcatggccaacagccacatgaccctgcatggctgcagct
B9A5L5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UGY3_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A1P7YYY5_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
A0A1P7YWY2_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
A0A1P7YWR9_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
A0A1P7YXN8_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
A0A1P8C849_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
B9A5A7_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UG22_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QVG6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
X4YVU5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QUS9_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt
M0QU02_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A291B0H2_E1B19K-      --------------------catctc-ccgggcgcactacagccggggtt
M0QV87_E1B19K-01        --------------------caactc-ccgggcgcactacagccggggtt
T1UKV6_E1B19K-01        --------------------catctc-ccggacgcactacagccggggtt
W8VNG2_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
F8UFP5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UGT5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UGX3_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
W8CZB0_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
G3CK71_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QTS5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QV08_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
G9JUV5_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
G1FC01_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A0G2UY10_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
A0A1J0MS84_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
M0QUJ3_E1B19K-01        --------------------ccagtc-cagggcgcactacagccggggtt
H0PPE7_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UKP8_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UHQ8_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
Q4KSL0_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UHG3_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A384ZUF2_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
M0QUN2_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E1CIM6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E1AI10_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
Q9YL99_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
K7ZLN6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E1CIR1_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A1Y1BXT7_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
T1UHH6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QVT4_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1ULJ8_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E9P585_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
D4N3H6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
C4P207_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1ULP4_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A384ZUM9_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
X4Y9D2_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
T1UHL7_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B9A5Q1_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QUB4_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QVK6_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A075TSZ1_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
F1DT57_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QUF3_E1B19K-01        --------------------caagcc-cagggcgcactacagccggggtt
E5RWD9_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E5RWL1_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B6DU90_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B9A5T7_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B6C6W8_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B9A681_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A1Y1BYF1_E1B19K-      --------------------ccagcc-cagggcgcactacagccggggtt
T1UHZ2_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
B2VQE3_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QU76_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QVC7_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
M0QU41_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
C5HDR2_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
D3GBW3_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
A0A097I4T0_E1B19K-      --------------------ccagtc-cagggcgcactacagccggggtt
T1UK99_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt
G1FBW4_E1B19K-01        --------------------ccagcc-caggccgcactacagccggtgtt
T1UKQ0_E1B19K-01        --------------------ccagcc-caggtcgcactacagccggtgtt
M0QVP5_E1B19K-01        --------------------ccagcc-cagggcgtactacagccggggtt
H5T740_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt
M0QUW8_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggggtt
E1CIJ0_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt
T1UGU0_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt
M0QV47_E1B19K-01        --------------------ccagcc-cagggcgcactacagccggtgtt

A0A097IW62_E1B19K-      gcatt---------------------------------------------
A0A0M3TH18_E1B19K-      gcttt---------------------------------------------
A0A1W5PVU4_E1B19K-      gcttt---------------------------------------------
Q6QPF3_E1B19K-01        gcctt---------------------------------------------
Q6QPB7_E1B19K-01        gcctt---------------------------------------------
Q6QPI9_E1B19K-01        gcctt---------------------------------------------
G9G841_E1B19K-01        gcctt---------------------------------------------
Q2KSM8_E1B19K-02        gcctt---------------------------------------------
Q2KSG6_E1B19K-01        gcctt---------------------------------------------
Q2KSM8_E1B19K-01        gcctt---------------------------------------------
A0A2L1F3A2_E1B19K-      gcctt---------------------------------------------
A0A2R3WN16_E1B19K-      gcctt---------------------------------------------
Q2KSG6_E1B19K-02        gcctt---------------------------------------------
A0A2L1F392_E1B19K-      gcctt---------------------------------------------
Q8UY91_E1B19K-01        gcctt---------------------------------------------
P10406_E1B19K-01        gcctt---------------------------------------------
Q5GFC7_E1B19K-01        gcctt---------------------------------------------
A0A2R3WN62_E1B19K-      gcctt---------------------------------------------
Q5GFC8_E1B19K-01        gcctt---------------------------------------------
Q6H1D7_E1B19K-01        gcctt---------------------------------------------
T1UJX4_E1B19K-01        gcttt---------------------------------------------
Q7T951_E1B19K-01        gcttt---------------------------------------------
T1UE63_E1B19K-01        gcttt---------------------------------------------
Q7T8D8_E1B19K-01        gcttt---------------------------------------------
Q5UW22_E1B19K-01        gcttt---------------------------------------------
Q8B8U7_E1B19K-01        gcttt---------------------------------------------
C7SRS7_E1B19K-01        gcttt---------------------------------------------
Q32UI6_E1B19K-01        gcttt---------------------------------------------
J7H4R9_E1B19K-01        gcttt---------------------------------------------
D2DM83_E1B19K-01        gcttt---------------------------------------------
J7I6W7_E1B19K-01        gcttt---------------------------------------------
W6EIX6_E1B19K-01        gcttt---------------------------------------------
A0A1L7NRH1_E1B19K-      gcttt---------------------------------------------
Q3ZL02_E1B19K-01        gcttt---------------------------------------------
T1UFS4_E1B19K-01        gcttt---------------------------------------------
T2CI10_E1B19K-01        gcttt---------------------------------------------
A0A0K0PX35_E1B19K-      gcctt---------------------------------------------
A0A0K0PX99_E1B19K-      gcctt---------------------------------------------
Q3ZKW2_E1B19K-01        gcttt---------------------------------------------
Q2KRU2_E1B19K-01        gcttt---------------------------------------------
K7NG43_E1B19K-01        gcttt---------------------------------------------
Q2KS85_E1B19K-01        gcttt---------------------------------------------
A0A0B4SJH1_E1B19K-      gcttt---------------------------------------------
A0A075IQ70_E1B19K-      gcttt---------------------------------------------
T1UIP3_E1B19K-01        gcttt---------------------------------------------
R4HLE1_E1B19K-01        gcttt---------------------------------------------
Q5EY83_E1B19K-01        gcttt---------------------------------------------
Q2Y0J3_E1B19K-01        gcttt---------------------------------------------
J7ID56_E1B19K-01        gcttt---------------------------------------------
I6LEP5_E1B19K-01        gcttt---------------------------------------------
R4HLJ6_E1B19K-01        gcttt---------------------------------------------
R4HLA0_E1B19K-01        gcttt---------------------------------------------
Q2KSL3_E1B19K-01        gcttt---------------------------------------------
I6LES1_E1B19K-01        gcttt---------------------------------------------
T1UF50_E1B19K-01        gcttt---------------------------------------------
R4HMC6_E1B19K-01        gcttt---------------------------------------------
I1V161_E1B19K-01        gcttt---------------------------------------------
J7I6S4_E1B19K-01        gcttt---------------------------------------------
A0A220VZ73_E1B19K-      gcttt---------------------------------------------
P03248_E1B19K-02        gcttt---------------------------------------------
Q6RK98_E1B19K-01        gcttt---------------------------------------------
J7I6Q4_E1B19K-01        gcttt---------------------------------------------
A0A1S6ELT2_E1B19K-      gcttt---------------------------------------------
F4ZCJ8_E1B19K-01        gcttt---------------------------------------------
B5SNR1_E1B19K-01        gcttt---------------------------------------------
P10544_E1B19K-01        gcttt---------------------------------------------
W0S1G8_E1B19K-01        gcttt---------------------------------------------
A0A142G3J2_E1B19K-      gcttt---------------------------------------------
P10543_E1B19K-01        gcttt---------------------------------------------
D3JIR7_E1B19K-01        gcttt---------------------------------------------
A0A076V686_E1B19K-      gcttt---------------------------------------------
P04492_E1B19K-01        gcttt---------------------------------------------
G1DE13_E1B19K-01        gcctt---------------------------------------------
D0Z5R9_E1B19K-01        gcctt---------------------------------------------
T1UEX7_E1B19K-01        gcctt---------------------------------------------
A0A2H5AI99_E1B19K-      gcttt---------------------------------------------
A0A0A1EUE4_E1B19K-      gcctt---------------------------------------------
A0MK43_E1B19K-01        gcctt---------------------------------------------
A0A2H5AID8_E1B19K-      gcctt---------------------------------------------
A0A2H5AIL0_E1B19K-      gcctt---------------------------------------------
A0A2H5AIC5_E1B19K-      gcctt---------------------------------------------
A0A2H5AI40_E1B19K-      gcctt---------------------------------------------
A0A2H5AII9_E1B19K-      gcctt---------------------------------------------
A0A2H5AIN5_E1B19K-      gcctt---------------------------------------------
A0A2H5AIU0_E1B19K-      gcctt---------------------------------------------
A0A2H5AIS9_E1B19K-      gcctt---------------------------------------------
A0A2H5AIT6_E1B19K-      gcctt---------------------------------------------
Q5C8R2_E1B19K-01        gcctt---------------------------------------------
A0A2H5AI21_E1B19K-      gcctt---------------------------------------------
A0A0M5L3Y4_E1B19K-      gcctt---------------------------------------------
A0A0A1EUC8_E1B19K-      gcctt---------------------------------------------
A0A2H5AI04_E1B19K-      gcctt---------------------------------------------
A0A2H5AI72_E1B19K-      gcctt---------------------------------------------
A0A2H5AIL3_E1B19K-      gcctt---------------------------------------------
A0A0A1EUB2_E1B19K-      gcctt---------------------------------------------
Q71BY5_E1B19K-01        g-------------------------------------------------
P06501_E1B19K-01        gcctt---------------------------------------------
A0A0M4N3Z1_E1B19K-      gcctt---------------------------------------------
Q8B6X5_E1B19K-01        gcctt---------------------------------------------
A0A0M4NHE0_E1B19K-      gcttt---------------------------------------------
H9AAD9_E1B19K-01        gcttt---------------------------------------------
H9AAK5_E1B19K-01        gcttt---------------------------------------------
H9AAH3_E1B19K-01        gcttt---------------------------------------------
F2WTJ7_E1B19K-01        gcttt---------------------------------------------
F2WTM9_E1B19K-01        gcttt---------------------------------------------
A0A1C8EG46_E1B19K-      gcttt---------------------------------------------
H9AAA8_E1B19K-01        gcttt---------------------------------------------
H9AA76_E1B19K-01        gcttt---------------------------------------------
H9AAN8_E1B19K-01        gcttt---------------------------------------------
H9AAS0_E1B19K-01        gcttt---------------------------------------------
H9AAV3_E1B19K-01        gcttt---------------------------------------------
H9AAY5_E1B19K-01        gcttt---------------------------------------------
M9YVA3_E1B19K-01        gcttt---------------------------------------------
M9YVF6_E1B19K-01        gcttt---------------------------------------------
A0A0M3TH31_E1B19K-      gcttt---------------------------------------------
M9YXY5_E1B19K-01        gcttt---------------------------------------------
G0ZAH2_E1B19K-01        gcttt---------------------------------------------
A0A1L3INW0_E1B19K-      gcctt---------------------------------------------
A0A2H4CJZ0_E1B19K-      gcctt---------------------------------------------
H8PFZ1_E1B19K-01        gcctt---------------------------------------------
F6KST6_E1B19K-01        gcgtt---------------------------------------------
F2WTG5_E1B19K-01        gcttt---------------------------------------------
Q695T5_E1B19K-01        gcttt---------------------------------------------
H9TER0_E1B19K-01        gcttt---------------------------------------------
Q6WQ37_E1B19K-01        gcttt---------------------------------------------
J9Z4N4_E1B19K-01        gcttt---------------------------------------------
Q71BY5_E1B19K-02        gcttt---------------------------------------------
E1ARN8_E1B19K-01        gcttt---------------------------------------------
P03246_E1B19K-01        gcttt---------------------------------------------
Q6VGV8_E1B19K-01        gcttt---------------------------------------------
A0A0G2R248_E1B19K-      gcttt---------------------------------------------
A0A291P1B2_E1B19K-      gcttt---------------------------------------------
T1UG63_E1B19K-01        gcttt---------------------------------------------
A0A1U9ALK7_E1B19K-      gcttt---------------------------------------------
P03247_E1B19K-01        gcttt---------------------------------------------
J9Z5H0_E1B19K-01        gcttt---------------------------------------------
J9Z4H6_E1B19K-01        gcttt---------------------------------------------
A0A2H4PJ75_E1B19K-      gcttt---------------------------------------------
J7I6T8_E1B19K-01        gcttt---------------------------------------------
A0A384ZUF2_E1B19K-      tcttcggcttcaacaatatgtgcgcagaggtctggggcgcttccaagatc
A0A384ZUM9_E1B19K-      tctttggtttcaacaacatgtgtgcagaggtctggggagctgctaagatc
B9A5L5_E1B19K-01        gcttt---------------------------------------------
T1UGY3_E1B19K-01        gcttt---------------------------------------------
A0A1P7YYY5_E1B19K-      gcttt---------------------------------------------
A0A1P7YWY2_E1B19K-      gcttt---------------------------------------------
A0A1P7YWR9_E1B19K-      gcttt---------------------------------------------
A0A1P7YXN8_E1B19K-      gcttt---------------------------------------------
A0A1P8C849_E1B19K-      gcttt---------------------------------------------
B9A5A7_E1B19K-01        gcttt---------------------------------------------
T1UG22_E1B19K-01        gcttt---------------------------------------------
M0QVG6_E1B19K-01        gcgtt---------------------------------------------
X4YVU5_E1B19K-01        gcgtt---------------------------------------------
M0QUS9_E1B19K-01        gcttt---------------------------------------------
M0QU02_E1B19K-01        gcatt---------------------------------------------
A0A291B0H2_E1B19K-      gcttt---------------------------------------------
M0QV87_E1B19K-01        gcttt---------------------------------------------
T1UKV6_E1B19K-01        gcttt---------------------------------------------
W8VNG2_E1B19K-01        gcttt---------------------------------------------
F8UFP5_E1B19K-01        gcttt---------------------------------------------
T1UGT5_E1B19K-01        gcttt---------------------------------------------
T1UGX3_E1B19K-01        gcttt---------------------------------------------
W8CZB0_E1B19K-01        gcttt---------------------------------------------
G3CK71_E1B19K-01        gcttt---------------------------------------------
M0QTS5_E1B19K-01        gcttt---------------------------------------------
M0QV08_E1B19K-01        gcttt---------------------------------------------
G9JUV5_E1B19K-01        gcttt---------------------------------------------
G1FC01_E1B19K-01        gcttt---------------------------------------------
A0A0G2UY10_E1B19K-      gcttt---------------------------------------------
A0A1J0MS84_E1B19K-      gcttt---------------------------------------------
M0QUJ3_E1B19K-01        gcttt---------------------------------------------
H0PPE7_E1B19K-01        gcttt---------------------------------------------
T1UKP8_E1B19K-01        gcttt---------------------------------------------
T1UHQ8_E1B19K-01        gcttt---------------------------------------------
Q4KSL0_E1B19K-01        gcttt---------------------------------------------
T1UHG3_E1B19K-01        gcttt---------------------------------------------
A0A384ZUF2_E1B19K-      gcttt---------------------------------------------
M0QUN2_E1B19K-01        gcttt---------------------------------------------
E1CIM6_E1B19K-01        gcttt---------------------------------------------
E1AI10_E1B19K-01        gcttt---------------------------------------------
Q9YL99_E1B19K-01        gcttt---------------------------------------------
K7ZLN6_E1B19K-01        gcttt---------------------------------------------
E1CIR1_E1B19K-01        gcttt---------------------------------------------
A0A1Y1BXT7_E1B19K-      gcttt---------------------------------------------
T1UHH6_E1B19K-01        gcttt---------------------------------------------
M0QVT4_E1B19K-01        gcttt---------------------------------------------
T1ULJ8_E1B19K-01        gcttt---------------------------------------------
E9P585_E1B19K-01        gcttt---------------------------------------------
D4N3H6_E1B19K-01        gcttt---------------------------------------------
C4P207_E1B19K-01        gcttt---------------------------------------------
T1ULP4_E1B19K-01        gcttt---------------------------------------------
A0A384ZUM9_E1B19K-      gcttt---------------------------------------------
X4Y9D2_E1B19K-01        gcttt---------------------------------------------
T1UHL7_E1B19K-01        gcttt---------------------------------------------
B9A5Q1_E1B19K-01        gcttt---------------------------------------------
M0QUB4_E1B19K-01        gcttt---------------------------------------------
M0QVK6_E1B19K-01        gcttt---------------------------------------------
A0A075TSZ1_E1B19K-      gcttt---------------------------------------------
F1DT57_E1B19K-01        gcttt---------------------------------------------
M0QUF3_E1B19K-01        gcttt---------------------------------------------
E5RWD9_E1B19K-01        gcttg---------------------------------------------
E5RWL1_E1B19K-01        gcttt---------------------------------------------
B6DU90_E1B19K-01        gcttt---------------------------------------------
B9A5T7_E1B19K-01        gcttt---------------------------------------------
B6C6W8_E1B19K-01        gcttt---------------------------------------------
B9A681_E1B19K-01        gcttt---------------------------------------------
A0A1Y1BYF1_E1B19K-      gcttt---------------------------------------------
T1UHZ2_E1B19K-01        gcttt---------------------------------------------
B2VQE3_E1B19K-01        gcttt---------------------------------------------
M0QU76_E1B19K-01        gcttt---------------------------------------------
M0QVC7_E1B19K-01        gcttt---------------------------------------------
M0QU41_E1B19K-01        gcttt---------------------------------------------
C5HDR2_E1B19K-01        gcttt---------------------------------------------
D3GBW3_E1B19K-01        gcttt---------------------------------------------
A0A097I4T0_E1B19K-      gcttt---------------------------------------------
T1UK99_E1B19K-01        gcatt---------------------------------------------
G1FBW4_E1B19K-01        gcatt---------------------------------------------
T1UKQ0_E1B19K-01        gcatt---------------------------------------------
M0QVP5_E1B19K-01        gcatt---------------------------------------------
H5T740_E1B19K-01        gcttt---------------------------------------------
M0QUW8_E1B19K-01        gcttt---------------------------------------------
E1CIJ0_E1B19K-01        gcttt---------------------------------------------
T1UGU0_E1B19K-01        gcttt---------------------------------------------
M0QV47_E1B19K-01        gcttt---------------------------------------------

A0A097IW62_E1B19K-      ------ttgtacttatattttggataggtgg----aataaggaaacccat
A0A0M3TH18_E1B19K-      ------ttgcgcttttattttagataagtgg----aataaggagactcat
A0A1W5PVU4_E1B19K-      ------ttgtgcttttattttagataagtgg----aataaggagactcat
Q6QPF3_E1B19K-01        ------ttttgcctttattcttgacaaatgg----agtcaagaaacccat
Q6QPB7_E1B19K-01        ------ttttgcctttatccttgacaaatgg----agtcaagaaacccat
Q6QPI9_E1B19K-01        ------ttttgcctttatccttgacaaatgg----agtcaagaaacccat
G9G841_E1B19K-01        ------ttttgcttttcttcttgacaaatgg----agtcaagaaacccat
Q2KSM8_E1B19K-02        ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
Q2KSG6_E1B19K-01        ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
Q2KSM8_E1B19K-01        ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
A0A2L1F3A2_E1B19K-      ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
A0A2R3WN16_E1B19K-      ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
Q2KSG6_E1B19K-02        ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
A0A2L1F392_E1B19K-      ------ttttgcttttgttcttgacaaatgg----agtcaagaaacccat
Q8UY91_E1B19K-01        ------ttttgcttttattcttgacaaatgg----agtcaagaaacccat
P10406_E1B19K-01        ------ttttgcttttatttttgacaaatgg----agtcaagaaacccat
Q5GFC7_E1B19K-01        ------ttttgcttttatttttgacaaatgg----agtcaagaaacccat
A0A2R3WN62_E1B19K-      ------ttttgcttttatttttgacaaatgg----agtcaagaaacccat
Q5GFC8_E1B19K-01        ------ttttgcttttatttttgacaaatgg----agtcaagaaacccat
Q6H1D7_E1B19K-01        ------ttttgcttttatttttgacaaatgg----agtcaagaaacccat
T1UJX4_E1B19K-01        ------tcttacttttatattagacaaatgg----atcccgcagactcat
Q7T951_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
T1UE63_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
Q7T8D8_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
Q5UW22_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
Q8B8U7_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
C7SRS7_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
Q32UI6_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
J7H4R9_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
D2DM83_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
J7I6W7_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
W6EIX6_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
A0A1L7NRH1_E1B19K-      ------tcttacttttatattagataaatgg----atcccgcagactcat
Q3ZL02_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
T1UFS4_E1B19K-01        ------tcttacttttatattagataaatgg----atcccgcagactcat
T2CI10_E1B19K-01        ------ccttacattcatatttgataaatgg----atcccacagacccac
A0A0K0PX35_E1B19K-      ------tcttacttttatattggataaatgg----atccgccaaacccac
A0A0K0PX99_E1B19K-      ------tcttacttttatattggataaatgg----atccgccaaacccac
Q3ZKW2_E1B19K-01        ------tcttacttttatattggataaatgg----atccgacaaacccac
Q2KRU2_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaacccac
K7NG43_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaacccac
Q2KS85_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaacccac
A0A0B4SJH1_E1B19K-      ------tcttacttttatattggataaatgg----atccgccaaacccac
A0A075IQ70_E1B19K-      ------tcttacttttatattggataaatgg----atccgccaaacccac
T1UIP3_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaacccac
R4HLE1_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
Q5EY83_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
Q2Y0J3_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
J7ID56_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
I6LEP5_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
R4HLJ6_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
R4HLA0_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
Q2KSL3_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
I6LES1_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
T1UF50_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
R4HMC6_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
I1V161_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
J7I6S4_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
A0A220VZ73_E1B19K-      ------tcttacttttatattggataaatgg----atccgccaaactcac
P03248_E1B19K-02        ------tcttacttttatattggataaatgg----atccgccaaactcac
Q6RK98_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
J7I6Q4_E1B19K-01        ------tcttacttttatattggataaatgg----atccgccaaactcac
A0A1S6ELT2_E1B19K-      ------catttgttttatattggatcaatgg----agcgcccaaacccat
F4ZCJ8_E1B19K-01        ------catttgttttatattggatcaatgg----agcgcccaaacccat
B5SNR1_E1B19K-01        ------catttgttttatattggatcaatgg----agcgcccaaacccat
P10544_E1B19K-01        ------catttgttttatattggatcaatgg----agcgcccaaacccat
W0S1G8_E1B19K-01        ------catttgttttatattggatcaatgg----agcgcccaaacccat
A0A142G3J2_E1B19K-      ------tatttgttttatattggatcaatgg----agcgcccaaactcat
P10543_E1B19K-01        ------tatttgttttatattggatcaatgg----agcgcccaaactcat
D3JIR7_E1B19K-01        ------tttggtaaccgttttagataaatgg----agccagacgtcccag
A0A076V686_E1B19K-      ------tttggtaaccgttttggataaatgg----agccaggcatcccag
P04492_E1B19K-01        ------tttggcaaccatattggataaatgg----agcgagaaatcccac
G1DE13_E1B19K-01        ------tttggtaaccgtgttggataaatgg----agcgagaggtcccac
D0Z5R9_E1B19K-01        ------tttggcaaccgtgttggataaatgg----agcgagaggtcccac
T1UEX7_E1B19K-01        ------tttggcaaccgtgttggataaatgg----agcgagaggtcccac
A0A2H5AI99_E1B19K-      ------tatctgccaccttttggataaatgg-ag---cagcgacagccac
A0A0A1EUE4_E1B19K-      ------tattacctatattttggatcaatgg-agcagcagcggcagccac
A0MK43_E1B19K-01        ------tattacctatattttggatcaatgg-agcaacagcgacagccac
A0A2H5AID8_E1B19K-      ------tgttgcttatattttggatcaatgg-agcaacagcgacagccac
A0A2H5AIL0_E1B19K-      ------tgttgcttatattttggatcaatgg-agcaacagcgacagccac
A0A2H5AIC5_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcgacagccac
A0A2H5AI40_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcaacagccac
A0A2H5AII9_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcaacagccac
A0A2H5AIN5_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcaacagccac
A0A2H5AIU0_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcaacagccac
A0A2H5AIS9_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcgacagccat
A0A2H5AIT6_E1B19K-      ------tgttgcctatattttggatcaatgg-agcaacagcgacagccac
Q5C8R2_E1B19K-01        ------tattacctatattttggatcaatgg-agcaacagcgacagccac
A0A2H5AI21_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcgacagccac
A0A0M5L3Y4_E1B19K-      ------tatcacctatattttggatcaatgg-agcaacagcgacagccac
A0A0A1EUC8_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcggcagtcac
A0A2H5AI04_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcggcagtcac
A0A2H5AI72_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcggcagtcac
A0A2H5AIL3_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcggcagtcac
A0A0A1EUB2_E1B19K-      ------tattacctatattttggatcaatgg-agcaacagcggcagccac
Q71BY5_E1B19K-01        -----------------------------------agc------------
P06501_E1B19K-01        ------tgcttcctacctgctggatagatgg----aacacccggacccac
A0A0M4N3Z1_E1B19K-      ------tgcttcctacctgctggatagatgg----aacacccggacccac
Q8B6X5_E1B19K-01        ------tgcttcctacctgctggatagatgg----aacacccggacccac
A0A0M4NHE0_E1B19K-      ------tgccgcctttttgctggatagatgg----aacgcccagacccag
H9AAD9_E1B19K-01        ------tgccgcctttttgctggatagatgg----aacgcccagacccag
H9AAK5_E1B19K-01        ------tgccgcctttttgctggatagatgg----aacgcccagacccag
H9AAH3_E1B19K-01        ------tgccgcctttttgctggatagatgg----aacgcccagacccag
F2WTJ7_E1B19K-01        ------tgccgcctttattttggatagatgg----aacagccagacccag
F2WTM9_E1B19K-01        ------tgccgcctttattttggatagatgg----aacagccagacccag
A0A1C8EG46_E1B19K-      ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AAA8_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AA76_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AAN8_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AAS0_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AAV3_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
H9AAY5_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
M9YVA3_E1B19K-01        ------tgccgcctttattttggatagatgg----aacacccagacccag
M9YVF6_E1B19K-01        ------tatctgttttcttttggataaatgg----agcagcgacagccac
A0A0M3TH31_E1B19K-      ------tatctgttttcttttggataaatgg----agcagcgacagccac
M9YXY5_E1B19K-01        ------tatctgttttcttttggataaatgg----agcagcgacagccac
G0ZAH2_E1B19K-01        ------cctcgcgtacctgctcgatcggtgg----gacgagaacagcgtc
A0A1L3INW0_E1B19K-      ------tgttgtgcatttactggacagatgg----aaccaggagacgtac
A0A2H4CJZ0_E1B19K-      ------catctgctttgtgctagatcgatgg----agcgcccaaacccgc
H8PFZ1_E1B19K-01        ------catctgctttgtgctagatcgatgg----agcgcccaaacccgc
F6KST6_E1B19K-01        ------tgtggttcatctgttagacagatgg----aacgagcagacgcag
F2WTG5_E1B19K-01        ------tgctgtacatctgttggacagatgg----aacgagcagacgcag
Q695T5_E1B19K-01        ------tgctgtacatctgttggacagatgg----aacgagcagacgcag
H9TER0_E1B19K-01        ------tgctgtacatctgttggacagatgg----aacgagcagacgcag
Q6WQ37_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
J9Z4N4_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
Q71BY5_E1B19K-02        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
E1ARN8_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
P03246_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
Q6VGV8_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
A0A0G2R248_E1B19K-      ------tttgagttttataaaggataaatgg----agcgaagaaacccat
A0A291P1B2_E1B19K-      ------tttgagttttataaaggataaatgg----agcgaagaaacccat
T1UG63_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
A0A1U9ALK7_E1B19K-      ------tttgagttttataaaggataaatgg----agcgaagaaacccat
P03247_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
J9Z5H0_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
J9Z4H6_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
A0A2H4PJ75_E1B19K-      ------tttgagttttataaaggataaatgg----agcgaagaaacccat
J7I6T8_E1B19K-01        ------tttgagttttataaaggataaatgg----agcgaagaaacccat
A0A384ZUF2_E1B19K-      aggggatgtaagttttatggctgctggatgggcgtggtcggaagacccaa
A0A384ZUM9_E1B19K-      aggggctgtaagttttatggctgctggatgggagtggtcggaagacccaa
B9A5L5_E1B19K-01        ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
T1UGY3_E1B19K-01        ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
A0A1P7YYY5_E1B19K-      ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
A0A1P7YWY2_E1B19K-      ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
A0A1P7YWR9_E1B19K-      ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
A0A1P7YXN8_E1B19K-      ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
A0A1P8C849_E1B19K-      ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
B9A5A7_E1B19K-01        ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
T1UG22_E1B19K-01        ------tgtggtttttttggttgacaaatgg----agccaggacacccaa
M0QVG6_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccat
X4YVU5_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccat
M0QUS9_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QU02_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
A0A291B0H2_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QV87_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1UKV6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
W8VNG2_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
F8UFP5_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
T1UGT5_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
T1UGX3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
W8CZB0_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
G3CK71_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QTS5_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QV08_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
G9JUV5_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
G1FC01_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
A0A0G2UY10_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
A0A1J0MS84_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QUJ3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
H0PPE7_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1UKP8_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1UHQ8_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
Q4KSL0_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1UHG3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
A0A384ZUF2_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QUN2_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
E1CIM6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
E1AI10_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
Q9YL99_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
K7ZLN6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
E1CIR1_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
A0A1Y1BXT7_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1UHH6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QVT4_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1ULJ8_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
E9P585_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
D4N3H6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
C4P207_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
T1ULP4_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
A0A384ZUM9_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
X4Y9D2_E1B19K-01        ------tgtggtttttctggttgacaaatgg----cgccaggacacccaa
T1UHL7_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
B9A5Q1_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QUB4_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
M0QVK6_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
A0A075TSZ1_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccaggacacccaa
F1DT57_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QUF3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
E5RWD9_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
E5RWL1_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
B6DU90_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
B9A5T7_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
B6C6W8_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
B9A681_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
A0A1Y1BYF1_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
T1UHZ2_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
B2VQE3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QU76_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QVC7_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
M0QU41_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
C5HDR2_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
D3GBW3_E1B19K-01        ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
A0A097I4T0_E1B19K-      ------tgtggtttttctggttgacaaatgg----agccagaacacccaa
T1UK99_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
G1FBW4_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
T1UKQ0_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
M0QVP5_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
H5T740_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
M0QUW8_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
E1CIJ0_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
T1UGU0_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac
M0QV47_E1B19K-01        ------tgtggtgtttctggttgacaaatgg----agccagcaaacccac

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
P03246_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      gagcgagatgtctgtgaagcagtgtgtgtttgagaaatgctacctgggag
A0A384ZUM9_E1B19K-      gagcgagatgtctgtgaagcagtgtgtgtttgagaagtgctacctggggg
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------

A0A097IW62_E1B19K-      -----------------------------------------ctgagtgct
A0A0M3TH18_E1B19K-      -----------------------------------------ctcagtaaa
A0A1W5PVU4_E1B19K-      -----------------------------------------ctgagtaga
Q6QPF3_E1B19K-01        -----------------------------------------ttcagcagg
Q6QPB7_E1B19K-01        -----------------------------------------ttcagcagg
Q6QPI9_E1B19K-01        -----------------------------------------ttcagcagg
G9G841_E1B19K-01        -----------------------------------------ttcagcagg
Q2KSM8_E1B19K-02        -----------------------------------------ttcagcagg
Q2KSG6_E1B19K-01        -----------------------------------------ttcagcagg
Q2KSM8_E1B19K-01        -----------------------------------------ttcagcagg
A0A2L1F3A2_E1B19K-      -----------------------------------------ttcagcagg
A0A2R3WN16_E1B19K-      -----------------------------------------ttcagcagg
Q2KSG6_E1B19K-02        -----------------------------------------ttcagcagg
A0A2L1F392_E1B19K-      -----------------------------------------ttcagcagg
Q8UY91_E1B19K-01        -----------------------------------------ttcagcagg
P10406_E1B19K-01        -----------------------------------------ttcagcagg
Q5GFC7_E1B19K-01        -----------------------------------------ttcagcagg
A0A2R3WN62_E1B19K-      -----------------------------------------ttcagcagg
Q5GFC8_E1B19K-01        -----------------------------------------ttcagcagg
Q6H1D7_E1B19K-01        -----------------------------------------ttcagcagg
T1UJX4_E1B19K-01        -----------------------------------------ttcagcagg
Q7T951_E1B19K-01        -----------------------------------------ttcagcagg
T1UE63_E1B19K-01        -----------------------------------------ttcagcagg
Q7T8D8_E1B19K-01        -----------------------------------------ttcagcagg
Q5UW22_E1B19K-01        -----------------------------------------ttcagcagg
Q8B8U7_E1B19K-01        -----------------------------------------ttcagcagg
C7SRS7_E1B19K-01        -----------------------------------------ttcagcagg
Q32UI6_E1B19K-01        -----------------------------------------ttcagcagg
J7H4R9_E1B19K-01        -----------------------------------------ttcagcagg
D2DM83_E1B19K-01        -----------------------------------------ttcagcagg
J7I6W7_E1B19K-01        -----------------------------------------ttcagcagg
W6EIX6_E1B19K-01        -----------------------------------------ttcagcagg
A0A1L7NRH1_E1B19K-      -----------------------------------------ttcagcagg
Q3ZL02_E1B19K-01        -----------------------------------------ttcagcagg
T1UFS4_E1B19K-01        -----------------------------------------ttcagcagg
T2CI10_E1B19K-01        -----------------------------------------ttcagcaag
A0A0K0PX35_E1B19K-      -----------------------------------------ttcagcaag
A0A0K0PX99_E1B19K-      -----------------------------------------ttcagcagg
Q3ZKW2_E1B19K-01        -----------------------------------------ttcagcaag
Q2KRU2_E1B19K-01        -----------------------------------------ttcagcaag
K7NG43_E1B19K-01        -----------------------------------------ttcagcaag
Q2KS85_E1B19K-01        -----------------------------------------ttcagcaag
A0A0B4SJH1_E1B19K-      -----------------------------------------ttcagcaag
A0A075IQ70_E1B19K-      -----------------------------------------ttcagcaag
T1UIP3_E1B19K-01        -----------------------------------------ttcagcaag
R4HLE1_E1B19K-01        -----------------------------------------ttcagcaag
Q5EY83_E1B19K-01        -----------------------------------------ttcagcaag
Q2Y0J3_E1B19K-01        -----------------------------------------ttcagcaag
J7ID56_E1B19K-01        -----------------------------------------ttcagcaag
I6LEP5_E1B19K-01        -----------------------------------------ttcagcaag
R4HLJ6_E1B19K-01        -----------------------------------------ttcagcaag
R4HLA0_E1B19K-01        -----------------------------------------ttcagcaag
Q2KSL3_E1B19K-01        -----------------------------------------ttcagcaag
I6LES1_E1B19K-01        -----------------------------------------ttcagcaag
T1UF50_E1B19K-01        -----------------------------------------ttcagcaag
R4HMC6_E1B19K-01        -----------------------------------------ttcagcaag
I1V161_E1B19K-01        -----------------------------------------ttcagcaag
J7I6S4_E1B19K-01        -----------------------------------------ttcagcaag
A0A220VZ73_E1B19K-      -----------------------------------------ttcagcaag
P03248_E1B19K-02        -----------------------------------------ttcagcaag
Q6RK98_E1B19K-01        -----------------------------------------ttcagcaag
J7I6Q4_E1B19K-01        -----------------------------------------ttcagcaag
A0A1S6ELT2_E1B19K-      -----------------------------------------ctgtcggag
F4ZCJ8_E1B19K-01        -----------------------------------------ctgtcggag
B5SNR1_E1B19K-01        -----------------------------------------ctgtcggag
P10544_E1B19K-01        -----------------------------------------ctgtcggag
W0S1G8_E1B19K-01        -----------------------------------------ctgtcggag
A0A142G3J2_E1B19K-      -----------------------------------------ctgtcgcag
P10543_E1B19K-01        -----------------------------------------ctgtcgcag
D3JIR7_E1B19K-01        -----------------------------------------ctgagttgg
A0A076V686_E1B19K-      -----------------------------------------ctcagttgg
P04492_E1B19K-01        -----------------------------------------ctgagttgg
G1DE13_E1B19K-01        -----------------------------------------ctgagctgg
D0Z5R9_E1B19K-01        -----------------------------------------ctgagctgg
T1UEX7_E1B19K-01        -----------------------------------------ctgagctgg
A0A2H5AI99_E1B19K-      -----------------------------------------ctgtcatgg
A0A0A1EUE4_E1B19K-      -----------------------------------------ctgtcgtgg
A0MK43_E1B19K-01        -----------------------------------------ctgtcgtgg
A0A2H5AID8_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIL0_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIC5_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AI40_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AII9_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIN5_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIU0_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIS9_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIT6_E1B19K-      -----------------------------------------ctgtcgtgg
Q5C8R2_E1B19K-01        -----------------------------------------ctgtcgtgg
A0A2H5AI21_E1B19K-      -----------------------------------------ctgtcgtgg
A0A0M5L3Y4_E1B19K-      -----------------------------------------ctgtcgtgg
A0A0A1EUC8_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AI04_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AI72_E1B19K-      -----------------------------------------ctgtcgtgg
A0A2H5AIL3_E1B19K-      -----------------------------------------ctgtcgtgg
A0A0A1EUB2_E1B19K-      -----------------------------------------ctgtcgtgg
Q71BY5_E1B19K-01        -----------------------------------------ctgagcccg
P06501_E1B19K-01        -----------------------------------------ctgtccccg
A0A0M4N3Z1_E1B19K-      -----------------------------------------ctgtccccg
Q8B6X5_E1B19K-01        -----------------------------------------ctgtccccg
A0A0M4NHE0_E1B19K-      -----------------------------------------ctgtccccg
H9AAD9_E1B19K-01        -----------------------------------------ctgtccccg
H9AAK5_E1B19K-01        -----------------------------------------ctgtccccg
H9AAH3_E1B19K-01        -----------------------------------------ctgtccccg
F2WTJ7_E1B19K-01        -----------------------------------------ctgtccccg
F2WTM9_E1B19K-01        -----------------------------------------ctgtccccg
A0A1C8EG46_E1B19K-      -----------------------------------------ctgtccccg
H9AAA8_E1B19K-01        -----------------------------------------ctgtccccg
H9AA76_E1B19K-01        -----------------------------------------ctgtccccg
H9AAN8_E1B19K-01        -----------------------------------------ctgtccccg
H9AAS0_E1B19K-01        -----------------------------------------ctgtccccg
H9AAV3_E1B19K-01        -----------------------------------------ctgtccccg
H9AAY5_E1B19K-01        -----------------------------------------ctgtccccg
M9YVA3_E1B19K-01        -----------------------------------------ctgtccccg
M9YVF6_E1B19K-01        -----------------------------------------ctgtcgtgg
A0A0M3TH31_E1B19K-      -----------------------------------------ctgtcgtgg
M9YXY5_E1B19K-01        -----------------------------------------ctgtcgtgg
G0ZAH2_E1B19K-01        -----------------------------------------ctcagcccg
A0A1L3INW0_E1B19K-      -----------------------------------------ctgagcccg
A0A2H4CJZ0_E1B19K-      -----------------------------------------ctgagcccg
H8PFZ1_E1B19K-01        -----------------------------------------ctgagcccg
F6KST6_E1B19K-01        -----------------------------------------ctgagcccg
F2WTG5_E1B19K-01        -----------------------------------------ctcagcccg
Q695T5_E1B19K-01        -----------------------------------------ctcagcccg
H9TER0_E1B19K-01        -----------------------------------------ctcagcccg
Q6WQ37_E1B19K-01        -----------------------------------------ctgagcggg
J9Z4N4_E1B19K-01        -----------------------------------------ctgagcggg
Q71BY5_E1B19K-02        -----------------------------------------ctgagcggg
E1ARN8_E1B19K-01        -----------------------------------------ctgagcggg
P03246_E1B19K-01        -----------------------------------------ctgagcggg
Q6VGV8_E1B19K-01        -----------------------------------------ctgagcggg
A0A0G2R248_E1B19K-      -----------------------------------------ctgagcggg
A0A291P1B2_E1B19K-      -----------------------------------------ctgagcggg
T1UG63_E1B19K-01        -----------------------------------------ctgagcggg
A0A1U9ALK7_E1B19K-      -----------------------------------------ctgagcggg
P03247_E1B19K-01        -----------------------------------------ctgagcggg
J9Z5H0_E1B19K-01        -----------------------------------------ctgagcggg
J9Z4H6_E1B19K-01        -----------------------------------------ctgagcggg
A0A2H4PJ75_E1B19K-      -----------------------------------------ctgagcggg
J7I6T8_E1B19K-01        -----------------------------------------ctgagcggg
A0A384ZUF2_E1B19K-      tctctaccgagggcaatgctagagtgagacactgctcttccctggagacg
A0A384ZUM9_E1B19K-      tgtctaccgagggcaatgctagagtgagacactgctcttccctggagacg
B9A5L5_E1B19K-01        -----------------------------------------ctaagcagg
T1UGY3_E1B19K-01        -----------------------------------------ctaagcagg
A0A1P7YYY5_E1B19K-      -----------------------------------------ctaagcagg
A0A1P7YWY2_E1B19K-      -----------------------------------------ctaagcagg
A0A1P7YWR9_E1B19K-      -----------------------------------------ctaagcagg
A0A1P7YXN8_E1B19K-      -----------------------------------------ctaagcagg
A0A1P8C849_E1B19K-      -----------------------------------------ctaagcagg
B9A5A7_E1B19K-01        -----------------------------------------ctaagcagg
T1UG22_E1B19K-01        -----------------------------------------ctaagcagg
M0QVG6_E1B19K-01        -----------------------------------------ctgaccagg
X4YVU5_E1B19K-01        -----------------------------------------ctgaccagg
M0QUS9_E1B19K-01        -----------------------------------------ctgagcagg
M0QU02_E1B19K-01        -----------------------------------------ctgagcagg
A0A291B0H2_E1B19K-      -----------------------------------------ctgagcagg
M0QV87_E1B19K-01        -----------------------------------------ctgagcagg
T1UKV6_E1B19K-01        -----------------------------------------ctgagcagg
W8VNG2_E1B19K-01        -----------------------------------------ctgagcagg
F8UFP5_E1B19K-01        -----------------------------------------ctgagcagg
T1UGT5_E1B19K-01        -----------------------------------------ctgagcagg
T1UGX3_E1B19K-01        -----------------------------------------ctgagcagg
W8CZB0_E1B19K-01        -----------------------------------------ctgagcagg
G3CK71_E1B19K-01        -----------------------------------------ctgagcagg
M0QTS5_E1B19K-01        -----------------------------------------ctgagcagg
M0QV08_E1B19K-01        -----------------------------------------ctgagcagg
G9JUV5_E1B19K-01        -----------------------------------------ctgagcagg
G1FC01_E1B19K-01        -----------------------------------------ctgagcagg
A0A0G2UY10_E1B19K-      -----------------------------------------ctgagcagg
A0A1J0MS84_E1B19K-      -----------------------------------------ctgagcagg
M0QUJ3_E1B19K-01        -----------------------------------------ctgagcagg
H0PPE7_E1B19K-01        -----------------------------------------ctgagcagg
T1UKP8_E1B19K-01        -----------------------------------------ctgagcagg
T1UHQ8_E1B19K-01        -----------------------------------------ctgagcagg
Q4KSL0_E1B19K-01        -----------------------------------------ctgagcagg
T1UHG3_E1B19K-01        -----------------------------------------ctgagcagg
A0A384ZUF2_E1B19K-      -----------------------------------------ctgagcagg
M0QUN2_E1B19K-01        -----------------------------------------ctgagcagg
E1CIM6_E1B19K-01        -----------------------------------------ctgagcagg
E1AI10_E1B19K-01        -----------------------------------------ctgagcagg
Q9YL99_E1B19K-01        -----------------------------------------ctgagcagg
K7ZLN6_E1B19K-01        -----------------------------------------ctgagcagg
E1CIR1_E1B19K-01        -----------------------------------------ctgagcagg
A0A1Y1BXT7_E1B19K-      -----------------------------------------ctgagcagg
T1UHH6_E1B19K-01        -----------------------------------------ctgagcagg
M0QVT4_E1B19K-01        -----------------------------------------ctgagcagg
T1ULJ8_E1B19K-01        -----------------------------------------ctgagcagg
E9P585_E1B19K-01        -----------------------------------------ctgagcagg
D4N3H6_E1B19K-01        -----------------------------------------ctgagcagg
C4P207_E1B19K-01        -----------------------------------------ctgagcagg
T1ULP4_E1B19K-01        -----------------------------------------ctgagcagg
A0A384ZUM9_E1B19K-      -----------------------------------------ctgagcagg
X4Y9D2_E1B19K-01        -----------------------------------------ctgagcagg
T1UHL7_E1B19K-01        -----------------------------------------ctgagcagg
B9A5Q1_E1B19K-01        -----------------------------------------ctgagcagg
M0QUB4_E1B19K-01        -----------------------------------------ctgagcagg
M0QVK6_E1B19K-01        -----------------------------------------ctgagcagg
A0A075TSZ1_E1B19K-      -----------------------------------------ctgagcagg
F1DT57_E1B19K-01        -----------------------------------------ctgagcagg
M0QUF3_E1B19K-01        -----------------------------------------ctgagcagg
E5RWD9_E1B19K-01        -----------------------------------------ctgagcagg
E5RWL1_E1B19K-01        -----------------------------------------ctgagcagg
B6DU90_E1B19K-01        -----------------------------------------ctgagcagg
B9A5T7_E1B19K-01        -----------------------------------------ctgagcagg
B6C6W8_E1B19K-01        -----------------------------------------ctgagcagg
B9A681_E1B19K-01        -----------------------------------------ctgagcagg
A0A1Y1BYF1_E1B19K-      -----------------------------------------ctgagcagg
T1UHZ2_E1B19K-01        -----------------------------------------ctgagcagg
B2VQE3_E1B19K-01        -----------------------------------------ctgagcagg
M0QU76_E1B19K-01        -----------------------------------------ctgagcagg
M0QVC7_E1B19K-01        -----------------------------------------ctgagcagg
M0QU41_E1B19K-01        -----------------------------------------ctgagcagg
C5HDR2_E1B19K-01        -----------------------------------------ctgagcagg
D3GBW3_E1B19K-01        -----------------------------------------ctgagcagg
A0A097I4T0_E1B19K-      -----------------------------------------ctgagcagg
T1UK99_E1B19K-01        -----------------------------------------ttaaccagg
G1FBW4_E1B19K-01        -----------------------------------------ctaaccagg
T1UKQ0_E1B19K-01        -----------------------------------------ttaaccagg
M0QVP5_E1B19K-01        -----------------------------------------ctaaccagg
H5T740_E1B19K-01        -----------------------------------------ctaaccagg
M0QUW8_E1B19K-01        -----------------------------------------ctaaccagg
E1CIJ0_E1B19K-01        -----------------------------------------ctaaccagg
T1UGU0_E1B19K-01        -----------------------------------------ctaaccagg
M0QV47_E1B19K-01        -----------------------------------------ctaaccagg

A0A097IW62_E1B19K-      ggtt--------------------acacttt-------------------
A0A0M3TH18_E1B19K-      ggat--------------------atacttt-------------------
A0A1W5PVU4_E1B19K-      ggat--------------------atacttt-------------------
Q6QPF3_E1B19K-01        gatt--------------------accgtct-------------------
Q6QPB7_E1B19K-01        gatt--------------------accgtct-------------------
Q6QPI9_E1B19K-01        gatt--------------------accgtct-------------------
G9G841_E1B19K-01        gatt--------------------accagct-------------------
Q2KSM8_E1B19K-02        gatt--------------------accagtt-------------------
Q2KSG6_E1B19K-01        gatt--------------------accagtt-------------------
Q2KSM8_E1B19K-01        gatt--------------------accagtt-------------------
A0A2L1F3A2_E1B19K-      gatt--------------------accagtt-------------------
A0A2R3WN16_E1B19K-      gatt--------------------accagtt-------------------
Q2KSG6_E1B19K-02        gatt--------------------accagtt-------------------
A0A2L1F392_E1B19K-      gatt--------------------accagtt-------------------
Q8UY91_E1B19K-01        gatt--------------------accagct-------------------
P10406_E1B19K-01        gatt--------------------accagct-------------------
Q5GFC7_E1B19K-01        gatt--------------------accagct-------------------
A0A2R3WN62_E1B19K-      gatt--------------------accagct-------------------
Q5GFC8_E1B19K-01        gatt--------------------accagct-------------------
Q6H1D7_E1B19K-01        gatt--------------------accagct-------------------
T1UJX4_E1B19K-01        ggat--------------------acgtttt-------------------
Q7T951_E1B19K-01        ggat--------------------acgtttt-------------------
T1UE63_E1B19K-01        ggat--------------------acgtttt-------------------
Q7T8D8_E1B19K-01        ggat--------------------acgtttt-------------------
Q5UW22_E1B19K-01        ggat--------------------acgtttt-------------------
Q8B8U7_E1B19K-01        ggat--------------------acgtttt-------------------
C7SRS7_E1B19K-01        ggat--------------------acgtttt-------------------
Q32UI6_E1B19K-01        ggat--------------------acgtttt-------------------
J7H4R9_E1B19K-01        ggat--------------------acgtttt-------------------
D2DM83_E1B19K-01        ggat--------------------acgtttt-------------------
J7I6W7_E1B19K-01        ggat--------------------acgtttt-------------------
W6EIX6_E1B19K-01        ggat--------------------acgtttt-------------------
A0A1L7NRH1_E1B19K-      ggat--------------------acgtttt-------------------
Q3ZL02_E1B19K-01        ggat--------------------acgtttt-------------------
T1UFS4_E1B19K-01        ggat--------------------acgtttt-------------------
T2CI10_E1B19K-01        ggat--------------------acgtttt-------------------
A0A0K0PX35_E1B19K-      ggat--------------------acgtttt-------------------
A0A0K0PX99_E1B19K-      ggat--------------------acgtttt-------------------
Q3ZKW2_E1B19K-01        ggat--------------------acgtttt-------------------
Q2KRU2_E1B19K-01        ggat--------------------acgtttt-------------------
K7NG43_E1B19K-01        ggat--------------------acgtttt-------------------
Q2KS85_E1B19K-01        ggat--------------------acgtttt-------------------
A0A0B4SJH1_E1B19K-      ggat--------------------acgtttt-------------------
A0A075IQ70_E1B19K-      ggat--------------------acgtttt-------------------
T1UIP3_E1B19K-01        ggat--------------------acgtttt-------------------
R4HLE1_E1B19K-01        ggat--------------------acgtttt-------------------
Q5EY83_E1B19K-01        ggat--------------------acgtttt-------------------
Q2Y0J3_E1B19K-01        ggat--------------------acgtttt-------------------
J7ID56_E1B19K-01        ggat--------------------acgtttt-------------------
I6LEP5_E1B19K-01        ggat--------------------acgtttt-------------------
R4HLJ6_E1B19K-01        ggat--------------------acgtttt-------------------
R4HLA0_E1B19K-01        ggat--------------------acgtttt-------------------
Q2KSL3_E1B19K-01        ggat--------------------acgtttt-------------------
I6LES1_E1B19K-01        ggat--------------------acgtttt-------------------
T1UF50_E1B19K-01        ggat--------------------acgtttt-------------------
R4HMC6_E1B19K-01        ggat--------------------acgtttt-------------------
I1V161_E1B19K-01        ggat--------------------acgtttt-------------------
J7I6S4_E1B19K-01        ggat--------------------acgtttt-------------------
A0A220VZ73_E1B19K-      ggat--------------------acgtttt-------------------
P03248_E1B19K-02        ggat--------------------acgtttt-------------------
Q6RK98_E1B19K-01        ggat--------------------acgtttt-------------------
J7I6Q4_E1B19K-01        ggat--------------------acgtttt-------------------
A0A1S6ELT2_E1B19K-      gggt--------------------atactct-------------------
F4ZCJ8_E1B19K-01        gggt--------------------atactct-------------------
B5SNR1_E1B19K-01        ggat--------------------atactct-------------------
P10544_E1B19K-01        ggat--------------------atactct-------------------
W0S1G8_E1B19K-01        gggt--------------------atactct-------------------
A0A142G3J2_E1B19K-      ggtt--------------------atactct-------------------
P10543_E1B19K-01        ggtt--------------------atactct-------------------
D3JIR7_E1B19K-01        gatt--------------------acatgct-------------------
A0A076V686_E1B19K-      gact--------------------atatgct-------------------
P04492_E1B19K-01        gatt--------------------acatgct-------------------
G1DE13_E1B19K-01        gatt--------------------acatgct-------------------
D0Z5R9_E1B19K-01        gatt--------------------acatgct-------------------
T1UEX7_E1B19K-01        gatt--------------------acatgct-------------------
A0A2H5AI99_E1B19K-      aatt--------------------acatgct-------------------
A0A0A1EUE4_E1B19K-      gatt--------------------acatgct-------------------
A0MK43_E1B19K-01        gagt--------------------acatgct-------------------
A0A2H5AID8_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIL0_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIC5_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AI40_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AII9_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIN5_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIU0_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIS9_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIT6_E1B19K-      gagt--------------------acatgct-------------------
Q5C8R2_E1B19K-01        gagt--------------------acatgct-------------------
A0A2H5AI21_E1B19K-      gagt--------------------acatgct-------------------
A0A0M5L3Y4_E1B19K-      gagt--------------------acatgct-------------------
A0A0A1EUC8_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AI04_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AI72_E1B19K-      gagt--------------------acatgct-------------------
A0A2H5AIL3_E1B19K-      gagt--------------------acatgct-------------------
A0A0A1EUB2_E1B19K-      gagt--------------------acatgct-------------------
Q71BY5_E1B19K-01        agcc--------------------agaacc--------------------
P06501_E1B19K-01        gggt--------------------accagat-------------------
A0A0M4N3Z1_E1B19K-      gggt--------------------accagat-------------------
Q8B6X5_E1B19K-01        gggt--------------------accagat-------------------
A0A0M4NHE0_E1B19K-      gggt--------------------acaccct-------------------
H9AAD9_E1B19K-01        gggt--------------------acaccct-------------------
H9AAK5_E1B19K-01        gggt--------------------acaccct-------------------
H9AAH3_E1B19K-01        gggt--------------------acaccct-------------------
F2WTJ7_E1B19K-01        gggt--------------------acaccct-------------------
F2WTM9_E1B19K-01        gggt--------------------acaccct-------------------
A0A1C8EG46_E1B19K-      gggt--------------------acaccct-------------------
H9AAA8_E1B19K-01        gggt--------------------acaccct-------------------
H9AA76_E1B19K-01        gggt--------------------acaccct-------------------
H9AAN8_E1B19K-01        gggt--------------------acaccct-------------------
H9AAS0_E1B19K-01        gggt--------------------acaccct-------------------
H9AAV3_E1B19K-01        gggt--------------------acaccct-------------------
H9AAY5_E1B19K-01        gggt--------------------acaccct-------------------
M9YVA3_E1B19K-01        gggt--------------------acaccct-------------------
M9YVF6_E1B19K-01        gatt--------------------acatgct-------------------
A0A0M3TH31_E1B19K-      gatt--------------------acatgct-------------------
M9YXY5_E1B19K-01        gatt--------------------acatgct-------------------
G0ZAH2_E1B19K-01        ggct--------------------accgcct-------------------
A0A1L3INW0_E1B19K-      gggt--------------------acaccct-------------------
A0A2H4CJZ0_E1B19K-      gggt--------------------acaccct-------------------
H8PFZ1_E1B19K-01        gggt--------------------acaccct-------------------
F6KST6_E1B19K-01        ggtt--------------------acacgct-------------------
F2WTG5_E1B19K-01        ggct--------------------acactct-------------------
Q695T5_E1B19K-01        ggtt--------------------atactct-------------------
H9TER0_E1B19K-01        ggtt--------------------acactct-------------------
Q6WQ37_E1B19K-01        gggt--------------------acctgct-------------------
J9Z4N4_E1B19K-01        gggt--------------------acctgct-------------------
Q71BY5_E1B19K-02        gggt--------------------acctgct-------------------
E1ARN8_E1B19K-01        gggt--------------------acctgct-------------------
P03246_E1B19K-01        gggt--------------------acctgct-------------------
Q6VGV8_E1B19K-01        gggt--------------------acctgct-------------------
A0A0G2R248_E1B19K-      gggt--------------------acctgct-------------------
A0A291P1B2_E1B19K-      gggt--------------------acctgct-------------------
T1UG63_E1B19K-01        gggt--------------------acctgct-------------------
A0A1U9ALK7_E1B19K-      gggt--------------------acctgct-------------------
P03247_E1B19K-01        gggt--------------------acctgct-------------------
J9Z5H0_E1B19K-01        gggt--------------------acctgct-------------------
J9Z4H6_E1B19K-01        gggt--------------------acctgct-------------------
A0A2H4PJ75_E1B19K-      gggt--------------------acctgct-------------------
J7I6T8_E1B19K-01        gggt--------------------acctgct-------------------
A0A384ZUF2_E1B19K-      ggctgcttctgcctggtgaagggcacagcctctctgaagcataatatggt
A0A384ZUM9_E1B19K-      ggctgcttctgcctggtgaagggcacagcctctctgaagcataatgtggt
B9A5L5_E1B19K-01        ggct--------------------acattct-------------------
T1UGY3_E1B19K-01        ggct--------------------acattct-------------------
A0A1P7YYY5_E1B19K-      ggct--------------------acattct-------------------
A0A1P7YWY2_E1B19K-      ggct--------------------acattct-------------------
A0A1P7YWR9_E1B19K-      ggct--------------------acattct-------------------
A0A1P7YXN8_E1B19K-      ggct--------------------acattct-------------------
A0A1P8C849_E1B19K-      ggct--------------------acattct-------------------
B9A5A7_E1B19K-01        ggct--------------------acattct-------------------
T1UG22_E1B19K-01        ggct--------------------acattct-------------------
M0QVG6_E1B19K-01        gatt--------------------acatcct-------------------
X4YVU5_E1B19K-01        gatt--------------------acatcct-------------------
M0QUS9_E1B19K-01        ggct--------------------acatcct-------------------
M0QU02_E1B19K-01        ggct--------------------acatcct-------------------
A0A291B0H2_E1B19K-      ggat--------------------acatcct-------------------
M0QV87_E1B19K-01        ggct--------------------acatcct-------------------
T1UKV6_E1B19K-01        ggct--------------------acatcct-------------------
W8VNG2_E1B19K-01        ggct--------------------acatcct-------------------
F8UFP5_E1B19K-01        ggct--------------------acatcct-------------------
T1UGT5_E1B19K-01        ggct--------------------acatcct-------------------
T1UGX3_E1B19K-01        ggct--------------------acattct-------------------
W8CZB0_E1B19K-01        ggct--------------------acattct-------------------
G3CK71_E1B19K-01        ggct--------------------acattct-------------------
M0QTS5_E1B19K-01        ggct--------------------acattct-------------------
M0QV08_E1B19K-01        ggct--------------------acattct-------------------
G9JUV5_E1B19K-01        ggct--------------------acattct-------------------
G1FC01_E1B19K-01        ggct--------------------acattct-------------------
A0A0G2UY10_E1B19K-      ggct--------------------acattct-------------------
A0A1J0MS84_E1B19K-      ggct--------------------acatcct-------------------
M0QUJ3_E1B19K-01        ggat--------------------acatcct-------------------
H0PPE7_E1B19K-01        ggat--------------------acatcct-------------------
T1UKP8_E1B19K-01        ggat--------------------acatcct-------------------
T1UHQ8_E1B19K-01        ggct--------------------acatcct-------------------
Q4KSL0_E1B19K-01        ggct--------------------acatcct-------------------
T1UHG3_E1B19K-01        ggct--------------------acatcct-------------------
A0A384ZUF2_E1B19K-      ggct--------------------acatcct-------------------
M0QUN2_E1B19K-01        ggct--------------------acatcct-------------------
E1CIM6_E1B19K-01        ggct--------------------acatcct-------------------
E1AI10_E1B19K-01        ggct--------------------acatcct-------------------
Q9YL99_E1B19K-01        ggct--------------------acatcct-------------------
K7ZLN6_E1B19K-01        ggct--------------------acatcct-------------------
E1CIR1_E1B19K-01        ggct--------------------acatcct-------------------
A0A1Y1BXT7_E1B19K-      ggct--------------------acatcct-------------------
T1UHH6_E1B19K-01        ggct--------------------acatcct-------------------
M0QVT4_E1B19K-01        ggct--------------------acatcct-------------------
T1ULJ8_E1B19K-01        ggct--------------------acatcct-------------------
E9P585_E1B19K-01        ggct--------------------acatcct-------------------
D4N3H6_E1B19K-01        ggct--------------------acatcct-------------------
C4P207_E1B19K-01        ggct--------------------acatcct-------------------
T1ULP4_E1B19K-01        ggct--------------------acatcct-------------------
A0A384ZUM9_E1B19K-      ggct--------------------acatcct-------------------
X4Y9D2_E1B19K-01        ggct--------------------acatcct-------------------
T1UHL7_E1B19K-01        ggct--------------------acatcct-------------------
B9A5Q1_E1B19K-01        ggct--------------------acatcct-------------------
M0QUB4_E1B19K-01        ggct--------------------acatcct-------------------
M0QVK6_E1B19K-01        ggct--------------------acatcct-------------------
A0A075TSZ1_E1B19K-      ggct--------------------acatcct-------------------
F1DT57_E1B19K-01        ggct--------------------acattct-------------------
M0QUF3_E1B19K-01        ggct--------------------acattct-------------------
E5RWD9_E1B19K-01        ggct--------------------acattct-------------------
E5RWL1_E1B19K-01        ggct--------------------acattct-------------------
B6DU90_E1B19K-01        ggct--------------------acattct-------------------
B9A5T7_E1B19K-01        ggct--------------------acattct-------------------
B6C6W8_E1B19K-01        ggct--------------------acattct-------------------
B9A681_E1B19K-01        ggct--------------------acattct-------------------
A0A1Y1BYF1_E1B19K-      ggct--------------------acattct-------------------
T1UHZ2_E1B19K-01        ggct--------------------acattct-------------------
B2VQE3_E1B19K-01        ggct--------------------acattct-------------------
M0QU76_E1B19K-01        ggct--------------------acattct-------------------
M0QVC7_E1B19K-01        ggct--------------------acattct-------------------
M0QU41_E1B19K-01        ggct--------------------acattct-------------------
C5HDR2_E1B19K-01        ggct--------------------acattct-------------------
D3GBW3_E1B19K-01        ggct--------------------acattct-------------------
A0A097I4T0_E1B19K-      ggct--------------------acattct-------------------
T1UK99_E1B19K-01        gatt--------------------acatcct-------------------
G1FBW4_E1B19K-01        gatt--------------------acatcct-------------------
T1UKQ0_E1B19K-01        gatt--------------------acatcct-------------------
M0QVP5_E1B19K-01        gatt--------------------acatcct-------------------
H5T740_E1B19K-01        gatt--------------------acatcct-------------------
M0QUW8_E1B19K-01        gatt--------------------acatcct-------------------
E1CIJ0_E1B19K-01        gatt--------------------acatcct-------------------
T1UGU0_E1B19K-01        gatt--------------------acatcct-------------------
M0QV47_E1B19K-01        gatt--------------------acatcct-------------------

A0A097IW62_E1B19K-      ---ggattacatta---------------ctcttc--agttatg----ga
A0A0M3TH18_E1B19K-      ---agattacatta---------------gtttgc--agctatg----ga
A0A1W5PVU4_E1B19K-      ---agattacatta---------------gtttgc--agctatg----ga
Q6QPF3_E1B19K-01        ---ggactgcttag---------------cagtag--ctttgtg----ga
Q6QPB7_E1B19K-01        ---ggactgcttag---------------cagtag--ctttgtg----ga
Q6QPI9_E1B19K-01        ---ggactgcttag---------------cagtag--ctttgtg----ga
G9G841_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
Q2KSM8_E1B19K-02        ---ggatttcttag---------------cagtag--ctttgtg----ga
Q2KSG6_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
Q2KSM8_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
A0A2L1F3A2_E1B19K-      ---ggatttcttag---------------cagtag--ctttgtg----ga
A0A2R3WN16_E1B19K-      ---ggatttcttag---------------cagtag--ctttgtg----ga
Q2KSG6_E1B19K-02        ---ggatttcttag---------------cagtag--ctttgtg----ga
A0A2L1F392_E1B19K-      ---ggatttcttag---------------cagtag--ctttgtg----ga
Q8UY91_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
P10406_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
Q5GFC7_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
A0A2R3WN62_E1B19K-      ---ggatttcttag---------------cagtag--ctttgtg----ga
Q5GFC8_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
Q6H1D7_E1B19K-01        ---ggatttcttag---------------cagtag--ctttgtg----ga
T1UJX4_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
Q7T951_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
T1UE63_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
Q7T8D8_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
Q5UW22_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
Q8B8U7_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
C7SRS7_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
Q32UI6_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
J7H4R9_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
D2DM83_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
J7I6W7_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
W6EIX6_E1B19K-01        ---ggatttcatag---------------ccacag--cattgtg----ga
A0A1L7NRH1_E1B19K-      ---ggatttcatag---------------ccacag--cattgtg----ga
Q3ZL02_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
T1UFS4_E1B19K-01        ---ggatttcgtag---------------ccacag--cattgtg----ga
T2CI10_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A0K0PX35_E1B19K-      ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A0K0PX99_E1B19K-      ---ggatttcatag---------------cagcag--ctttgtg----ga
Q3ZKW2_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q2KRU2_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
K7NG43_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q2KS85_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A0B4SJH1_E1B19K-      ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A075IQ70_E1B19K-      ---ggatttcatag---------------cagcag--ctttgtg----ga
T1UIP3_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
R4HLE1_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q5EY83_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q2Y0J3_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
J7ID56_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
I6LEP5_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
R4HLJ6_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
R4HLA0_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q2KSL3_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
I6LES1_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
T1UF50_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
R4HMC6_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
I1V161_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
J7I6S4_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A220VZ73_E1B19K-      ---ggatttcatag---------------cagcag--ctttgtg----ga
P03248_E1B19K-02        ---ggatttcatag---------------cagcag--ctttgtg----ga
Q6RK98_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
J7I6Q4_E1B19K-01        ---ggatttcatag---------------cagcag--ctttgtg----ga
A0A1S6ELT2_E1B19K-      ---ggattacatga---------------caatgg--ctctgtg----ga
F4ZCJ8_E1B19K-01        ---ggattacatga---------------caatgg--ccctgtg----ga
B5SNR1_E1B19K-01        ---ggattacatga---------------caatgg--ccctgtg----ga
P10544_E1B19K-01        ---ggattacatga---------------caatgg--ccctgtg----ga
W0S1G8_E1B19K-01        ---ggattacatga---------------caatgg--ccctgtg----ga
A0A142G3J2_E1B19K-      ---ggattacatgg---------------caatgg--ctctgtg----ga
P10543_E1B19K-01        ---ggattacatgg---------------caatgg--ctctgtg----ga
D3JIR7_E1B19K-01        ---ggattacatgg---------------caatgc--agctgtg----ga
A0A076V686_E1B19K-      ---ggattacatga---------------caatgc--agctgtg----ga
P04492_E1B19K-01        ---ggattacatgt---------------caatgc--agctgtg----ga
G1DE13_E1B19K-01        ---ggattacatgg---------------caatgc--atttgtg----ga
D0Z5R9_E1B19K-01        ---ggattacatgg---------------caatgc--atttgtg----ga
T1UEX7_E1B19K-01        ---ggattacatgg---------------caatgc--atttgtg----ga
A0A2H5AI99_E1B19K-      ---ggattacctgt---------------cgatgg--cggtgtg----ga
A0A0A1EUE4_E1B19K-      ---ggattacctgg---------------caatgg--ccctgtg----ga
A0MK43_E1B19K-01        ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AID8_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AIL0_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AIC5_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AI40_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AII9_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AIN5_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AIU0_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AIS9_E1B19K-      ---ggattacatgg---------------cgatgg--ctttgtg----ga
A0A2H5AIT6_E1B19K-      ---ggattacatgg---------------cgatgg--ctttgtg----ga
Q5C8R2_E1B19K-01        ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A2H5AI21_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A0M5L3Y4_E1B19K-      ---ggattacatgg---------------cgatgg--ctctgtg----ga
A0A0A1EUC8_E1B19K-      ---ggattacatgt---------------cgatgg--cgctgtg----ga
A0A2H5AI04_E1B19K-      ---ggattacatgt---------------cgatgg--cgctgtg----ga
A0A2H5AI72_E1B19K-      ---ggattacatgt---------------cgatgg--cgctgtg----ga
A0A2H5AIL3_E1B19K-      ---ggattacatgt---------------cgatgg--cgctgtg----ga
A0A0A1EUB2_E1B19K-      ---ggattacatgt---------------cgatgg--cgctgtg----ga
Q71BY5_E1B19K-01        ---gga-------------------------------acctg------ca
P06501_E1B19K-01        ---ggattacatca---------------gcctga--acctgtg----ga
A0A0M4N3Z1_E1B19K-      ---ggattacatca---------------gcctga--acctgtg----ga
Q8B6X5_E1B19K-01        ---ggattacatca---------------ggctga--acctgtg----ga
A0A0M4NHE0_E1B19K-      ---ggattacatca---------------gcttgc--agctgtg----ga
H9AAD9_E1B19K-01        ---ggattacatca---------------gcttgc--agctgtg----ga
H9AAK5_E1B19K-01        ---ggattacatca---------------gcttgc--agctgtg----ga
H9AAH3_E1B19K-01        ---ggattacatca---------------gcttgc--agctgtg----ga
F2WTJ7_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
F2WTM9_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
A0A1C8EG46_E1B19K-      ---ggattacatca---------------gcttgc--agctgtg----ga
H9AAA8_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
H9AA76_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
H9AAN8_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
H9AAS0_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
H9AAV3_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
H9AAY5_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
M9YVA3_E1B19K-01        ---ggattacatca---------------gcctgc--agctgtg----ga
M9YVF6_E1B19K-01        ---ggattacatga---------------ccatgg--cgttgtg----gc
A0A0M3TH31_E1B19K-      ---ggattacatga---------------ccatgg--cgctgtg----gc
M9YXY5_E1B19K-01        ---ggattacatga---------------ccatgg--cgctgtg----gc
G0ZAH2_E1B19K-01        ---cgattgcttgg---------------ccctcg--cgatatg----ga
A0A1L3INW0_E1B19K-      ---ggattttttga---------------cgctga--gcctgtg----ga
A0A2H4CJZ0_E1B19K-      ---ggactacctga---------------ccatgt--ccctgtg----ga
H8PFZ1_E1B19K-01        ---ggactacctga---------------ccatgt--ccctgtg----ga
F6KST6_E1B19K-01        ---ggacttcctaa-------------cgctatgc----ctgtg----ga
F2WTG5_E1B19K-01        ---ggacttcctga-------------cgctatgc----ctatg----ga
Q695T5_E1B19K-01        ---ggacttcctga-------------cgctatgc----ctatg----ga
H9TER0_E1B19K-01        ---ggacttcctga-------------cgctatgc----ctatg----ga
Q6WQ37_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
J9Z4N4_E1B19K-01        ---ggattttctgg---------------ccatgc--atttgtg----ga
Q71BY5_E1B19K-02        ---ggattttctgg---------------ccatgc--atttgtg----ga
E1ARN8_E1B19K-01        ---ggattttctgg---------------ccatgc--atttgtg----ga
P03246_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
Q6VGV8_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
A0A0G2R248_E1B19K-      ---ggattttctgg---------------ccatgc--atctgtg----ga
A0A291P1B2_E1B19K-      ---ggattttctgg---------------ccatgc--atctgtg----ga
T1UG63_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
A0A1U9ALK7_E1B19K-      ---ggattttctgg---------------ccatgc--atctgtg----ga
P03247_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
J9Z5H0_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
J9Z4H6_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
A0A2H4PJ75_E1B19K-      ---ggattttctgg---------------ccatgc--atctgtg----ga
J7I6T8_E1B19K-01        ---ggattttctgg---------------ccatgc--atctgtg----ga
A0A384ZUF2_E1B19K-      gaagggctgcacggatgagcgcatgtacaacatgctgacctgcgattcgg
A0A384ZUM9_E1B19K-      gaagggctgtacggatgagcgcatgtacaacatgctgacctgcgattcag
B9A5L5_E1B19K-01        ---ggactttgcag---------------ccatgc--acctgtg----ga
T1UGY3_E1B19K-01        ---ggactttgcag---------------ccatgc--acctgtg----ga
A0A1P7YYY5_E1B19K-      ---ggactttgcag---------------ccatgc--acctgtg----ga
A0A1P7YWY2_E1B19K-      ---ggactttgcag---------------ccatgc--acctgtg----ga
A0A1P7YWR9_E1B19K-      ---ggactttgcag---------------ccatgc--acctgtg----ga
A0A1P7YXN8_E1B19K-      ---ggactttgcag---------------ccatgc--acctgtg----ga
A0A1P8C849_E1B19K-      ---ggactttgcag---------------ccatgc--acctgtg----ga
B9A5A7_E1B19K-01        ---ggactttgcag---------------ccatgc--acctgtg----ga
T1UG22_E1B19K-01        ---ggactttgcag---------------ccatgc--acctgtg----ga
M0QVG6_E1B19K-01        ---ggacttcacgg---------------ccatgc--atctgtg----ga
X4YVU5_E1B19K-01        ---ggacttcacgg---------------ccatgc--atctgtg----ga
M0QUS9_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
M0QU02_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A291B0H2_E1B19K-      ---ggacttcgcag---------------ccatgc--atctgtg----ga
M0QV87_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UKV6_E1B19K-01        ---ggacttcgcag---------------ccatgc--atctgtg----ga
W8VNG2_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
F8UFP5_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
T1UGT5_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
T1UGX3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
W8CZB0_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
G3CK71_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
M0QTS5_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
M0QV08_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
G9JUV5_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
G1FC01_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
A0A0G2UY10_E1B19K-      ---ggacttcgcgg---------------ccatgc--acctgtg----ga
A0A1J0MS84_E1B19K-      ---ggacttcgcgg---------------ccatgc--acctgtg----ga
M0QUJ3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
H0PPE7_E1B19K-01        ---ggacttcgcgg---------------ccatgc--acctgtg----ga
T1UKP8_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UHQ8_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
Q4KSL0_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UHG3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A384ZUF2_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QUN2_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E1CIM6_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E1AI10_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
Q9YL99_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
K7ZLN6_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E1CIR1_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A1Y1BXT7_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UHH6_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QVT4_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1ULJ8_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E9P585_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
D4N3H6_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
C4P207_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1ULP4_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A384ZUM9_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
X4Y9D2_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UHL7_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B9A5Q1_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QUB4_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QVK6_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A075TSZ1_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
F1DT57_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QUF3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E5RWD9_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
E5RWL1_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B6DU90_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B9A5T7_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B6C6W8_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B9A681_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A1Y1BYF1_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UHZ2_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
B2VQE3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QU76_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QVC7_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
M0QU41_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
C5HDR2_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
D3GBW3_E1B19K-01        ---ggacttcgcag---------------ccatgc--acctgtg----ga
A0A097I4T0_E1B19K-      ---ggacttcgcag---------------ccatgc--acctgtg----ga
T1UK99_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
G1FBW4_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
T1UKQ0_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
M0QVP5_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
H5T740_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
M0QUW8_E1B19K-01        ---ggacttcacgg---------------ccatgc--acctgtg----ga
E1CIJ0_E1B19K-01        ---ggacttcacgg---------------ccatgc--atctgtg----ga
T1UGU0_E1B19K-01        ---ggacttcacgg---------------ccatgc--atctgtg----ga
M0QV47_E1B19K-01        ---ggacttcacgg---------------ccatgc--atctgtg----ga
                            *                                   *         

A0A097IW62_E1B19K-      aggctta-------------------------------------------
A0A0M3TH18_E1B19K-      aggctta-------------------------------------------
A0A1W5PVU4_E1B19K-      aggctta-------------------------------------------
Q6QPF3_E1B19K-01        gaacatg-------------------------------------------
Q6QPB7_E1B19K-01        gaacatg-------------------------------------------
Q6QPI9_E1B19K-01        gaacatg-------------------------------------------
G9G841_E1B19K-01        gaacatg-------------------------------------------
Q2KSM8_E1B19K-02        gagcatg-------------------------------------------
Q2KSG6_E1B19K-01        gagcatg-------------------------------------------
Q2KSM8_E1B19K-01        gagcatg-------------------------------------------
A0A2L1F3A2_E1B19K-      gagcatg-------------------------------------------
A0A2R3WN16_E1B19K-      gagcatg-------------------------------------------
Q2KSG6_E1B19K-02        gagcatg-------------------------------------------
A0A2L1F392_E1B19K-      gagcatg-------------------------------------------
Q8UY91_E1B19K-01        gaacatg-------------------------------------------
P10406_E1B19K-01        gaacatg-------------------------------------------
Q5GFC7_E1B19K-01        gaacatg-------------------------------------------
A0A2R3WN62_E1B19K-      gaacatg-------------------------------------------
Q5GFC8_E1B19K-01        gaacatg-------------------------------------------
Q6H1D7_E1B19K-01        gaacatg-------------------------------------------
T1UJX4_E1B19K-01        gaacatg-------------------------------------------
Q7T951_E1B19K-01        gaacatg-------------------------------------------
T1UE63_E1B19K-01        gaacatg-------------------------------------------
Q7T8D8_E1B19K-01        gaacatg-------------------------------------------
Q5UW22_E1B19K-01        gaacatg-------------------------------------------
Q8B8U7_E1B19K-01        gaacatg-------------------------------------------
C7SRS7_E1B19K-01        gaacatg-------------------------------------------
Q32UI6_E1B19K-01        gaacatg-------------------------------------------
J7H4R9_E1B19K-01        gaacatg-------------------------------------------
D2DM83_E1B19K-01        gaacatg-------------------------------------------
J7I6W7_E1B19K-01        gaacatg-------------------------------------------
W6EIX6_E1B19K-01        gaacatg-------------------------------------------
A0A1L7NRH1_E1B19K-      gaacatg-------------------------------------------
Q3ZL02_E1B19K-01        gaacatg-------------------------------------------
T1UFS4_E1B19K-01        gaacatg-------------------------------------------
T2CI10_E1B19K-01        gaacatg-------------------------------------------
A0A0K0PX35_E1B19K-      gaacatg-------------------------------------------
A0A0K0PX99_E1B19K-      gaacatg-------------------------------------------
Q3ZKW2_E1B19K-01        gaacatg-------------------------------------------
Q2KRU2_E1B19K-01        gaacatg-------------------------------------------
K7NG43_E1B19K-01        gaacatg-------------------------------------------
Q2KS85_E1B19K-01        gaacatg-------------------------------------------
A0A0B4SJH1_E1B19K-      gaacatg-------------------------------------------
A0A075IQ70_E1B19K-      gaacatg-------------------------------------------
T1UIP3_E1B19K-01        gaacatg-------------------------------------------
R4HLE1_E1B19K-01        gaacatg-------------------------------------------
Q5EY83_E1B19K-01        gaacatg-------------------------------------------
Q2Y0J3_E1B19K-01        gaacatg-------------------------------------------
J7ID56_E1B19K-01        gaacatg-------------------------------------------
I6LEP5_E1B19K-01        gaacatg-------------------------------------------
R4HLJ6_E1B19K-01        gaacatg-------------------------------------------
R4HLA0_E1B19K-01        gaacatg-------------------------------------------
Q2KSL3_E1B19K-01        gaacatg-------------------------------------------
I6LES1_E1B19K-01        gaacatg-------------------------------------------
T1UF50_E1B19K-01        gaacatg-------------------------------------------
R4HMC6_E1B19K-01        gaacatg-------------------------------------------
I1V161_E1B19K-01        gaacatg-------------------------------------------
J7I6S4_E1B19K-01        gaacatg-------------------------------------------
A0A220VZ73_E1B19K-      gaacatg-------------------------------------------
P03248_E1B19K-02        gaacatg-------------------------------------------
Q6RK98_E1B19K-01        gaacatg-------------------------------------------
J7I6Q4_E1B19K-01        gaacatg-------------------------------------------
A0A1S6ELT2_E1B19K-      gaaccct-------------------------------------------
F4ZCJ8_E1B19K-01        gaaccct-------------------------------------------
B5SNR1_E1B19K-01        gaaccct-------------------------------------------
P10544_E1B19K-01        gaaccct-------------------------------------------
W0S1G8_E1B19K-01        gaaccct-------------------------------------------
A0A142G3J2_E1B19K-      gaacctt-------------------------------------------
P10543_E1B19K-01        gaacctt-------------------------------------------
D3JIR7_E1B19K-01        gggcatg-------------------------------------------
A0A076V686_E1B19K-      gggcatg-------------------------------------------
P04492_E1B19K-01        gggcatg-------------------------------------------
G1DE13_E1B19K-01        gggcatg-------------------------------------------
D0Z5R9_E1B19K-01        gggcatg-------------------------------------------
T1UEX7_E1B19K-01        gggcatg-------------------------------------------
A0A2H5AI99_E1B19K-      gggccat-------------------------------------------
A0A0A1EUE4_E1B19K-      gggccat-------------------------------------------
A0MK43_E1B19K-01        gggccat-------------------------------------------
A0A2H5AID8_E1B19K-      gggccat-------------------------------------------
A0A2H5AIL0_E1B19K-      gggccat-------------------------------------------
A0A2H5AIC5_E1B19K-      gggccat-------------------------------------------
A0A2H5AI40_E1B19K-      gggccat-------------------------------------------
A0A2H5AII9_E1B19K-      gggccat-------------------------------------------
A0A2H5AIN5_E1B19K-      gggccat-------------------------------------------
A0A2H5AIU0_E1B19K-      gggccat-------------------------------------------
A0A2H5AIS9_E1B19K-      gggccat-------------------------------------------
A0A2H5AIT6_E1B19K-      gggccat-------------------------------------------
Q5C8R2_E1B19K-01        gggccat-------------------------------------------
A0A2H5AI21_E1B19K-      gggccat-------------------------------------------
A0A0M5L3Y4_E1B19K-      gggccat-------------------------------------------
A0A0A1EUC8_E1B19K-      gggccat-------------------------------------------
A0A2H5AI04_E1B19K-      gggccat-------------------------------------------
A0A2H5AI72_E1B19K-      gggccat-------------------------------------------
A0A2H5AIL3_E1B19K-      gggccat-------------------------------------------
A0A0A1EUB2_E1B19K-      gggccat-------------------------------------------
Q71BY5_E1B19K-01        agacctg-------------------------------------------
P06501_E1B19K-01        agttttg-------------------------------------------
A0A0M4N3Z1_E1B19K-      agttttg-------------------------------------------
Q8B6X5_E1B19K-01        agttttg-------------------------------------------
A0A0M4NHE0_E1B19K-      ggttttg-------------------------------------------
H9AAD9_E1B19K-01        ggttttg-------------------------------------------
H9AAK5_E1B19K-01        ggttttg-------------------------------------------
H9AAH3_E1B19K-01        ggttttg-------------------------------------------
F2WTJ7_E1B19K-01        ggttctg-------------------------------------------
F2WTM9_E1B19K-01        ggttctg-------------------------------------------
A0A1C8EG46_E1B19K-      ggttctg-------------------------------------------
H9AAA8_E1B19K-01        ggttctg-------------------------------------------
H9AA76_E1B19K-01        ggttctg-------------------------------------------
H9AAN8_E1B19K-01        ggttctg-------------------------------------------
H9AAS0_E1B19K-01        ggttctg-------------------------------------------
H9AAV3_E1B19K-01        ggttctg-------------------------------------------
H9AAY5_E1B19K-01        ggttctg-------------------------------------------
M9YVA3_E1B19K-01        ggttctg-------------------------------------------
M9YVF6_E1B19K-01        gggc----------------------------------------------
A0A0M3TH31_E1B19K-      gggc----------------------------------------------
M9YXY5_E1B19K-01        gggc----------------------------------------------
G0ZAH2_E1B19K-01        agcacac-------------------------------------------
A0A1L3INW0_E1B19K-      agacagg-------------------------------------------
A0A2H4CJZ0_E1B19K-      gggc----------------------------------------------
H8PFZ1_E1B19K-01        gggc----------------------------------------------
F6KST6_E1B19K-01        agtttgg-------------------------------------------
F2WTG5_E1B19K-01        agttcgg-------------------------------------------
Q695T5_E1B19K-01        agttcgg-------------------------------------------
H9TER0_E1B19K-01        agttcgg-------------------------------------------
Q6WQ37_E1B19K-01        gagc----------------------------------------------
J9Z4N4_E1B19K-01        gagc----------------------------------------------
Q71BY5_E1B19K-02        gagc----------------------------------------------
E1ARN8_E1B19K-01        gagc----------------------------------------------
P03246_E1B19K-01        gagc----------------------------------------------
Q6VGV8_E1B19K-01        gagc----------------------------------------------
A0A0G2R248_E1B19K-      gagc----------------------------------------------
A0A291P1B2_E1B19K-      gagc----------------------------------------------
T1UG63_E1B19K-01        gagc----------------------------------------------
A0A1U9ALK7_E1B19K-      gagc----------------------------------------------
P03247_E1B19K-01        gagc----------------------------------------------
J9Z5H0_E1B19K-01        gagc----------------------------------------------
J9Z4H6_E1B19K-01        gagc----------------------------------------------
A0A2H4PJ75_E1B19K-      gagc----------------------------------------------
J7I6T8_E1B19K-01        gagc----------------------------------------------
A0A384ZUF2_E1B19K-      gggtctgccatatcctgaagaacatccatgtgacctcccaccccagaaag
A0A384ZUM9_E1B19K-      gggtctgccatatcctgaagaacatccatgtgacctcccacgccagaaag
B9A5L5_E1B19K-01        gggcctg-------------------------------------------
T1UGY3_E1B19K-01        gggcctg-------------------------------------------
A0A1P7YYY5_E1B19K-      gggcctg-------------------------------------------
A0A1P7YWY2_E1B19K-      gggcctg-------------------------------------------
A0A1P7YWR9_E1B19K-      gggcctg-------------------------------------------
A0A1P7YXN8_E1B19K-      gggcctg-------------------------------------------
A0A1P8C849_E1B19K-      gggcctg-------------------------------------------
B9A5A7_E1B19K-01        gggcctg-------------------------------------------
T1UG22_E1B19K-01        gggcctg-------------------------------------------
M0QVG6_E1B19K-01        aggcctg-------------------------------------------
X4YVU5_E1B19K-01        aggcctg-------------------------------------------
M0QUS9_E1B19K-01        gggcctg-------------------------------------------
M0QU02_E1B19K-01        gggcctg-------------------------------------------
A0A291B0H2_E1B19K-      gggcctg-------------------------------------------
M0QV87_E1B19K-01        gggcctg-------------------------------------------
T1UKV6_E1B19K-01        gggcctg-------------------------------------------
W8VNG2_E1B19K-01        gggcctg-------------------------------------------
F8UFP5_E1B19K-01        gggcctg-------------------------------------------
T1UGT5_E1B19K-01        gggcctg-------------------------------------------
T1UGX3_E1B19K-01        gggcctg-------------------------------------------
W8CZB0_E1B19K-01        gggcctg-------------------------------------------
G3CK71_E1B19K-01        gggcctg-------------------------------------------
M0QTS5_E1B19K-01        gggcctg-------------------------------------------
M0QV08_E1B19K-01        gggcctg-------------------------------------------
G9JUV5_E1B19K-01        gggcctg-------------------------------------------
G1FC01_E1B19K-01        gggcctg-------------------------------------------
A0A0G2UY10_E1B19K-      ggtcctg-------------------------------------------
A0A1J0MS84_E1B19K-      ggtcctg-------------------------------------------
M0QUJ3_E1B19K-01        gggcctg-------------------------------------------
H0PPE7_E1B19K-01        gggcctg-------------------------------------------
T1UKP8_E1B19K-01        ggtcctg-------------------------------------------
T1UHQ8_E1B19K-01        gggcctg-------------------------------------------
Q4KSL0_E1B19K-01        gggcctg-------------------------------------------
T1UHG3_E1B19K-01        gggcctg-------------------------------------------
A0A384ZUF2_E1B19K-      gggcctg-------------------------------------------
M0QUN2_E1B19K-01        gggcctg-------------------------------------------
E1CIM6_E1B19K-01        gggcctg-------------------------------------------
E1AI10_E1B19K-01        gggcctg-------------------------------------------
Q9YL99_E1B19K-01        gggcctg-------------------------------------------
K7ZLN6_E1B19K-01        gggcctg-------------------------------------------
E1CIR1_E1B19K-01        gggcctg-------------------------------------------
A0A1Y1BXT7_E1B19K-      gggcctg-------------------------------------------
T1UHH6_E1B19K-01        ggtcctg-------------------------------------------
M0QVT4_E1B19K-01        gggcctg-------------------------------------------
T1ULJ8_E1B19K-01        gggcctg-------------------------------------------
E9P585_E1B19K-01        gggcctg-------------------------------------------
D4N3H6_E1B19K-01        gggcctg-------------------------------------------
C4P207_E1B19K-01        gggcctg-------------------------------------------
T1ULP4_E1B19K-01        gggcctg-------------------------------------------
A0A384ZUM9_E1B19K-      gggcctg-------------------------------------------
X4Y9D2_E1B19K-01        ggtcctg-------------------------------------------
T1UHL7_E1B19K-01        ggtcctg-------------------------------------------
B9A5Q1_E1B19K-01        gggcctg-------------------------------------------
M0QUB4_E1B19K-01        gggcctg-------------------------------------------
M0QVK6_E1B19K-01        gggcctg-------------------------------------------
A0A075TSZ1_E1B19K-      ggtcctg-------------------------------------------
F1DT57_E1B19K-01        gggcatg-------------------------------------------
M0QUF3_E1B19K-01        gggcatg-------------------------------------------
E5RWD9_E1B19K-01        gggcatg-------------------------------------------
E5RWL1_E1B19K-01        gggcatg-------------------------------------------
B6DU90_E1B19K-01        gggcatg-------------------------------------------
B9A5T7_E1B19K-01        gggcatg-------------------------------------------
B6C6W8_E1B19K-01        gggcatg-------------------------------------------
B9A681_E1B19K-01        gggcatg-------------------------------------------
A0A1Y1BYF1_E1B19K-      gggcatg-------------------------------------------
T1UHZ2_E1B19K-01        gggcatg-------------------------------------------
B2VQE3_E1B19K-01        gggcatg-------------------------------------------
M0QU76_E1B19K-01        gggcatg-------------------------------------------
M0QVC7_E1B19K-01        gggcatg-------------------------------------------
M0QU41_E1B19K-01        gggcatg-------------------------------------------
C5HDR2_E1B19K-01        gggcatg-------------------------------------------
D3GBW3_E1B19K-01        gggcatg-------------------------------------------
A0A097I4T0_E1B19K-      gggcatg-------------------------------------------
T1UK99_E1B19K-01        aggcctg-------------------------------------------
G1FBW4_E1B19K-01        aggcctg-------------------------------------------
T1UKQ0_E1B19K-01        aggcctg-------------------------------------------
M0QVP5_E1B19K-01        aggcctg-------------------------------------------
H5T740_E1B19K-01        aggcctg-------------------------------------------
M0QUW8_E1B19K-01        aggcctg-------------------------------------------
E1CIJ0_E1B19K-01        aggcctg-------------------------------------------
T1UGU0_E1B19K-01        aggcctg-------------------------------------------
M0QV47_E1B19K-01        aggcctg-------------------------------------------

A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2L1F3A2_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
M9YVF6_E1B19K-01        -----------------------------gctc-----------------
A0A0M3TH31_E1B19K-      -----------------------------gctc-----------------
M9YXY5_E1B19K-01        -----------------------------gctc-----------------
G0ZAH2_E1B19K-01        -----------------------------gctgagg--------------
A0A1L3INW0_E1B19K-      -----------------------------gctgaag--------------
A0A2H4CJZ0_E1B19K-      --------------------------------catg--------------
H8PFZ1_E1B19K-01        --------------------------------catg--------------
F6KST6_E1B19K-01        -----------------------------catcagg--------------
F2WTG5_E1B19K-01        -----------------------------gatcagg--------------
Q695T5_E1B19K-01        -----------------------------aatcagg--------------
H9TER0_E1B19K-01        -----------------------------aatcagg--------------
Q6WQ37_E1B19K-01        ----------------------------------gg--------------
J9Z4N4_E1B19K-01        ----------------------------------ag--------------
Q71BY5_E1B19K-02        ----------------------------------gg--------------
E1ARN8_E1B19K-01        ----------------------------------gg--------------
P03246_E1B19K-01        ----------------------------------gg--------------
Q6VGV8_E1B19K-01        ----------------------------------gg--------------
A0A0G2R248_E1B19K-      ----------------------------------gg--------------
A0A291P1B2_E1B19K-      ----------------------------------gg--------------
T1UG63_E1B19K-01        ----------------------------------gg--------------
A0A1U9ALK7_E1B19K-      ----------------------------------gg--------------
P03247_E1B19K-01        ----------------------------------gg--------------
J9Z5H0_E1B19K-01        ----------------------------------gg--------------
J9Z4H6_E1B19K-01        ----------------------------------gg--------------
A0A2H4PJ75_E1B19K-      ----------------------------------gg--------------
J7I6T8_E1B19K-01        ----------------------------------gg--------------
A0A384ZUF2_E1B19K-      aagtggccagtgtttgagaataacctgctgatcaagtgccatatgcacct
A0A384ZUM9_E1B19K-      aagtggccagtgtttgagaataacctgctgatcaagtgccatatgcacct
B9A5L5_E1B19K-01        -----------------------------gatgagg--------------
T1UGY3_E1B19K-01        -----------------------------gatgagg--------------
A0A1P7YYY5_E1B19K-      -----------------------------gatgagg--------------
A0A1P7YWY2_E1B19K-      -----------------------------gatgagg--------------
A0A1P7YWR9_E1B19K-      -----------------------------gatgagg--------------
A0A1P7YXN8_E1B19K-      -----------------------------gatgagg--------------
A0A1P8C849_E1B19K-      -----------------------------gatgagg--------------
B9A5A7_E1B19K-01        -----------------------------gatgagg--------------
T1UG22_E1B19K-01        -----------------------------gatgagg--------------
M0QVG6_E1B19K-01        -----------------------------ggtcagg--------------
X4YVU5_E1B19K-01        -----------------------------ggtcagg--------------
M0QUS9_E1B19K-01        -----------------------------ggtcagg--------------
M0QU02_E1B19K-01        -----------------------------gatcagg--------------
A0A291B0H2_E1B19K-      -----------------------------gatcagg--------------
M0QV87_E1B19K-01        -----------------------------gatcagg--------------
T1UKV6_E1B19K-01        -----------------------------gatcagg--------------
W8VNG2_E1B19K-01        -----------------------------gatcagg--------------
F8UFP5_E1B19K-01        -----------------------------gatcagg--------------
T1UGT5_E1B19K-01        -----------------------------ggtcagg--------------
T1UGX3_E1B19K-01        -----------------------------ggtcagg--------------
W8CZB0_E1B19K-01        -----------------------------ggtcagg--------------
G3CK71_E1B19K-01        -----------------------------ggtcagg--------------
M0QTS5_E1B19K-01        -----------------------------ggtcagg--------------
M0QV08_E1B19K-01        -----------------------------ggtcagg--------------
G9JUV5_E1B19K-01        -----------------------------ggtcagg--------------
G1FC01_E1B19K-01        -----------------------------ggtcagg--------------
A0A0G2UY10_E1B19K-      -----------------------------gatcagg--------------
A0A1J0MS84_E1B19K-      -----------------------------ggtcagg--------------
M0QUJ3_E1B19K-01        -----------------------------gatcagg--------------
H0PPE7_E1B19K-01        -----------------------------gatcagg--------------
T1UKP8_E1B19K-01        -----------------------------gatcagg--------------
T1UHQ8_E1B19K-01        -----------------------------gatcagg--------------
Q4KSL0_E1B19K-01        -----------------------------gatcagg--------------
T1UHG3_E1B19K-01        -----------------------------gatcagg--------------
A0A384ZUF2_E1B19K-      -----------------------------gatcagg--------------
M0QUN2_E1B19K-01        -----------------------------gatcagg--------------
E1CIM6_E1B19K-01        -----------------------------gatcagg--------------
E1AI10_E1B19K-01        -----------------------------gatcagg--------------
Q9YL99_E1B19K-01        -----------------------------gatcagg--------------
K7ZLN6_E1B19K-01        -----------------------------gatcagg--------------
E1CIR1_E1B19K-01        -----------------------------gatcagg--------------
A0A1Y1BXT7_E1B19K-      -----------------------------gatcagg--------------
T1UHH6_E1B19K-01        -----------------------------gatcagg--------------
M0QVT4_E1B19K-01        -----------------------------gatcagg--------------
T1ULJ8_E1B19K-01        -----------------------------gatcagg--------------
E9P585_E1B19K-01        -----------------------------gatcagg--------------
D4N3H6_E1B19K-01        -----------------------------gatcagg--------------
C4P207_E1B19K-01        -----------------------------gatcagg--------------
T1ULP4_E1B19K-01        -----------------------------gatcagg--------------
A0A384ZUM9_E1B19K-      -----------------------------gatcagg--------------
X4Y9D2_E1B19K-01        -----------------------------gatcagg--------------
T1UHL7_E1B19K-01        -----------------------------gatcagg--------------
B9A5Q1_E1B19K-01        -----------------------------gatcagg--------------
M0QUB4_E1B19K-01        -----------------------------gatcagg--------------
M0QVK6_E1B19K-01        -----------------------------gatcagg--------------
A0A075TSZ1_E1B19K-      -----------------------------gatcagg--------------
F1DT57_E1B19K-01        -----------------------------ggtcagg--------------
M0QUF3_E1B19K-01        -----------------------------ggtgagg--------------
E5RWD9_E1B19K-01        -----------------------------ggtgagg--------------
E5RWL1_E1B19K-01        -----------------------------ggtgagg--------------
B6DU90_E1B19K-01        -----------------------------ggtgagg--------------
B9A5T7_E1B19K-01        -----------------------------ggtgagg--------------
B6C6W8_E1B19K-01        -----------------------------ggtgagg--------------
B9A681_E1B19K-01        -----------------------------ggtgagg--------------
A0A1Y1BYF1_E1B19K-      -----------------------------ggtgagg--------------
T1UHZ2_E1B19K-01        -----------------------------ggtgagg--------------
B2VQE3_E1B19K-01        -----------------------------ggtgagg--------------
M0QU76_E1B19K-01        -----------------------------ggtgagg--------------
M0QVC7_E1B19K-01        -----------------------------ggtgagg--------------
M0QU41_E1B19K-01        -----------------------------ggtgagg--------------
C5HDR2_E1B19K-01        -----------------------------ggtcagg--------------
D3GBW3_E1B19K-01        -----------------------------ggtcagg--------------
A0A097I4T0_E1B19K-      -----------------------------ggtcagg--------------
T1UK99_E1B19K-01        -----------------------------ggtcagg--------------
G1FBW4_E1B19K-01        -----------------------------ggtcagg--------------
T1UKQ0_E1B19K-01        -----------------------------ggtcagg--------------
M0QVP5_E1B19K-01        -----------------------------ggtcagg--------------
H5T740_E1B19K-01        -----------------------------ggtcagg--------------
M0QUW8_E1B19K-01        -----------------------------ggtcagg--------------
E1CIJ0_E1B19K-01        -----------------------------ggtcagg--------------
T1UGU0_E1B19K-01        -----------------------------ggtcagg--------------
M0QV47_E1B19K-01        -----------------------------ggtcagg--------------

A0A097IW62_E1B19K-      ---------------------catgaggaaggggaagatttacacctt--
A0A0M3TH18_E1B19K-      ---------------------catgaggaaggggaagatctacacctt--
A0A1W5PVU4_E1B19K-      ---------------------catgaggaaggggaagatctacacatt--
Q6QPF3_E1B19K-01        ---------------gaggtgccagcgcctgaatgcaatctccggcta--
Q6QPB7_E1B19K-01        ---------------gaggtgccagcgcctgaatgcaatctccggcta--
Q6QPI9_E1B19K-01        ---------------gaggtgccagcgcctgaatgcaatctccggcta--
G9G841_E1B19K-01        ---------------gaaatcccagcgcctgaatgcaatctcaggcta--
Q2KSM8_E1B19K-02        ---------------gaagtgccagcgcctgaatgcaatc-ccggcta--
Q2KSG6_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatctccggcta--
Q2KSM8_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatctccggcta--
A0A2L1F3A2_E1B19K-      ---------------gaagtgccagcgcctgaatgcaatctccggcta--
A0A2R3WN16_E1B19K-      ---------------gaagtgccagcgcctgaatgcaatctccggcta--
Q2KSG6_E1B19K-02        ---------------gaagtgccagcgcctgaatgcaatc----------
A0A2L1F392_E1B19K-      ---------------gaagtgccagcgcctgaatgcaatc----------
Q8UY91_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatctccggcta--
P10406_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatc-ccggcta--
Q5GFC7_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatc-ccggcta--
A0A2R3WN62_E1B19K-      ---------------gaagtgccagcgcctgaatgcaatc-ccggcta--
Q5GFC8_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatctccggcta--
Q6H1D7_E1B19K-01        ---------------gaagtgccagcgcctgaatgcaatctccggcta--
T1UJX4_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q7T951_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
T1UE63_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q7T8D8_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q5UW22_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q8B8U7_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
C7SRS7_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q32UI6_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
J7H4R9_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
D2DM83_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
J7I6W7_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
W6EIX6_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
A0A1L7NRH1_E1B19K-      ---------------gaaggttcgcaagatgaggacaatcttaggtta--
Q3ZL02_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
T1UFS4_E1B19K-01        ---------------gaaggttcgcaagatgaggacaatcttaggtta--
T2CI10_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
A0A0K0PX35_E1B19K-      ---------------gaaggctcgcaggatgaggacaatcttagatta--
A0A0K0PX99_E1B19K-      ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q3ZKW2_E1B19K-01        ---------------gaaggctcgcagcatgaggacaatcttagatta--
Q2KRU2_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
K7NG43_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q2KS85_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
A0A0B4SJH1_E1B19K-      ---------------gaaggctcgcaggatgaggacaatcttagatta--
A0A075IQ70_E1B19K-      ---------------gaaggctcgcaggatgaggacaatcttagatta--
T1UIP3_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
R4HLE1_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q5EY83_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q2Y0J3_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
J7ID56_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
I6LEP5_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
R4HLJ6_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
R4HLA0_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q2KSL3_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
I6LES1_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
T1UF50_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
R4HMC6_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttaaatta--
I1V161_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttaaatta--
J7I6S4_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttaaatta--
A0A220VZ73_E1B19K-      ---------------gaaggctcgcaggatgaggacaatcttaaatta--
P03248_E1B19K-02        ---------------gaaggctcgcaggatgaggacaatcttagatta--
Q6RK98_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
J7I6Q4_E1B19K-01        ---------------gaaggctcgcaggatgaggacaatcttagatta--
A0A1S6ELT2_E1B19K-      ---------------------gctgcggaggaagagggtcttaggttg--
F4ZCJ8_E1B19K-01        ---------------------gctgcggaggaagagggtcttaggttg--
B5SNR1_E1B19K-01        ---------------------gctgcggaggaagagggtcttaggttg--
P10544_E1B19K-01        ---------------------gctgcggaggaagagggtcttaggttg--
W0S1G8_E1B19K-01        ---------------------gctgcggaggaagagggtcttaggttg--
A0A142G3J2_E1B19K-      ---------------------gctacggaggaagagggtcttaggttg--
P10543_E1B19K-01        ---------------------gctacggaggaagagggtcttaggttg--
D3JIR7_E1B19K-01        ------------------------gctcacgaggagggtttgcattta--
A0A076V686_E1B19K-      ------------------------gctcacgaggagggtttgcattta--
P04492_E1B19K-01        ------------------------gctgaagaggagggtttgcattta--
G1DE13_E1B19K-01        ------------------------gctgaagaggagggtttgcattta--
D0Z5R9_E1B19K-01        ------------------------gctgaagaggagggtttgcattta--
T1UEX7_E1B19K-01        ------------------------gctgaagaggagggtttgcattta--
A0A2H5AI99_E1B19K-      ------------------------gctgaggaagagggtctgcatata--
A0A0A1EUE4_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0MK43_E1B19K-01        ------------------------gctgcggaggagggtttgcattta--
A0A2H5AID8_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIL0_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIC5_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AI40_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AII9_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIN5_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIU0_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIS9_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIT6_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
Q5C8R2_E1B19K-01        ------------------------gctgcggaggagggtttgcattta--
A0A2H5AI21_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A0M5L3Y4_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A0A1EUC8_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AI04_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AI72_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A2H5AIL3_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
A0A0A1EUB2_E1B19K-      ------------------------gctgcggaggagggtttgcattta--
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        ------------------------gttgcgccggcgggtttacaatta--
A0A0M4N3Z1_E1B19K-      ------------------------gttgcgccggcgggtttacaacta--
Q8B6X5_E1B19K-01        ------------------------gttgcgccggcgggtttacaacta--
A0A0M4NHE0_E1B19K-      ------------------------gctgcgccggcgggtttacaacta--
H9AAD9_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAK5_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAH3_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
F2WTJ7_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
F2WTM9_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
A0A1C8EG46_E1B19K-      ------------------------gctgcgccggcgggtttacaacta--
H9AAA8_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AA76_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAN8_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAS0_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAV3_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
H9AAY5_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
M9YVA3_E1B19K-01        ------------------------gctgcgccggcgggtttacaacta--
M9YVF6_E1B19K-01        ----------------------ctgaggaggaggagggcttgcattta--
A0A0M3TH31_E1B19K-      ----------------------ctgaggaggaggagggcttgcattta--
M9YXY5_E1B19K-01        ----------------------ctgaggaggaggagggcttgcattta--
G0ZAH2_E1B19K-01        ----------------------gaggggatcctgagaggggtgatgca--
A0A1L3INW0_E1B19K-      --------------------------aggggcag-gaagcttta------
A0A2H4CJZ0_E1B19K-      ----------------------ctgaggaagaggagggtct---------
H8PFZ1_E1B19K-01        ----------------------ctgcggaagaggagggtct---------
F6KST6_E1B19K-01        ----------------------aaggggcg-----gaagcttta------
F2WTG5_E1B19K-01        ----------------------agagggag-----gaagctgta------
Q695T5_E1B19K-01        ----------------------agggggag-----gaagctgta------
H9TER0_E1B19K-01        ----------------------agggggag-----gaagctgta------
Q6WQ37_E1B19K-01        ----------------------ttgtgagacacaagaatcgcctgcta--
J9Z4N4_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
Q71BY5_E1B19K-02        ----------------------tggtgagacacaagaatcgcctacta--
E1ARN8_E1B19K-01        ----------------------tggtgagacacaagaatcgcctacta--
P03246_E1B19K-01        ----------------------ttgtgagacacaagaatcgcctgcta--
Q6VGV8_E1B19K-01        ----------------------ttgtgagacacaagaatcgcctgcta--
A0A0G2R248_E1B19K-      ----------------------ttgtgagacacaagaatcgcctgcta--
A0A291P1B2_E1B19K-      ----------------------tggtgagacacaagaatcgcctgcta--
T1UG63_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
A0A1U9ALK7_E1B19K-      ----------------------tggtgagacacaagaatcgcctgcta--
P03247_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
J9Z5H0_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
J9Z4H6_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
A0A2H4PJ75_E1B19K-      ----------------------tggtgagacacaagaatcgcctgcta--
J7I6T8_E1B19K-01        ----------------------tggtgagacacaagaatcgcctgcta--
A0A384ZUF2_E1B19K-      gggagccagaaggggcaccttccagccgtaccagtgcaactttagccaga
A0A384ZUM9_E1B19K-      gggcgccagaaggggcacctttcagccgtaccagtgcaactttagccaga
B9A5L5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UGY3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A1P7YYY5_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
A0A1P7YWY2_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
A0A1P7YWR9_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
A0A1P7YXN8_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
A0A1P8C849_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
B9A5A7_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UG22_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QVG6_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
X4YVU5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QUS9_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QU02_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A291B0H2_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
M0QV87_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UKV6_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
W8VNG2_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
F8UFP5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UGT5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UGX3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
W8CZB0_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
G3CK71_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QTS5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QV08_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
G9JUV5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
G1FC01_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A0G2UY10_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
A0A1J0MS84_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
M0QUJ3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
H0PPE7_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UKP8_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UHQ8_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
Q4KSL0_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
T1UHG3_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
A0A384ZUF2_E1B19K-      ----------------------cagcggggacagagaatcttgaatta--
M0QUN2_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
E1CIM6_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
E1AI10_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
Q9YL99_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
K7ZLN6_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
E1CIR1_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
A0A1Y1BXT7_E1B19K-      ----------------------cagcggggacagaaaatcttgaatta--
T1UHH6_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QVT4_E1B19K-01        ----------------------cagcggggacagagaatcttgaatta--
T1ULJ8_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
E9P585_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
D4N3H6_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
C4P207_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1ULP4_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A384ZUM9_E1B19K-      ----------------------cagcggggacagagaatcttgagtta--
X4Y9D2_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UHL7_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B9A5Q1_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QUB4_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QVK6_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A075TSZ1_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
F1DT57_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QUF3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
E5RWD9_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
E5RWL1_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B6DU90_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B9A5T7_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B6C6W8_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B9A681_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A1Y1BYF1_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
T1UHZ2_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
B2VQE3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QU76_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QVC7_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QU41_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
C5HDR2_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
D3GBW3_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
A0A097I4T0_E1B19K-      ----------------------cagcggggacagagaatcttgaacta--
T1UK99_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
G1FBW4_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UKQ0_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QVP5_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
H5T740_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QUW8_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
E1CIJ0_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
T1UGU0_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--
M0QV47_E1B19K-01        ----------------------cagcggggacagagaatcttgaacta--

A0A097IW62_E1B19K-      ---------------------ctcgcgggagccg------------cggt
A0A0M3TH18_E1B19K-      ---------------------ctcgcaggggccg------------cggt
A0A1W5PVU4_E1B19K-      ---------------------ctcgcaggggccg------------cggt
Q6QPF3_E1B19K-01        ---------------------cttgccagtacag-----------ccggt
Q6QPB7_E1B19K-01        ---------------------cttgccagtacag-----------ccggt
Q6QPI9_E1B19K-01        ---------------------cttgccagtacag-----------ccggt
G9G841_E1B19K-01        ---------------------cttgccggtacag-----------ccact
Q2KSM8_E1B19K-02        ---------------------cttgccggtacag-----------ccgct
Q2KSG6_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
Q2KSM8_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
A0A2L1F3A2_E1B19K-      ---------------------cttgccggtacag-----------ccgct
A0A2R3WN16_E1B19K-      ---------------------cttgccggtacag-----------ccgct
Q2KSG6_E1B19K-02        -----------------------tgccggtacag-----------ccgct
A0A2L1F392_E1B19K-      -----------------------tgccggtacag-----------ccgct
Q8UY91_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
P10406_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
Q5GFC7_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
A0A2R3WN62_E1B19K-      ---------------------cttgccggtacag-----------ccgct
Q5GFC8_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
Q6H1D7_E1B19K-01        ---------------------cttgccggtacag-----------ccgct
T1UJX4_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
Q7T951_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
T1UE63_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
Q7T8D8_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
Q5UW22_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
Q8B8U7_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
C7SRS7_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
Q32UI6_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
J7H4R9_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
D2DM83_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
J7I6W7_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
W6EIX6_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
A0A1L7NRH1_E1B19K-      ---------------------ctggccagtgcag-----------ccttt
Q3ZL02_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
T1UFS4_E1B19K-01        ---------------------ctggccagtgcag-----------ccttt
T2CI10_E1B19K-01        ---------------------ctggccagtacag-----------cctct
A0A0K0PX35_E1B19K-      ---------------------ctggccagtgcag-----------cctct
A0A0K0PX99_E1B19K-      ---------------------ctggccagtgcag-----------cctct
Q3ZKW2_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
Q2KRU2_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
K7NG43_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
Q2KS85_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
A0A0B4SJH1_E1B19K-      ---------------------ctggccagtgcag-----------cctct
A0A075IQ70_E1B19K-      ---------------------ctggccagtgcag-----------cctct
T1UIP3_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
R4HLE1_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
Q5EY83_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
Q2Y0J3_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
J7ID56_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
I6LEP5_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
R4HLJ6_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
R4HLA0_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
Q2KSL3_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
I6LES1_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
T1UF50_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
R4HMC6_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
I1V161_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
J7I6S4_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
A0A220VZ73_E1B19K-      ---------------------ctggccagtgcag-----------cctct
P03248_E1B19K-02        ---------------------ctggccagtgcag-----------cctct
Q6RK98_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
J7I6Q4_E1B19K-01        ---------------------ctggccagtgcag-----------cctct
A0A1S6ELT2_E1B19K-      ---------------------ctcgccggcgcag------------cctc
F4ZCJ8_E1B19K-01        ---------------------ctcgccggcgcag------------cctc
B5SNR1_E1B19K-01        ---------------------ctcgccggcgcag------------cctc
P10544_E1B19K-01        ---------------------ctcgccggcgcag------------cctc
W0S1G8_E1B19K-01        ---------------------ctcgccggcgcag------------cctc
A0A142G3J2_E1B19K-      ---------------------cttgccggcgcag------------cgtc
P10543_E1B19K-01        ---------------------cttgccggcgcag------------cgtc
D3JIR7_E1B19K-01        ---------------------ctcgctggcgcgg-----------ccttt
A0A076V686_E1B19K-      ---------------------ctcgctggcgcgg-----------ccttt
P04492_E1B19K-01        ---------------------ctcgctggcgcgg-----------ccttt
G1DE13_E1B19K-01        ---------------------ctcgctggcgcgg-----------cctct
D0Z5R9_E1B19K-01        ---------------------ctcgctggcgcgg-----------cctct
T1UEX7_E1B19K-01        ---------------------ctcgctggcgcgg-----------cctct
A0A2H5AI99_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A0A1EUE4_E1B19K-      ---------------------ctcgcgggcgcag----------------
A0MK43_E1B19K-01        ---------------------cttgcgggcgcag----------------
A0A2H5AID8_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIL0_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIC5_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AI40_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AII9_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIN5_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIU0_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIS9_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIT6_E1B19K-      ---------------------cttgcgggcgcag----------------
Q5C8R2_E1B19K-01        ---------------------cttgcgggcgcag----------------
A0A2H5AI21_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A0M5L3Y4_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A0A1EUC8_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AI04_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AI72_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A2H5AIL3_E1B19K-      ---------------------cttgcgggcgcag----------------
A0A0A1EUB2_E1B19K-      ---------------------cttgcgggcgcag----------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
A0A0M4N3Z1_E1B19K-      ---------------------ctcgcgggggctg------------cctc
Q8B6X5_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
A0A0M4NHE0_E1B19K-      ---------------------ctcgcgggggctg------------cctc
H9AAD9_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAK5_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAH3_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
F2WTJ7_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
F2WTM9_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
A0A1C8EG46_E1B19K-      ---------------------ctcgcgggggctg------------cctc
H9AAA8_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AA76_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAN8_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAS0_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAV3_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
H9AAY5_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
M9YVA3_E1B19K-01        ---------------------ctcgcgggggctg------------cctc
M9YVF6_E1B19K-01        ---------------------cttgccggtgcag--------cctcagca
A0A0M3TH31_E1B19K-      ---------------------cttgccggtgcag--------cctcagcg
M9YXY5_E1B19K-01        ---------------------cttgccggtgcag--------cctcagcg
G0ZAH2_E1B19K-01        ---------------------ggggccccgggcg---cgggtgaaccggg
A0A1L3INW0_E1B19K-      ---------------------cgggagaatgtta---------------g
A0A2H4CJZ0_E1B19K-      ---------------------caggcttct----------------cgcc
H8PFZ1_E1B19K-01        ---------------------caggcttct----------------cgcc
F6KST6_E1B19K-01        ---------------------caggcgtttggtg-----gagaggcatcc
F2WTG5_E1B19K-01        ---------------------cgggcgcctggtg-----gagaggcatcc
Q695T5_E1B19K-01        ---------------------cgggcgcttggtg-----gagaggcatcc
H9TER0_E1B19K-01        ---------------------cgggcgcttggtg-----gagaggcatcc
Q6WQ37_E1B19K-01        ---------------------ctgttgtcttccg----------------
J9Z4N4_E1B19K-01        ---------------------ctgttgtcttccg----------------
Q71BY5_E1B19K-02        ---------------------ctgttgtcttccg----------------
E1ARN8_E1B19K-01        ---------------------ctgttgtcttccg----------------
P03246_E1B19K-01        ---------------------ctgttgtcttccg----------------
Q6VGV8_E1B19K-01        ---------------------ctgttgtcttccg----------------
A0A0G2R248_E1B19K-      ---------------------ctgttgtcttccg----------------
A0A291P1B2_E1B19K-      ---------------------ctgttgtcttccg----------------
T1UG63_E1B19K-01        ---------------------ctgttgtcttccg----------------
A0A1U9ALK7_E1B19K-      ---------------------ctgttgtcttccg----------------
P03247_E1B19K-01        ---------------------ctgttgtcttccg----------------
J9Z5H0_E1B19K-01        ---------------------ctgttgtcttccg----------------
J9Z4H6_E1B19K-01        ---------------------ctgttgtcttccg----------------
A0A2H4PJ75_E1B19K-      ---------------------ctgttgtcttccg----------------
J7I6T8_E1B19K-01        ---------------------ctgttgtcttccg----------------
A0A384ZUF2_E1B19K-      ccaagctgctgttggagaacgatgccttctccagggtgaacctgaacggc
A0A384ZUM9_E1B19K-      ccaagctgctgttggagaacgatgccttctccagggtgaacctgaacggc
B9A5L5_E1B19K-01        ---------------------ctggcttttacag-----------ccagc
T1UGY3_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A1P7YYY5_E1B19K-      ---------------------ctggcttctacag-----------ccagc
A0A1P7YWY2_E1B19K-      ---------------------ctggcttctacag-----------ccagc
A0A1P7YWR9_E1B19K-      ---------------------ctggcttctacag-----------ccagc
A0A1P7YXN8_E1B19K-      ---------------------ctggcttctacag-----------ccagc
A0A1P8C849_E1B19K-      ---------------------ctggcttctacag-----------ccagc
B9A5A7_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UG22_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QVG6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
X4YVU5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QUS9_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QU02_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A291B0H2_E1B19K-      ---------------------ctggcttctacag-----------ccagc
M0QV87_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UKV6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
W8VNG2_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
F8UFP5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UGT5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UGX3_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
W8CZB0_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
G3CK71_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QTS5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QV08_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
G9JUV5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
G1FC01_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A0G2UY10_E1B19K-      ---------------------ctggcttctacag-----------ccagc
A0A1J0MS84_E1B19K-      ---------------------ctggcttctacag-----------ccagc
M0QUJ3_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
H0PPE7_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UKP8_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UHQ8_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
Q4KSL0_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UHG3_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A384ZUF2_E1B19K-      ---------------------ctggcttctacag-----------ccagc
M0QUN2_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
E1CIM6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
E1AI10_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
Q9YL99_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
K7ZLN6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
E1CIR1_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A1Y1BXT7_E1B19K-      ---------------------ctggcttctacag-----------ccagc
T1UHH6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QVT4_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1ULJ8_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
E9P585_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
D4N3H6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
C4P207_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1ULP4_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A384ZUM9_E1B19K-      ---------------------ctggcttctacag-----------ccagc
X4Y9D2_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UHL7_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
B9A5Q1_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QUB4_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QVK6_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
A0A075TSZ1_E1B19K-      ---------------------ctggcttctacag-----------ccagc
F1DT57_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QUF3_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
E5RWD9_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
E5RWL1_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
B6DU90_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
B9A5T7_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
B6C6W8_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
B9A681_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
A0A1Y1BYF1_E1B19K-      ---------------------ctggcttatacag-----------ccagc
T1UHZ2_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
B2VQE3_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
M0QU76_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
M0QVC7_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
M0QU41_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
C5HDR2_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
D3GBW3_E1B19K-01        ---------------------ctggcttatacag-----------ccagc
A0A097I4T0_E1B19K-      ---------------------ctggcttatacag-----------ccagc
T1UK99_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
G1FBW4_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UKQ0_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QVP5_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
H5T740_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QUW8_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
E1CIJ0_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
T1UGU0_E1B19K-01        ---------------------ctggcttctacag-----------ccagc
M0QV47_E1B19K-01        ---------------------ctggcttctacag-----------ccagc

A0A097IW62_E1B19K-      cgct----------------------------------------------
A0A0M3TH18_E1B19K-      cgctg---------------------------------------------
A0A1W5PVU4_E1B19K-      cgctg---------------------------------------------
Q6QPF3_E1B19K-01        agaca---------------------------------------------
Q6QPB7_E1B19K-01        agaca---------------------------------------------
Q6QPI9_E1B19K-01        agaca---------------------------------------------
G9G841_E1B19K-01        agaca---------------------------------------------
Q2KSM8_E1B19K-02        ag------------------------------------------------
Q2KSG6_E1B19K-01        agaca---------------------------------------------
Q2KSM8_E1B19K-01        agaca---------------------------------------------
A0A2L1F3A2_E1B19K-      agaca---------------------------------------------
A0A2R3WN16_E1B19K-      agaca---------------------------------------------
Q2KSG6_E1B19K-02        ag------------------------------------------------
A0A2L1F392_E1B19K-      ag------------------------------------------------
Q8UY91_E1B19K-01        agaca---------------------------------------------
P10406_E1B19K-01        ag------------------------------------------------
Q5GFC7_E1B19K-01        ag------------------------------------------------
A0A2R3WN62_E1B19K-      ag------------------------------------------------
Q5GFC8_E1B19K-01        agaca---------------------------------------------
Q6H1D7_E1B19K-01        agaca---------------------------------------------
T1UJX4_E1B19K-01        gggtg---------------------------------------------
Q7T951_E1B19K-01        gggtg---------------------------------------------
T1UE63_E1B19K-01        gggtg---------------------------------------------
Q7T8D8_E1B19K-01        gggtg---------------------------------------------
Q5UW22_E1B19K-01        gggtg---------------------------------------------
Q8B8U7_E1B19K-01        gggtg---------------------------------------------
C7SRS7_E1B19K-01        gggtg---------------------------------------------
Q32UI6_E1B19K-01        gggtg---------------------------------------------
J7H4R9_E1B19K-01        gggtg---------------------------------------------
D2DM83_E1B19K-01        gggtg---------------------------------------------
J7I6W7_E1B19K-01        gggtg---------------------------------------------
W6EIX6_E1B19K-01        gggtg---------------------------------------------
A0A1L7NRH1_E1B19K-      gggtg---------------------------------------------
Q3ZL02_E1B19K-01        gggtg---------------------------------------------
T1UFS4_E1B19K-01        gggtg---------------------------------------------
T2CI10_E1B19K-01        gggcg---------------------------------------------
A0A0K0PX35_E1B19K-      gggcg---------------------------------------------
A0A0K0PX99_E1B19K-      gggcg---------------------------------------------
Q3ZKW2_E1B19K-01        gggag---------------------------------------------
Q2KRU2_E1B19K-01        gggag---------------------------------------------
K7NG43_E1B19K-01        gggag---------------------------------------------
Q2KS85_E1B19K-01        gggag---------------------------------------------
A0A0B4SJH1_E1B19K-      gggag---------------------------------------------
A0A075IQ70_E1B19K-      gggag---------------------------------------------
T1UIP3_E1B19K-01        gggag---------------------------------------------
R4HLE1_E1B19K-01        aggag---------------------------------------------
Q5EY83_E1B19K-01        gggag---------------------------------------------
Q2Y0J3_E1B19K-01        gggag---------------------------------------------
J7ID56_E1B19K-01        gggag---------------------------------------------
I6LEP5_E1B19K-01        gggag---------------------------------------------
R4HLJ6_E1B19K-01        gggag---------------------------------------------
R4HLA0_E1B19K-01        gggag---------------------------------------------
Q2KSL3_E1B19K-01        gggag---------------------------------------------
I6LES1_E1B19K-01        gggag---------------------------------------------
T1UF50_E1B19K-01        gggag---------------------------------------------
R4HMC6_E1B19K-01        aggag---------------------------------------------
I1V161_E1B19K-01        aggag---------------------------------------------
J7I6S4_E1B19K-01        aggag---------------------------------------------
A0A220VZ73_E1B19K-      aggag---------------------------------------------
P03248_E1B19K-02        aggag---------------------------------------------
Q6RK98_E1B19K-01        aggag---------------------------------------------
J7I6Q4_E1B19K-01        aggag---------------------------------------------
A0A1S6ELT2_E1B19K-      cgcac---------------------------------------------
F4ZCJ8_E1B19K-01        cgcac---------------------------------------------
B5SNR1_E1B19K-01        cgcac---------------------------------------------
P10544_E1B19K-01        cgcac---------------------------------------------
W0S1G8_E1B19K-01        cgcac---------------------------------------------
A0A142G3J2_E1B19K-      cgcac---------------------------------------------
P10543_E1B19K-01        cgcac---------------------------------------------
D3JIR7_E1B19K-01        gacca------------------tg-------------------------
A0A076V686_E1B19K-      gacca------------------tg-------------------------
P04492_E1B19K-01        gacca------------------tg-------------------------
G1DE13_E1B19K-01        aacca------------------tg-------------------------
D0Z5R9_E1B19K-01        aacca------------------tg-------------------------
T1UEX7_E1B19K-01        aacca------------------tg-------------------------
A0A2H5AI99_E1B19K-      -cctc------------------cg-------------------------
A0A0A1EUE4_E1B19K-      -cctc------------------cg-------------------------
A0MK43_E1B19K-01        -cctc------------------cg-------------------------
A0A2H5AID8_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIL0_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIC5_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AI40_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AII9_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIN5_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIU0_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIS9_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIT6_E1B19K-      -cctc------------------cg-------------------------
Q5C8R2_E1B19K-01        -cctc------------------cg-------------------------
A0A2H5AI21_E1B19K-      -cctc------------------cg-------------------------
A0A0M5L3Y4_E1B19K-      -cctc------------------cg-------------------------
A0A0A1EUC8_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AI04_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AI72_E1B19K-      -cctc------------------cg-------------------------
A0A2H5AIL3_E1B19K-      -cctc------------------cg-------------------------
A0A0A1EUB2_E1B19K-      -cctc------------------cg-------------------------
Q71BY5_E1B19K-01        --ccc---------------------------------------------
P06501_E1B19K-01        agcta---------------------------------------------
A0A0M4N3Z1_E1B19K-      agcta---------------------------------------------
Q8B6X5_E1B19K-01        agcta---------------------------------------------
A0A0M4NHE0_E1B19K-      cgctc---------------------------------------------
H9AAD9_E1B19K-01        cgctc---------------------------------------------
H9AAK5_E1B19K-01        cgctc---------------------------------------------
H9AAH3_E1B19K-01        cgctc---------------------------------------------
F2WTJ7_E1B19K-01        cgctc---------------------------------------------
F2WTM9_E1B19K-01        cgctc---------------------------------------------
A0A1C8EG46_E1B19K-      cgctc---------------------------------------------
H9AAA8_E1B19K-01        cgctc---------------------------------------------
H9AA76_E1B19K-01        cgctc---------------------------------------------
H9AAN8_E1B19K-01        cgctc---------------------------------------------
H9AAS0_E1B19K-01        cgctc---------------------------------------------
H9AAV3_E1B19K-01        cgctc---------------------------------------------
H9AAY5_E1B19K-01        cgctc---------------------------------------------
M9YVA3_E1B19K-01        cgctc---------------------------------------------
M9YVF6_E1B19K-01        aggtc------------------tg-------------------------
A0A0M3TH31_E1B19K-      aggtc------------------tg-------------------------
M9YXY5_E1B19K-01        aggtc------------------tg-------------------------
G0ZAH2_E1B19K-01        agatcaggcgggaggtggaggagcggctgacgcaggtgcagcgggagttg
A0A1L3INW0_E1B19K-      agcgc------------------ca--------tccttcgctgatcc---
A0A2H4CJZ0_E1B19K-      ggcgc------------------gg-------------cctccgcac---
H8PFZ1_E1B19K-01        ggcgc------------------gg-------------cctccgcac---
F6KST6_E1B19K-01        gtctc------------------tg----cgccagcaccggcttcaa---
F2WTG5_E1B19K-01        gtctc------------------tg----cgccagcagcgtctgcaa---
Q695T5_E1B19K-01        gtctc------------------tg----cgccagcagcgtctgcaa---
H9TER0_E1B19K-01        gtctc------------------tg----cgccagcagcgtctgcaa---
Q6WQ37_E1B19K-01        ---tc------------------cg-----------cccggcgata----
J9Z4N4_E1B19K-01        ---tc------------------cg-----------cccggcaata----
Q71BY5_E1B19K-02        ---tc------------------cg-----------cccggcaata----
E1ARN8_E1B19K-01        ---tc------------------cg-----------cccggcaata----
P03246_E1B19K-01        ---tc------------------cg-----------cccggcgata----
Q6VGV8_E1B19K-01        ---tc------------------cg-----------cccggcgata----
A0A0G2R248_E1B19K-      ---tc------------------cg-----------cccggcgata----
A0A291P1B2_E1B19K-      ---tc------------------cg-----------cccggcaata----
T1UG63_E1B19K-01        ---tc------------------cg-----------cccggcaata----
A0A1U9ALK7_E1B19K-      ---tc------------------cg-----------cccggcaata----
P03247_E1B19K-01        ---tc------------------cg-----------cccggcaata----
J9Z5H0_E1B19K-01        ---tc------------------cg-----------cccggcaata----
J9Z4H6_E1B19K-01        ---tc------------------cg-----------cccggcaata----
A0A2H4PJ75_E1B19K-      ---tc------------------cg-----------cccggcaata----
J7I6T8_E1B19K-01        ---tc------------------cg-----------cccggcaata----
A0A384ZUF2_E1B19K-      atctt------------------tgacatggatgtctcggtgtacaagat
A0A384ZUM9_E1B19K-      atctt------------------tgacatggatgtctcggtgtacaagat
B9A5L5_E1B19K-01        agcgt------------------cg----ggtcttcttcatctacac---
T1UGY3_E1B19K-01        agctt------------------cg----ggtcttcttcatctacac---
A0A1P7YYY5_E1B19K-      agctt------------------cg----ggtcttcttcatctacac---
A0A1P7YWY2_E1B19K-      agctt------------------cg----ggtcttcttcatctacac---
A0A1P7YWR9_E1B19K-      agctt------------------cg----ggtcttcttcatctacac---
A0A1P7YXN8_E1B19K-      agctt------------------cg----ggtcttcttcatctacac---
A0A1P8C849_E1B19K-      agctt------------------tg----ggtcttcttcatctacac---
B9A5A7_E1B19K-01        agctt------------------cg----ggtcttcttcatctacac---
T1UG22_E1B19K-01        agctt------------------cg----ggtcttcttcatctacac---
M0QVG6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
X4YVU5_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QUS9_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QU02_E1B19K-01        agctc------------------cg----ggtcttcttcatctacac---
A0A291B0H2_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
M0QV87_E1B19K-01        agttc------------------cg----ggtcttcttcgtctacac---
T1UKV6_E1B19K-01        agttc------------------cg----ggtcttcttcgtctacac---
W8VNG2_E1B19K-01        agctc------------------cg----ggtcttcttcatctacac---
F8UFP5_E1B19K-01        agctc------------------cg----ggtcttcttcatctacac---
T1UGT5_E1B19K-01        agttc------------------cg----ggtcttcttcgtctacac---
T1UGX3_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
W8CZB0_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
G3CK71_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QTS5_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QV08_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
G9JUV5_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
G1FC01_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
A0A0G2UY10_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
A0A1J0MS84_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
M0QUJ3_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
H0PPE7_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1UKP8_E1B19K-01        agctc------------------ca----ggtcttcttcgtctacac---
T1UHQ8_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
Q4KSL0_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1UHG3_E1B19K-01        agctc------------------cg----ggtcttctttgtctacac---
A0A384ZUF2_E1B19K-      agctc------------------cg----gttcttcttcgtctacac---
M0QUN2_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E1CIM6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E1AI10_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
Q9YL99_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
K7ZLN6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E1CIR1_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
A0A1Y1BXT7_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
T1UHH6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QVT4_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1ULJ8_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E9P585_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
D4N3H6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
C4P207_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1ULP4_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
A0A384ZUM9_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
X4Y9D2_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1UHL7_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B9A5Q1_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QUB4_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QVK6_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
A0A075TSZ1_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
F1DT57_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QUF3_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E5RWD9_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E5RWL1_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B6DU90_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B9A5T7_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B6C6W8_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B9A681_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
A0A1Y1BYF1_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
T1UHZ2_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
B2VQE3_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QU76_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QVC7_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QU41_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
C5HDR2_E1B19K-01        agttc------------------cg----ggtcttcttcgtctacac---
D3GBW3_E1B19K-01        agttc------------------cg----ggtcttcttcgtctacac---
A0A097I4T0_E1B19K-      agctc------------------cg----ggtcttcttcgtctacac---
T1UK99_E1B19K-01        agctc------------------cg----ggtcttcttcatctacac---
G1FBW4_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1UKQ0_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QVP5_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
H5T740_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QUW8_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
E1CIJ0_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
T1UGU0_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---
M0QV47_E1B19K-01        agctc------------------cg----ggtcttcttcgtctacac---

A0A097IW62_E1B19K-      ----------------gcagcggttgcaaaccagcctcc--------gga
A0A0M3TH18_E1B19K-      --------------ccgcagcgggtg------------c--------gga
A0A1W5PVU4_E1B19K-      --------------ccgcagcgggtg------------c--------gga
Q6QPF3_E1B19K-01        --------------cgctgaggatcctgagtctccagtca---ccccagg
Q6QPB7_E1B19K-01        --------------cgctgaggatcctgagtctccagtca---ccccagg
Q6QPI9_E1B19K-01        --------------cgctgaggatcctgagtctccagtca---ccccagg
G9G841_E1B19K-01        --------------ctctgaagatcctgaatctccaggagagtcccaggg
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------ctctgaggatcctaagtctccagcaaatttcccagg
Q2KSM8_E1B19K-01        --------------ctctgaggatcctaagtctccagcaaatttcccagg
A0A2L1F3A2_E1B19K-      --------------ctctgaggatcctaagtctccagcaaatttcccagg
A0A2R3WN16_E1B19K-      --------------ctctgaggatcctaagtctccagcaaatttcccagg
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        --------------ctctgaggatcctgaatctccaggagagtcccaggg
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        --------------ctctgaggatcctgagtctc----------------
Q6H1D7_E1B19K-01        --------------ctctgaggatcctgagtctc----------------
T1UJX4_E1B19K-01        --------------tagcgggaatcctgaggcatc--------cacctgt
Q7T951_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
T1UE63_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
Q7T8D8_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
Q5UW22_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
Q8B8U7_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
C7SRS7_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
Q32UI6_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
J7H4R9_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
D2DM83_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
J7I6W7_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
W6EIX6_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
A0A1L7NRH1_E1B19K-      --------------tagcgggaatcctgaggcatc--------caccggt
Q3ZL02_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
T1UFS4_E1B19K-01        --------------tagcgggaatcctgaggcatc--------caccggt
T2CI10_E1B19K-01        --------------tagcagggatcctgagacacc--------caccgac
A0A0K0PX35_E1B19K-      --------------tagcagggatcctgagacacc--------cacctgc
A0A0K0PX99_E1B19K-      --------------tagcagggatcctgagacacc--------caccggc
Q3ZKW2_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
Q2KRU2_E1B19K-01        --------------tagcagggatactgagacacc--------caccggc
K7NG43_E1B19K-01        --------------tagcagggatactgagacacc--------caccggc
Q2KS85_E1B19K-01        --------------tagcagggatactgagacacc--------caccggc
A0A0B4SJH1_E1B19K-      --------------tagcagggatactgagacacc--------caccggc
A0A075IQ70_E1B19K-      --------------tagcagggatactgagacacc--------caccggc
T1UIP3_E1B19K-01        --------------tagcagggatactgagacacc--------caccggc
R4HLE1_E1B19K-01        --------------tagcagggatattgagacacc--------caccgac
Q5EY83_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
Q2Y0J3_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
J7ID56_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
I6LEP5_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
R4HLJ6_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
R4HLA0_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
Q2KSL3_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
I6LES1_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
T1UF50_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
R4HMC6_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
I1V161_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
J7I6S4_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
A0A220VZ73_E1B19K-      --------------tagcagggatactgagacacc--------caccgac
P03248_E1B19K-02        --------------tagcagggatactgagacacc--------cacctac
Q6RK98_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
J7I6Q4_E1B19K-01        --------------tagcagggatactgagacacc--------caccgac
A0A1S6ELT2_E1B19K-      --------------ggtctggatccagtgcg---ggaggagga----gga
F4ZCJ8_E1B19K-01        --------------ggtctggatccagtgcgggaggaggagga----gga
B5SNR1_E1B19K-01        --------------ggtctggatccagtgcg---ggaggagga----gga
P10544_E1B19K-01        --------------ggtctggatccagtgcg---------gga----gga
W0S1G8_E1B19K-01        --------------ggtctggatccagtgcg---------gga----gga
A0A142G3J2_E1B19K-      --------------ggtttggatccagtgca----------------gga
P10543_E1B19K-01        --------------ggtttggatccagtgca----------------gga
D3JIR7_E1B19K-01        --------------ccgcgactgccaacgtt----------------gca
A0A076V686_E1B19K-      --------------ccgcgactgccaacgtt----------------gc-
P04492_E1B19K-01        --------------ccgccgctgccgacgtt----------------gca
G1DE13_E1B19K-01        --------------ccgccgttgc--------------------------
D0Z5R9_E1B19K-01        --------------ccgccgttgc--------------------------
T1UEX7_E1B19K-01        --------------ccgccgttgc--------------------------
A0A2H5AI99_E1B19K-      --------------cggttggatcgagtgga----------------gga
A0A0A1EUE4_E1B19K-      --------------cggctggatcgagtggt----------------gga
A0MK43_E1B19K-01        --------------cggctggaccgagtggt----------------gga
A0A2H5AID8_E1B19K-      --------------cggctggatcgagtggt----------------gga
A0A2H5AIL0_E1B19K-      --------------cggctggatcgagtggt----------------gga
A0A2H5AIC5_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AI40_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AII9_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AIN5_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AIU0_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AIS9_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A2H5AIT6_E1B19K-      --------------cggctggaccgagtggt----------------gga
Q5C8R2_E1B19K-01        --------------cggctggaccgagtggt----------------gga
A0A2H5AI21_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A0M5L3Y4_E1B19K-      --------------cggctggaccgagtggt----------------gga
A0A0A1EUC8_E1B19K-      --------------cggctggaccgagtgga----------------gga
A0A2H5AI04_E1B19K-      --------------cggctggaccgagtgga----------------gga
A0A2H5AI72_E1B19K-      --------------cggctggaccgagtgga----------------gga
A0A2H5AIL3_E1B19K-      --------------cggctggaccgagtgga----------------gga
A0A0A1EUB2_E1B19K-      --------------cggctgggccgagtgga----------------gga
Q71BY5_E1B19K-01        -----------------------------------------------ggc
P06501_E1B19K-01        --------------gggccggcggcgccgct----------------ggc
A0A0M4N3Z1_E1B19K-      --------------gggccggtggcgccgct----------------ggt
Q8B6X5_E1B19K-01        --------------gggccggtggcgccgct----------------ggt
A0A0M4NHE0_E1B19K-      --------------gggctggcgtcggtggc----------------gga
H9AAD9_E1B19K-01        --------------gggctggcgtcggtggc----------------gga
H9AAK5_E1B19K-01        --------------gggctggcgtcggtggc----------------gga
H9AAH3_E1B19K-01        --------------gggctggcgtcggtggc----------------gga
F2WTJ7_E1B19K-01        --------------gggcgggcatcgttgcc----------------gga
F2WTM9_E1B19K-01        --------------gggcgggcatcgttgcc----------------gga
A0A1C8EG46_E1B19K-      --------------gggcgggcatcttcgcc----------------gga
H9AAA8_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
H9AA76_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
H9AAN8_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
H9AAS0_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
H9AAV3_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
H9AAY5_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
M9YVA3_E1B19K-01        --------------gggcgggcatcgtcgcc----------------gga
M9YVF6_E1B19K-01        --------------gagcgagt-------------------------gga
A0A0M3TH31_E1B19K-      --------------gagcgagt-------------------------gga
M9YXY5_E1B19K-01        --------------gagcgagt-------------------------gga
G0ZAH2_E1B19K-01        gaagagagggagagggagaggcagcagcggg----------------aga
A0A1L3INW0_E1B19K-      --------------agaagaccgtgcgagctcaggttctgtcgcggtggg
A0A2H4CJZ0_E1B19K-      --------------ggactggatccggtgct----------------gga
H8PFZ1_E1B19K-01        --------------ggactggatccggtgct----------------gga
F6KST6_E1B19K-01        --------------gcccaagcactgctgaggca-------------gga
F2WTG5_E1B19K-01        --------------gctcaagtgctgctgaggcg-------------gga
Q695T5_E1B19K-01        --------------gctcaagtgctgctgaggcg-------------gga
H9TER0_E1B19K-01        --------------gctcaagtgctgctgaggcg-------------gga
Q6WQ37_E1B19K-01        --------------ataccgac-------------------------gga
J9Z4N4_E1B19K-01        --------------ataccgac-------------------------gga
Q71BY5_E1B19K-02        --------------ataccgac-------------------------gga
E1ARN8_E1B19K-01        --------------ataccgac-------------------------gga
P03246_E1B19K-01        --------------ataccgac-------------------------gga
Q6VGV8_E1B19K-01        --------------ataccgac-------------------------gga
A0A0G2R248_E1B19K-      --------------ataccgac-------------------------gga
A0A291P1B2_E1B19K-      --------------ataccgac-------------------------gga
T1UG63_E1B19K-01        --------------ataccgac-------------------------gga
A0A1U9ALK7_E1B19K-      --------------ataccgac-------------------------gga
P03247_E1B19K-01        --------------ataccgac-------------------------gga
J9Z5H0_E1B19K-01        --------------ataccgac-------------------------gga
J9Z4H6_E1B19K-01        --------------ataccgac-------------------------gga
A0A2H4PJ75_E1B19K-      --------------ataccgac-------------------------gga
J7I6T8_E1B19K-01        --------------ataccgac-------------------------gga
A0A384ZUF2_E1B19K-      cctgagatacgatgagaccaa-gtccagggtgcgcgcttgcgagtgcggg
A0A384ZUM9_E1B19K-      cctgagatacgatgagaccaa-gtccagggtgcgcgcttgcgagtgcggg
B9A5L5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGY3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A1P7YYY5_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1P7YWY2_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1P7YWR9_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1P7YXN8_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1P8C849_E1B19K-      --------------agacaaacatccatgtt----------------gga
B9A5A7_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UG22_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QVG6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
X4YVU5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QUS9_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QU02_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A291B0H2_E1B19K-      --------------agacaaacatccatgtt----------------gga
M0QV87_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UKV6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
W8VNG2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
F8UFP5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGT5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGX3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
W8CZB0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
G3CK71_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QTS5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QV08_E1B19K-01        --------------agacaaacatccatgtt----------------gga
G9JUV5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
G1FC01_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A0G2UY10_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1J0MS84_E1B19K-      --------------agacaaacatccatgtt----------------gga
M0QUJ3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
H0PPE7_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UKP8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHQ8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
Q4KSL0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHG3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A384ZUF2_E1B19K-      --------------agacaaacatccatgtt----------------gga
M0QUN2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E1CIM6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E1AI10_E1B19K-01        --------------agacaaacatccatgtt----------------gga
Q9YL99_E1B19K-01        --------------agacaaacatccatgtt----------------gga
K7ZLN6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E1CIR1_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A1Y1BXT7_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UHH6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QVT4_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1ULJ8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E9P585_E1B19K-01        --------------agacaaacatccatgtt----------------gga
D4N3H6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
C4P207_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1ULP4_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A384ZUM9_E1B19K-      --------------agacaaacatccatgtt----------------gga
X4Y9D2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHL7_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B9A5Q1_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QUB4_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QVK6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A075TSZ1_E1B19K-      --------------agacaaacatccatgtt----------------gga
F1DT57_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QUF3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E5RWD9_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E5RWL1_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B6DU90_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B9A5T7_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B6C6W8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B9A681_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A1Y1BYF1_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UHZ2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B2VQE3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QU76_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QVC7_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QU41_E1B19K-01        --------------agacaaacatccatgtt----------------gga
C5HDR2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
D3GBW3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A097I4T0_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UK99_E1B19K-01        --------------agacaaacatccatgtt----------------gga
G1FBW4_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UKQ0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QVP5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
H5T740_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QUW8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
E1CIJ0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGU0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
M0QV47_E1B19K-01        --------------agacaaacatccatgtt----------------gga

A0A097IW62_E1B19K-      gg--------------------------cggttgggaatgccaacggacg
A0A0M3TH18_E1B19K-      gg--------------------------cggttggggttcaagacagagg
A0A1W5PVU4_E1B19K-      gg--------------------------cggctggggttccagacagagg
Q6QPF3_E1B19K-01        aa--------------caccaacgccgccagcagccgcagcaggagcagc
Q6QPB7_E1B19K-01        aa--------------caccaacgccgccagcagccgcagcaggagcagc
Q6QPI9_E1B19K-01        aa--------------caccaacgccgccagcagccgcagcaggagcagc
G9G841_E1B19K-01        ca--------------cgccaacgtcgccggcagcagcagcggcagcag-
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        aa--------------cgccaacgccgc------cag------cagcag-
Q2KSM8_E1B19K-01        aa--------------cgccaacgccgc------cag------cagcag-
A0A2L1F3A2_E1B19K-      aa--------------cgccaacgccgc------cag------cagcag-
A0A2R3WN16_E1B19K-      aa--------------cgccaacgccgc------cag------cagcag-
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        ca--------------cgccaacgtcgc------cagcagcagcagcag-
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        -------------------------------------------cagcag-
Q6H1D7_E1B19K-01        -------------------------------------------cagcag-
T1UJX4_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q7T951_E1B19K-01        ca--------------tgccagcggttctggag-----------------
T1UE63_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q7T8D8_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q5UW22_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q8B8U7_E1B19K-01        ca--------------tgccagcggttctggag-----------------
C7SRS7_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q32UI6_E1B19K-01        ca--------------tgccagcggttctggag-----------------
J7H4R9_E1B19K-01        ca--------------tgccagcggttctggag-----------------
D2DM83_E1B19K-01        ca--------------tgccagcggttctggag-----------------
J7I6W7_E1B19K-01        ca--------------tgccagcggttctggag-----------------
W6EIX6_E1B19K-01        ca--------------tgccagcggttctggag-----------------
A0A1L7NRH1_E1B19K-      ca--------------tgccagcggttctggag-----------------
Q3ZL02_E1B19K-01        ca--------------tgccagcggttctggag-----------------
T1UFS4_E1B19K-01        ca--------------tgccagcggttctggag-----------------
T2CI10_E1B19K-01        ca--------------tgccagcggttttggag-----------------
A0A0K0PX35_E1B19K-      ca--------------tgccatcggttctggag-----------------
A0A0K0PX99_E1B19K-      aa--------------tgccagcggttctggag-----------------
Q3ZKW2_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q2KRU2_E1B19K-01        ca--------------tgccagcggttctggag-----------------
K7NG43_E1B19K-01        ca--------------tgccagcggttctggag-----------------
Q2KS85_E1B19K-01        ca--------------tgccagcggttctggag-----------------
A0A0B4SJH1_E1B19K-      ca--------------tgccagcggttctggag-----------------
A0A075IQ70_E1B19K-      ca--------------tgccagcggttctggag-----------------
T1UIP3_E1B19K-01        ca--------------tgccagcggttctggag-----------------
R4HLE1_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
Q5EY83_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
Q2Y0J3_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
J7ID56_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
I6LEP5_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
R4HLJ6_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
R4HLA0_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
Q2KSL3_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
I6LES1_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
T1UF50_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
R4HMC6_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
I1V161_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
J7I6S4_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
A0A220VZ73_E1B19K-      ca--------------tgccagcggttctgcag-----------------
P03248_E1B19K-02        ca--------------tgccagcggttctgcag-----------------
Q6RK98_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
J7I6Q4_E1B19K-01        ca--------------tgccagcggttctgcag-----------------
A0A1S6ELT2_E1B19K-      gg-----------------------------aggagg-------------
F4ZCJ8_E1B19K-01        gg-----------------------------aggagg-------------
B5SNR1_E1B19K-01        gg-----------------------------aggagg-------------
P10544_E1B19K-01        gg-----------------------------aggagg-------------
W0S1G8_E1B19K-01        gg-----------------------------aggagg-------------
A0A142G3J2_E1B19K-      ag-----------------------------aggagg-------------
P10543_E1B19K-01        ag-----------------------------aggagg-------------
D3JIR7_E1B19K-01        gg------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        ag------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A2H5AI99_E1B19K-      gg-----------------------------aggacgag-----------
A0A0A1EUE4_E1B19K-      gg-----------------------------aggacgag-----------
A0MK43_E1B19K-01        gg-----------------------------agaacgag-----------
A0A2H5AID8_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIL0_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIC5_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AI40_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AII9_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIN5_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIU0_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIS9_E1B19K-      gg-----------------------------agaacgag-----------
A0A2H5AIT6_E1B19K-      gg-----------------------------agaacgag-----------
Q5C8R2_E1B19K-01        gg-----------------------------agaacgag-----------
A0A2H5AI21_E1B19K-      gg-----------------------------agaacgag-----------
A0A0M5L3Y4_E1B19K-      gg-----------------------------agaacgag-----------
A0A0A1EUC8_E1B19K-      gg-----------------------------aggacgag-----------
A0A2H5AI04_E1B19K-      gg-----------------------------aggacgag-----------
A0A2H5AI72_E1B19K-      gg-----------------------------aggacgag-----------
A0A2H5AIL3_E1B19K-      gg-----------------------------aggacgag-----------
A0A0A1EUB2_E1B19K-      gg-----------------------------aggacgag-----------
Q71BY5_E1B19K-01        gt------------------------------------------------
P06501_E1B19K-01        ga------------------ggca------ggggtcgcagcaggaggagc
A0A0M4N3Z1_E1B19K-      ga------------------ggca------ggggtcgcagcaggaggagc
Q8B6X5_E1B19K-01        ga------------------ggca------ggggtcgcagcaggaggagc
A0A0M4NHE0_E1B19K-      gg------------------agcgttcggaggaatccaagccggaggtga
H9AAD9_E1B19K-01        gg------------------agcgttcggaggaatccaagccggaggtga
H9AAK5_E1B19K-01        gg------------------agcgttcggaggaatccaagccggaggtga
H9AAH3_E1B19K-01        gg------------------agcgttcggaggaatccaagccggaggtga
F2WTJ7_E1B19K-01        gg------------------agcagtcgccggaggtgaagccgaaggt--
F2WTM9_E1B19K-01        gg------------------agcagtcgccggaggtgaagccgaaggt--
A0A1C8EG46_E1B19K-      gg------------------agcagttgccggaggtgaagccggaggt--
H9AAA8_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
H9AA76_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
H9AAN8_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
H9AAS0_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
H9AAV3_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
H9AAY5_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
M9YVA3_E1B19K-01        gg------------------agcagtcgccggaggtgaagccggaggt--
M9YVF6_E1B19K-01        gg-----------------aagag---------gagg-------------
A0A0M3TH31_E1B19K-      gg-----------------aagag---------gagg-------------
M9YXY5_E1B19K-01        gg-----------------aagag---------gagg-------------
G0ZAH2_E1B19K-01        gg--------------gagcagcagcagcaggagggggaaatgactacga
A0A1L3INW0_E1B19K-      ga-----------gccctggagaacc------------------------
A0A2H4CJZ0_E1B19K-      gg--------------------agccggagccggagg-------------
H8PFZ1_E1B19K-01        gg--------------------agtcggagctggagg-------------
F6KST6_E1B19K-01        gg-----------agctggaaacaatattggaggagga-agcaatgaaca
F2WTG5_E1B19K-01        gg-----------atctggaggccatttcggaggaggagagc----ggca
Q695T5_E1B19K-01        gg-----------atctggaagccatttcggaggaggagagc----ggca
H9TER0_E1B19K-01        gg-----------atctggaagccatttcggaggaggagagc----ggca
Q6WQ37_E1B19K-01        gg------------agcagcagcagcagc--aggaggaa-------gcca
J9Z4N4_E1B19K-01        gg---agcag---------cagcagcagc--aggaggaa-------gcca
Q71BY5_E1B19K-02        gg---agcagcagcagcaacagcagcagc--aggaggaa-------gcca
E1ARN8_E1B19K-01        gg---agcagcagcagcaacagcagcagc--aggaggaa-------gcca
P03246_E1B19K-01        gg------------agcagcagcagcagc--aggaggaa-------gcca
Q6VGV8_E1B19K-01        gg------------agcagcagcagcagc--aggaggaa-------gcca
A0A0G2R248_E1B19K-      gg------------agcagcagcagcagc--aggaggaa-------gcca
A0A291P1B2_E1B19K-      gg------------------agcaacagc--aggaggaa-------gcca
T1UG63_E1B19K-01        gg---agcagcagcagcagcagcagcagc--aggaggaa-------gcca
A0A1U9ALK7_E1B19K-      gg------------------agcaacagc--aggaggaa-------gcca
P03247_E1B19K-01        gg------------------agcaacagc--aggaggaa-------gcca
J9Z5H0_E1B19K-01        gg------------------agcaacagc--aggaggaa-------gcca
J9Z4H6_E1B19K-01        agagcagcagcagcagcagcagcagcagc--aggaggaa-------gcca
A0A2H4PJ75_E1B19K-      gg---------agcagcagcagcagcagc--aggaggaa-------gcca
J7I6T8_E1B19K-01        gg------agcagcagcagcagcagcagc--aggaggaa-------gcca
A0A384ZUF2_E1B19K-      gg-----------------cagacacacc--aggatgcagccagtggccc
A0A384ZUM9_E1B19K-      gg-----------------cagacacacc--aggatgcaaccggtggccc
B9A5L5_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
T1UGY3_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
A0A1P7YYY5_E1B19K-      gg-----------------aagaaat-------aaggga------ggcca
A0A1P7YWY2_E1B19K-      gg-----------------aagaaat-------gaggga------gtcca
A0A1P7YWR9_E1B19K-      gg-----------------aagaaat-------gaggga------ggcca
A0A1P7YXN8_E1B19K-      gg-----------------aagaaat-------gaggga------ggcca
A0A1P8C849_E1B19K-      gg-----------------aagaaat-------gaggga------ggcca
B9A5A7_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
T1UG22_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
M0QVG6_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
X4YVU5_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
M0QUS9_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
M0QU02_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
A0A291B0H2_E1B19K-      gg-----------------aagaaat-------gaggga------ggcca
M0QV87_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
T1UKV6_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
W8VNG2_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
F8UFP5_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
T1UGT5_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
T1UGX3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
W8CZB0_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
G3CK71_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QTS5_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QV08_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
G9JUV5_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
G1FC01_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A0G2UY10_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
A0A1J0MS84_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
M0QUJ3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
H0PPE7_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
T1UKP8_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
T1UHQ8_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
Q4KSL0_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
T1UHG3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A384ZUF2_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
M0QUN2_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E1CIM6_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E1AI10_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
Q9YL99_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
K7ZLN6_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E1CIR1_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A1Y1BXT7_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
T1UHH6_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QVT4_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
T1ULJ8_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E9P585_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
D4N3H6_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
C4P207_E1B19K-01        gg-----------------aagaaat-------gagaca------ggcca
T1ULP4_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A384ZUM9_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
X4Y9D2_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
T1UHL7_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B9A5Q1_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QUB4_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QVK6_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A075TSZ1_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
F1DT57_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QUF3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E5RWD9_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
E5RWL1_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B6DU90_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B9A5T7_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B6C6W8_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B9A681_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A1Y1BYF1_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
T1UHZ2_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
B2VQE3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QU76_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QVC7_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QU41_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
C5HDR2_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
D3GBW3_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
A0A097I4T0_E1B19K-      gg-----------------aagaaat-------gaggca------ggcca
T1UK99_E1B19K-01        gg-----------------aagaaat-------gaggga------ggcca
G1FBW4_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
T1UKQ0_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
M0QVP5_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
H5T740_E1B19K-01        gg-----------------aagaaat-------gaggca------ggcca
M0QUW8_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
E1CIJ0_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
T1UGU0_E1B19K-01        gg-----------------aagagat-------gaggga------ggcca
M0QV47_E1B19K-01        gg-----------------aagagat-------gaggga------gacca

A0A097IW62_E1B19K-      acagggtttgcctgttagaggc---agagaa------------------c
A0A0M3TH18_E1B19K-      accaaacgcgcttgctggaggccgaggagga------------------g
A0A1W5PVU4_E1B19K-      atcaaacccgcttgctggaggccgaggagga------------------g
Q6QPF3_E1B19K-01        agcaa------gaggaggaccgagaagagaa------------------c
Q6QPB7_E1B19K-01        agcaagaggaggaggaggatcgagaagagaa------------------c
Q6QPI9_E1B19K-01        agcaa------gaggaggaccgagaagagaa------------------c
G9G841_E1B19K-01        -----------gaggaggatcaagaagagaa------------------c
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        -----------caggaggatcaagaagagaa------------------c
Q2KSM8_E1B19K-01        -----------caggaggatcaagaagagaa------------------c
A0A2L1F3A2_E1B19K-      -----------caggaggatcaagaagagaa------------------c
A0A2R3WN16_E1B19K-      -----------caggaggatcaagaagagaa------------------c
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        -----------gaggaggatcaagaagagaa------------------c
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        -----------caggaggatcaagaagagaa------------------t
Q6H1D7_E1B19K-01        -----------caggaggatcaagaagagaa------------------t
T1UJX4_E1B19K-01        -----------gaggaacagcaagaggacaa------------------t
Q7T951_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
T1UE63_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
Q7T8D8_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
Q5UW22_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
Q8B8U7_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
C7SRS7_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
Q32UI6_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
J7H4R9_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
D2DM83_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
J7I6W7_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
W6EIX6_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
A0A1L7NRH1_E1B19K-      -----------gaggaacagcaagaggacaa------------------c
Q3ZL02_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
T1UFS4_E1B19K-01        -----------gaggaacagcaagaggacaa------------------c
T2CI10_E1B19K-01        -----------gaggagcaccaagaggacaa------------------t
A0A0K0PX35_E1B19K-      -----------gaggagcagcaggaggacaa------------------t
A0A0K0PX99_E1B19K-      -----------gaggagcagcaggaggacaa------------------t
Q3ZKW2_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
Q2KRU2_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
K7NG43_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
Q2KS85_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
A0A0B4SJH1_E1B19K-      -----------gaggagcagcaggaggacaa------------------t
A0A075IQ70_E1B19K-      -----------gaggagcagcaggaggacaa------------------t
T1UIP3_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
R4HLE1_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
Q5EY83_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
Q2Y0J3_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
J7ID56_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
I6LEP5_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
R4HLJ6_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
R4HLA0_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
Q2KSL3_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
I6LES1_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
T1UF50_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
R4HMC6_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
I1V161_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
J7I6S4_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
A0A220VZ73_E1B19K-      -----------gaggagcagcaggaggacaa------------------t
P03248_E1B19K-02        -----------gaggagcagcaggaggacaa------------------t
Q6RK98_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
J7I6Q4_E1B19K-01        -----------gaggagcagcaggaggacaa------------------t
A0A1S6ELT2_E1B19K-      ------------------aggagagggagaa------------------c
F4ZCJ8_E1B19K-01        ------------------aggaggaggagaa------------------c
B5SNR1_E1B19K-01        ------------------aggaggaggagaa------------------c
P10544_E1B19K-01        ------------------aggaggaggagaa------------------c
W0S1G8_E1B19K-01        ------------------aggaggaggagaa------------------c
A0A142G3J2_E1B19K-      ------------------aggaggaggagaa------------------c
P10543_E1B19K-01        ------------------aggaggaggagaa------------------c
D3JIR7_E1B19K-01        ------------------aggaggagctgga-------------------
A0A076V686_E1B19K-      ------------------aggaggagccgga-------------------
P04492_E1B19K-01        ------------------aggagaaggagga-------------------
G1DE13_E1B19K-01        ------------------------aggagga-------------------
D0Z5R9_E1B19K-01        ------------------------aggagga-------------------
T1UEX7_E1B19K-01        ------------------------aggagga-------------------
A0A2H5AI99_E1B19K-      --------------ccggtggaaaccgacaa------------------t
A0A0A1EUE4_E1B19K-      --------------ccggacgagaccgagaa------------------c
A0MK43_E1B19K-01        --------------ccggaggagaccgagaa------------------t
A0A2H5AID8_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIL0_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIC5_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AI40_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AII9_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIN5_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIU0_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIS9_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A2H5AIT6_E1B19K-      --------------ccggaggagaccgagaa------------------t
Q5C8R2_E1B19K-01        --------------ccggaggagaccgagaa------------------t
A0A2H5AI21_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A0M5L3Y4_E1B19K-      --------------ccggaggagaccgagaa------------------t
A0A0A1EUC8_E1B19K-      --------------ccgggggagaccgagaa------------------c
A0A2H5AI04_E1B19K-      --------------ccgggggagaccgagaa------------------c
A0A2H5AI72_E1B19K-      --------------ccgggggagaccgagaa------------------c
A0A2H5AIL3_E1B19K-      --------------ccgggggagaccgagaa------------------c
A0A0A1EUB2_E1B19K-      --------------ccgggagagatggagaa------------------c
Q71BY5_E1B19K-01        -------------------------------------------------c
P06501_E1B19K-01        agcagcagcgg---caggaggaggagcaggtgcagg---a------ggag
A0A0M4N3Z1_E1B19K-      agcagcagcagcgtcaggaggagcagcaggtgcagg---aagagggggaa
Q8B6X5_E1B19K-01        agcagcagcagcgtcaggaggagcagcaggtgcagg---aagagggggaa
A0A0M4NHE0_E1B19K-      acccggaggcg---cagggggaggcgaaggaggaag------------cg
H9AAD9_E1B19K-01        acccggaggcg---cagggggaggcgaaggaggaaa------------cg
H9AAK5_E1B19K-01        acccggaggcg---cagggggaggcgaaggaggaaa------------cg
H9AAH3_E1B19K-01        acccggaggcg---cagggggaggcgaaggaggaaa------------cg
F2WTJ7_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
F2WTM9_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
A0A1C8EG46_E1B19K-      ----ggcgggg---cagggggaggagcaggagcaga------agccagcg
H9AAA8_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcaggagcagaagccagcg
H9AA76_E1B19K-01        ----ggcgggg---cagggggaggagcaggagccgg------agccagcg
H9AAN8_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
H9AAS0_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
H9AAV3_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
H9AAY5_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
M9YVA3_E1B19K-01        ----ggcgggg---cagggggaggagcaggagcagg------agccagcg
M9YVF6_E1B19K-01        ------------------ag------gagaa------------------c
A0A0M3TH31_E1B19K-      ------------------aggagaacgagaa------------------c
M9YXY5_E1B19K-01        ------------------aggagaacgagaa------------------c
G0ZAH2_E1B19K-01        gcatatggaggccttccatggaggcggagtggc---------------cg
A0A1L3INW0_E1B19K-      ------------------tagccgaggagga------------------c
A0A2H4CJZ0_E1B19K-      ------------------aggagg---agaa------------------c
H8PFZ1_E1B19K-01        ------------------aggagg---agaa------------------c
F6KST6_E1B19K-01        ------------------tggaagagcagaa------------------c
F2WTG5_E1B19K-01        ------------------tggaag---agaa------------------t
Q695T5_E1B19K-01        ------------------tggaagagaagaa------------------t
H9TER0_E1B19K-01        ------------------tggaagagaagaa------------------t
Q6WQ37_E1B19K-01        ------ggcggcggcggcaggagc---agag------------------c
J9Z4N4_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
Q71BY5_E1B19K-02        ---ggcggcggcggcggcaggagc---agag------------------c
E1ARN8_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
P03246_E1B19K-01        ------ggcggcggcggcaggagc---agag------------------c
Q6VGV8_E1B19K-01        ------ggcggcggcggcaggagc---agag------------------c
A0A0G2R248_E1B19K-      ------ggcggcggcggcaggagc---agag------------------c
A0A291P1B2_E1B19K-      ---ggcggcggcggcggcaggagc---agag------------------c
T1UG63_E1B19K-01        ggcggcggcggcggcggcaggagc---agag------------------c
A0A1U9ALK7_E1B19K-      ---ggcggcggcggcggcaggagc---agag------------------c
P03247_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
J9Z5H0_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
J9Z4H6_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
A0A2H4PJ75_E1B19K-      ---ggcggcggcggcggcaggagc---agag------------------c
J7I6T8_E1B19K-01        ---ggcggcggcggcggcaggagc---agag------------------c
A0A384ZUF2_E1B19K-      ------------------tggatg---tga--------------------
A0A384ZUM9_E1B19K-      ------------------tggatg---tga--------------------
B9A5L5_E1B19K-01        ------------------tggacg---agaa------------------c
T1UGY3_E1B19K-01        ------------------tggacg---agaa------------------c
A0A1P7YYY5_E1B19K-      ------------------tggaca---agaa------------------c
A0A1P7YWY2_E1B19K-      ------------------tggaca---agaa------------------c
A0A1P7YWR9_E1B19K-      ------------------tggaca---agaa------------------c
A0A1P7YXN8_E1B19K-      ------------------tggaca---agaa------------------c
A0A1P8C849_E1B19K-      ------------------tggaca---agaa------------------c
B9A5A7_E1B19K-01        ------------------tggaca---agaa------------------c
T1UG22_E1B19K-01        ------------------tggaca---agaa------------------c
M0QVG6_E1B19K-01        ------------------tggacg---agaa------------------c
X4YVU5_E1B19K-01        ------------------tggacg---agaa------------------c
M0QUS9_E1B19K-01        ------------------tggacg---agaa------------------c
M0QU02_E1B19K-01        ------------------tggacg---agaa------------------c
A0A291B0H2_E1B19K-      ------------------tggacg---agaa------------------c
M0QV87_E1B19K-01        ------------------tggacg---agaa------------------c
T1UKV6_E1B19K-01        ------------------tggacg---agaa------------------c
W8VNG2_E1B19K-01        ------------------tggacg---acaa------------------c
F8UFP5_E1B19K-01        ------------------tggacg---acaa------------------c
T1UGT5_E1B19K-01        ------------------tggacg---agaa------------------c
T1UGX3_E1B19K-01        ------------------tggacg---agaa------------------c
W8CZB0_E1B19K-01        ------------------tggacg---agaa------------------c
G3CK71_E1B19K-01        ------------------tgtacg---agaa------------------c
M0QTS5_E1B19K-01        ------------------tggacg---agaa------------------c
M0QV08_E1B19K-01        ------------------tggacg---agaa------------------c
G9JUV5_E1B19K-01        ------------------tggacg---agaa------------------c
G1FC01_E1B19K-01        ------------------tggacg---agaa------------------c
A0A0G2UY10_E1B19K-      ------------------tggacg---agaa------------------c
A0A1J0MS84_E1B19K-      ------------------tggacg---agaa------------------c
M0QUJ3_E1B19K-01        ------------------tggacg---agaa------------------c
H0PPE7_E1B19K-01        ------------------tggacg---agaa------------------c
T1UKP8_E1B19K-01        ------------------tggacg---agaa------------------c
T1UHQ8_E1B19K-01        ------------------tggacg---agaa------------------c
Q4KSL0_E1B19K-01        ------------------tggacg---agaa------------------c
T1UHG3_E1B19K-01        ------------------tggacg---agaa------------------c
A0A384ZUF2_E1B19K-      ------------------tggacg---agaa------------------c
M0QUN2_E1B19K-01        ------------------tggacg---agaa------------------c
E1CIM6_E1B19K-01        ------------------tggacg---agaa------------------c
E1AI10_E1B19K-01        ------------------tggacg---agaa------------------c
Q9YL99_E1B19K-01        ------------------tggacg---agaa------------------c
K7ZLN6_E1B19K-01        ------------------tggacg---agaa------------------c
E1CIR1_E1B19K-01        ------------------tggacg---agaa------------------c
A0A1Y1BXT7_E1B19K-      ------------------tggacg---agaa------------------c
T1UHH6_E1B19K-01        ------------------tggacg---agaa------------------c
M0QVT4_E1B19K-01        ------------------tggacg---agaa------------------c
T1ULJ8_E1B19K-01        ------------------tggacg---agaa------------------c
E9P585_E1B19K-01        ------------------tggacg---agaa------------------c
D4N3H6_E1B19K-01        ------------------tggacg---agaa------------------c
C4P207_E1B19K-01        ------------------tggacg---agaa------------------c
T1ULP4_E1B19K-01        ------------------tggacg---agaa------------------c
A0A384ZUM9_E1B19K-      ------------------tggacg---agaa------------------c
X4Y9D2_E1B19K-01        ------------------tggacg---agaa------------------c
T1UHL7_E1B19K-01        ------------------tggacg---agaa------------------c
B9A5Q1_E1B19K-01        ------------------tggacg---agaa------------------c
M0QUB4_E1B19K-01        ------------------tggacg---agaa------------------c
M0QVK6_E1B19K-01        ------------------tggacg---agaa------------------c
A0A075TSZ1_E1B19K-      ------------------tggacg---agaa------------------c
F1DT57_E1B19K-01        ------------------tggacg---agaa------------------c
M0QUF3_E1B19K-01        ------------------tggacg---agaa------------------c
E5RWD9_E1B19K-01        ------------------tggacg---agaa------------------c
E5RWL1_E1B19K-01        ------------------tggacg---agaa------------------c
B6DU90_E1B19K-01        ------------------tggacg---agaa------------------c
B9A5T7_E1B19K-01        ------------------tggacg---agaa------------------c
B6C6W8_E1B19K-01        ------------------tggacg---agaa------------------c
B9A681_E1B19K-01        ------------------tggacg---agaa------------------c
A0A1Y1BYF1_E1B19K-      ------------------tggacg---agaa------------------c
T1UHZ2_E1B19K-01        ------------------tggacg---agaa------------------c
B2VQE3_E1B19K-01        ------------------tggacg---agaa------------------c
M0QU76_E1B19K-01        ------------------tggacg---agaa------------------c
M0QVC7_E1B19K-01        ------------------tggacg---agaa------------------c
M0QU41_E1B19K-01        ------------------tggacg---agaa------------------c
C5HDR2_E1B19K-01        ------------------tggacg---agaa------------------c
D3GBW3_E1B19K-01        ------------------tggacg---agaa------------------c
A0A097I4T0_E1B19K-      ------------------tggacg---agaa------------------c
T1UK99_E1B19K-01        ------------------tggacg---agaa------------------c
G1FBW4_E1B19K-01        ------------------tggacg---agaa------------------c
T1UKQ0_E1B19K-01        ------------------tggacg---agaa------------------c
M0QVP5_E1B19K-01        ------------------tggacg---agaa------------------c
H5T740_E1B19K-01        ------------------tggacg---agaa------------------c
M0QUW8_E1B19K-01        ------------------tggacg---agaa------------------c
E1CIJ0_E1B19K-01        ------------------tggacg---agaa------------------c
T1UGU0_E1B19K-01        ------------------tggacg---agaa------------------c
M0QV47_E1B19K-01        ------------------tggacg---agaa------------------c

A0A097IW62_E1B19K-      cccagggcg----------------------ggcatg-gatc--------
A0A0M3TH18_E1B19K-      cccagggcg----------------------gggacg-gatc--------
A0A1W5PVU4_E1B19K-      ccccgggcg----------------------ggaatg-gatc--------
Q6QPF3_E1B19K-01        ccgagagcc----------------------ggtctg-gacc--------
Q6QPB7_E1B19K-01        ccgagagcc----------------------ggtctg-gacc--------
Q6QPI9_E1B19K-01        ctgagagcc----------------------ggtctg-gacc--------
G9G841_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2KSM8_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
A0A2L1F3A2_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
A0A2R3WN16_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q6H1D7_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
T1UJX4_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q7T951_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
T1UE63_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q7T8D8_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q5UW22_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q8B8U7_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
C7SRS7_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q32UI6_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
J7H4R9_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
D2DM83_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
J7I6W7_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
W6EIX6_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
A0A1L7NRH1_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
Q3ZL02_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
T1UFS4_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
T2CI10_E1B19K-01        ccgagagtc----------------------ggcctg-gacc--------
A0A0K0PX35_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
A0A0K0PX99_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
Q3ZKW2_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2KRU2_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
K7NG43_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2KS85_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
A0A0B4SJH1_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
A0A075IQ70_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
T1UIP3_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
R4HLE1_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q5EY83_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2Y0J3_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
J7ID56_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
I6LEP5_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
R4HLJ6_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
R4HLA0_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
Q2KSL3_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
I6LES1_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
T1UF50_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
R4HMC6_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
I1V161_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
J7I6S4_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
A0A220VZ73_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
P03248_E1B19K-02        ccgagagcc----------------------ggcctg-gacc--------
Q6RK98_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
J7I6Q4_E1B19K-01        ccgagagcc----------------------ggcctg-gacc--------
A0A1S6ELT2_E1B19K-      ctgagggcc----------------------ggtctg-gatc--------
F4ZCJ8_E1B19K-01        ctgagggcc----------------------ggtctg-gatc--------
B5SNR1_E1B19K-01        ctgagggcc----------------------ggtctg-gatc--------
P10544_E1B19K-01        ctgagggcc----------------------ggtctg-gatc--------
W0S1G8_E1B19K-01        ctgagggcc----------------------ggtctg-gatc--------
A0A142G3J2_E1B19K-      ctgagggcc----------------------ggcctg-gacc--------
P10543_E1B19K-01        ctgagggcc----------------------ggcctg-gacc--------
D3JIR7_E1B19K-01        -------------------------------gcagcgggacc--------
A0A076V686_E1B19K-      -------------------------------ggagcgggacc--------
P04492_E1B19K-01        -------------------------------ggagcggaacc--------
G1DE13_E1B19K-01        -------------------------------gcagcagaaca--------
D0Z5R9_E1B19K-01        -------------------------------gcagcagaaca--------
T1UEX7_E1B19K-01        -------------------------------gcagcagaaca--------
A0A2H5AI99_E1B19K-      ccgagagcc----------------------ggcctg-gacc--------
A0A0A1EUE4_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0MK43_E1B19K-01        ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AID8_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIL0_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIC5_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AI40_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AII9_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIN5_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIU0_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIS9_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AIT6_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
Q5C8R2_E1B19K-01        ctgagagcc----------------------ggcctg-gacc--------
A0A2H5AI21_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A0M5L3Y4_E1B19K-      ctgagagcc----------------------ggcctg-gacc--------
A0A0A1EUC8_E1B19K-      ctgagggcc----------------------gggctg-gacc--------
A0A2H5AI04_E1B19K-      ctgagggcc----------------------gggctg-gacc--------
A0A2H5AI72_E1B19K-      ctgagggcc----------------------gggctg-gacc--------
A0A2H5AIL3_E1B19K-      ctgagggcc----------------------gggctg-gacc--------
A0A0A1EUB2_E1B19K-      ctgagggcc----------------------gggctg-gacc--------
Q71BY5_E1B19K-01        ctaaaatgg----------------------tgcctgctatc--------
P06501_E1B19K-01        atgaggtcc----------------------ggcctg-gacc--------
A0A0M4N3Z1_E1B19K-      atgaggtcc----------------------ggcctg-gacc--------
Q8B6X5_E1B19K-01        atgaggtcc----------------------ggcctg-gacc--------
A0A0M4NHE0_E1B19K-      ctgcggtcc----------------------ggcctg-gacc--------
H9AAD9_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAK5_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAH3_E1B19K-01        ctgcggtcc----------------------ggcctg-aacc--------
F2WTJ7_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
F2WTM9_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
A0A1C8EG46_E1B19K-      ctgcggtcc----------------------ggcctg-ggcc--------
H9AAA8_E1B19K-01        ctgcggtcc----------------------ggcttg-gacc--------
H9AA76_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAN8_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAS0_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAV3_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
H9AAY5_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
M9YVA3_E1B19K-01        ctgcggtcc----------------------ggcctg-gacc--------
M9YVF6_E1B19K-01        ccgagggca----------------------ggcgtg-gacc--------
A0A0M3TH31_E1B19K-      ccgagggcc----------------------ggcgtg-gacc--------
M9YXY5_E1B19K-01        ccgagggcc----------------------ggcgtg-gacc--------
G0ZAH2_E1B19K-01        ccgcgggcg----------------------gggatg-gacc--------
A0A1L3INW0_E1B19K-      cctcgagcg----------------------gggctg-gacc--------
A0A2H4CJZ0_E1B19K-      ccgagggcc----------------------ggcctg-gacc--------
H8PFZ1_E1B19K-01        ccgagggcc----------------------ggcctg-gacc--------
F6KST6_E1B19K-01        cccagagcg----------------------gggctg-gacc--------
F2WTG5_E1B19K-01        ccgagagcg----------------------gggctg-gacc--------
Q695T5_E1B19K-01        ccgagagcg----------------------gggctg-gacc--------
H9TER0_E1B19K-01        ccgagagcg----------------------gggctg-gacc--------
Q6WQ37_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
J9Z4N4_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
Q71BY5_E1B19K-02        ccatggaac-------------ccgagagccggcctg-gacc--------
E1ARN8_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
P03246_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
Q6VGV8_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
A0A0G2R248_E1B19K-      ccatggaac-------------ccgagagccggcctg-gacc--------
A0A291P1B2_E1B19K-      ccatggaac-------------ccgagagccggcctg-gacc--------
T1UG63_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
A0A1U9ALK7_E1B19K-      ccatggaac-------------ccgagagccggcctg-gacc--------
P03247_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
J9Z5H0_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
J9Z4H6_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
A0A2H4PJ75_E1B19K-      ccatggaac-------------ccgagagccggcctg-gacc--------
J7I6T8_E1B19K-01        ccatggaac-------------ccgagagccggcctg-gacc--------
A0A384ZUF2_E1B19K-      ccgaggagctgagaccagaccacctggtgatggcctg-taccgggaccga
A0A384ZUM9_E1B19K-      ccgaggagctgcggcccgaccacctggtgatggcctg-taccgggaccga
B9A5L5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UGY3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A1P7YYY5_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
A0A1P7YWY2_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
A0A1P7YWR9_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
A0A1P7YXN8_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
A0A1P8C849_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
B9A5A7_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UG22_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QVG6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
X4YVU5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QUS9_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QU02_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A291B0H2_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
M0QV87_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UKV6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
W8VNG2_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
F8UFP5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UGT5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UGX3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
W8CZB0_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
G3CK71_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QTS5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QV08_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
G9JUV5_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
G1FC01_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A0G2UY10_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
A0A1J0MS84_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
M0QUJ3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
H0PPE7_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UKP8_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UHQ8_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
Q4KSL0_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UHG3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A384ZUF2_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
M0QUN2_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E1CIM6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E1AI10_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
Q9YL99_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
K7ZLN6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E1CIR1_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A1Y1BXT7_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
T1UHH6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QVT4_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1ULJ8_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E9P585_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
D4N3H6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
C4P207_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1ULP4_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A384ZUM9_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
X4Y9D2_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UHL7_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B9A5Q1_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QUB4_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QVK6_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A075TSZ1_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
F1DT57_E1B19K-01        ccgaggagc----------------------ggtctg-gacc--------
M0QUF3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E5RWD9_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E5RWL1_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B6DU90_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B9A5T7_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B6C6W8_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B9A681_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A1Y1BYF1_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
T1UHZ2_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
B2VQE3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QU76_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QVC7_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QU41_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
C5HDR2_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
D3GBW3_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
A0A097I4T0_E1B19K-      ccgaggagc----------------------ggcctg-gacc--------
T1UK99_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
G1FBW4_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UKQ0_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QVP5_E1B19K-01        ccgaggagc----------------------ggtctg-gacc--------
H5T740_E1B19K-01        ccgaggagc----------------------ggtctg-gacc--------
M0QUW8_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
E1CIJ0_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
T1UGU0_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------
M0QV47_E1B19K-01        ccgaggagc----------------------ggcctg-gacc--------

A0A097IW62_E1B19K-      ------cccc---gagcgagaa----------------------------
A0A0M3TH18_E1B19K-      ------cccc---gagcgagac----------------------------
A0A1W5PVU4_E1B19K-      ------cccc---gagcgagac----------------------------
Q6QPF3_E1B19K-01        ------ctcc---ggtggcggaggaggagga-------------------
Q6QPB7_E1B19K-01        ------ctcc---ggtggcggaggaggagga-------------------
Q6QPI9_E1B19K-01        ------ctcc---ggtggcggaggaggagga-------------------
G9G841_E1B19K-01        ------ctcc------ggcggaggaggagta-------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        ------ctcc------ggc---ggaggagga-------------------
Q2KSM8_E1B19K-01        ------ctcc------ggcggaggaggagga-------------------
A0A2L1F3A2_E1B19K-      ------ctcc------ggc---ggaggagga-------------------
A0A2R3WN16_E1B19K-      ------ctcc------ggcggaggaggagga-------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q8UY91_E1B19K-01        ------ctcc------ggcggaggaggagga-------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q5GFC8_E1B19K-01        ------ctcc------ggcggaggagtag---------------------
Q6H1D7_E1B19K-01        ------ctcc------ggcggaggagtag---------------------
T1UJX4_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
Q7T951_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
T1UE63_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
Q7T8D8_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
Q5UW22_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
Q8B8U7_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
C7SRS7_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
Q32UI6_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
J7H4R9_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
D2DM83_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
J7I6W7_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
W6EIX6_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
A0A1L7NRH1_E1B19K-      ------ctcc---agtggagga---ggcgga-------------------
Q3ZL02_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
T1UFS4_E1B19K-01        ------ctcc---agtggagga---ggcgga-------------------
T2CI10_E1B19K-01        ------ctcc---ggtggaggaggcggagga-------------------
A0A0K0PX35_E1B19K-      ------ctcc---ggtggaggaggcggagga-------------------
A0A0K0PX99_E1B19K-      ------ctcc---ggtggaggaggcggagga-------------------
Q3ZKW2_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
Q2KRU2_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
K7NG43_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
Q2KS85_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
A0A0B4SJH1_E1B19K-      ------ctcc---ggt---------ggagga-------------------
A0A075IQ70_E1B19K-      ------ctcc---ggt---------ggagga-------------------
T1UIP3_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
R4HLE1_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
Q5EY83_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
Q2Y0J3_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
J7ID56_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
I6LEP5_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
R4HLJ6_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
R4HLA0_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
Q2KSL3_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
I6LES1_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
T1UF50_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
R4HMC6_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
I1V161_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
J7I6S4_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
A0A220VZ73_E1B19K-      ------ctcc---ggt---------ggagga-------------------
P03248_E1B19K-02        ------ctcc---ggt---------ggagga-------------------
Q6RK98_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
J7I6Q4_E1B19K-01        ------ctcc---ggt---------ggagga-------------------
A0A1S6ELT2_E1B19K-      ------ctca---aacggaatt----------------------------
F4ZCJ8_E1B19K-01        ------ctca---aacggaatt----------------------------
B5SNR1_E1B19K-01        ------ctca---aacggaatt----------------------------
P10544_E1B19K-01        ------ctca---aacggaatt----------------------------
W0S1G8_E1B19K-01        ------ctca---aacggaatt----------------------------
A0A142G3J2_E1B19K-      ------cttc---aacggaatt----------------------------
P10543_E1B19K-01        ------cttc---aacggaatt----------------------------
D3JIR7_E1B19K-01        ------ctgc---ggcggagaa----------------------------
A0A076V686_E1B19K-      ------ctgc---ggtggagaa----------------------------
P04492_E1B19K-01        ------ctgcggtggtggagaa----------------------------
G1DE13_E1B19K-01        ------ctac---gacggagga----------------------------
D0Z5R9_E1B19K-01        ------ctac---gacggagga----------------------------
T1UEX7_E1B19K-01        ------ctac---gacggagga----------------------------
A0A2H5AI99_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A0A1EUE4_E1B19K-      ------ctcc---aatggaaga----------------------------
A0MK43_E1B19K-01        ------ctcc---agtggaaga----------------------------
A0A2H5AID8_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIL0_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIC5_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AI40_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AII9_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIN5_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIU0_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIS9_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A2H5AIT6_E1B19K-      ------ctcc---agtggaaga----------------------------
Q5C8R2_E1B19K-01        ------ctcc---agtggaaga----------------------------
A0A2H5AI21_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A0M5L3Y4_E1B19K-      ------ctcc---agtggaaga----------------------------
A0A0A1EUC8_E1B19K-      ------ctcc---aacggagga----------------------------
A0A2H5AI04_E1B19K-      ------ctcc---aacggagga----------------------------
A0A2H5AI72_E1B19K-      ------ctcc---aacggagga----------------------------
A0A2H5AIL3_E1B19K-      ------ctcc---aacggagga----------------------------
A0A0A1EUB2_E1B19K-      ------ctcc---aacggagga----------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
P06501_E1B19K-01        ------ctcc---aacggaga------a----------------------
A0A0M4N3Z1_E1B19K-      ------ctcc---aacggaga------a----------------------
Q8B6X5_E1B19K-01        ------ctcc---aacggaga------a----------------------
A0A0M4NHE0_E1B19K-      ------ctcc---ggtggagg---agga----------------------
H9AAD9_E1B19K-01        ------ctcc---ggtggagg---agaa----------------------
H9AAK5_E1B19K-01        ------ctcc---ggtggagg---agaa----------------------
H9AAH3_E1B19K-01        ------ctcc---ggtggagg---agaa----------------------
F2WTJ7_E1B19K-01        ------ctcc---ggaggagaaggagga----------------------
F2WTM9_E1B19K-01        ------ctcc---ggaggagaaggagga----------------------
A0A1C8EG46_E1B19K-      ------ctcc---ggaggaga------a----------------------
H9AAA8_E1B19K-01        ------ctcc---ggaggaga------a----------------------
H9AA76_E1B19K-01        ------ctcc---ggaggaga------a----------------------
H9AAN8_E1B19K-01        ------ctcc---ggaggaga------a----------------------
H9AAS0_E1B19K-01        ------ctcc---ggaggaga------a----------------------
H9AAV3_E1B19K-01        ------ctcc---ggaggaga------a----------------------
H9AAY5_E1B19K-01        ------ctcc---ggaggaga------a----------------------
M9YVA3_E1B19K-01        ------ctcc---ggaggaga------a----------------------
M9YVF6_E1B19K-01        ------ctcc---tctggaatag---------------------------
A0A0M3TH31_E1B19K-      ------ctcc---tctggaatag---------------------------
M9YXY5_E1B19K-01        ------ctcc---tctggaatag---------------------------
G0ZAH2_E1B19K-01        ------cccc---gctggaggagcagtgggaggcggaccacgacccggag
A0A1L3INW0_E1B19K-      ------ctc------cggaggaggaggtgga-------------------
A0A2H4CJZ0_E1B19K-      ------cttc---ggcggaatag---------------------------
H8PFZ1_E1B19K-01        ------ctcc---ggcggaatag---------------------------
F6KST6_E1B19K-01        ------ctcc---agtggaggcgtag------------------------
F2WTG5_E1B19K-01        ------ctcc---agcggaggagtag------------------------
Q695T5_E1B19K-01        ------ctcc---ggcggaggagtag------------------------
H9TER0_E1B19K-01        ------ctcc---ggcggaggagtag------------------------
Q6WQ37_E1B19K-01        ------ctc------------------ggga-------------------
J9Z4N4_E1B19K-01        ------ctc------------------ggga-------------------
Q71BY5_E1B19K-02        ------ctc------------------ggga-------------------
E1ARN8_E1B19K-01        ------ctc------------------ggga-------------------
P03246_E1B19K-01        ------ctc------------------ggga-------------------
Q6VGV8_E1B19K-01        ------ctc------------------ggga-------------------
A0A0G2R248_E1B19K-      ------ctc------------------ggga-------------------
A0A291P1B2_E1B19K-      ------ctc------------------ggga-------------------
T1UG63_E1B19K-01        ------ctc------------------ggga-------------------
A0A1U9ALK7_E1B19K-      ------ctc------------------ggga-------------------
P03247_E1B19K-01        ------ctc------------------ggga-------------------
J9Z5H0_E1B19K-01        ------ctc------------------ggga-------------------
J9Z4H6_E1B19K-01        ------ctc------------------ggga-------------------
A0A2H4PJ75_E1B19K-      ------ctc------------------ggga-------------------
J7I6T8_E1B19K-01        ------ctc------------------ggga-------------------
A0A384ZUF2_E1B19K-      gttcagctcc---agtgg-ggaggacacaga-------------------
A0A384ZUM9_E1B19K-      gttcagctcc---agtgg-ggaggacacaga-------------------
B9A5L5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UGY3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A1P7YYY5_E1B19K-      ------ctcc---gttggaagaggagctgga-------------------
A0A1P7YWY2_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
A0A1P7YWR9_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
A0A1P7YXN8_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
A0A1P8C849_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
B9A5A7_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UG22_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QVG6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
X4YVU5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QUS9_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QU02_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A291B0H2_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
M0QV87_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UKV6_E1B19K-01        ------ctcc---gtcggaagaggagttgga-------------------
W8VNG2_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
F8UFP5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UGT5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UGX3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
W8CZB0_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
G3CK71_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QTS5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QV08_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
G9JUV5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
G1FC01_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A0G2UY10_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
A0A1J0MS84_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
M0QUJ3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
H0PPE7_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UKP8_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UHQ8_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
Q4KSL0_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UHG3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A384ZUF2_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
M0QUN2_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E1CIM6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E1AI10_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
Q9YL99_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
K7ZLN6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E1CIR1_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A1Y1BXT7_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
T1UHH6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QVT4_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1ULJ8_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E9P585_E1B19K-01        ------ctcc---gttggaagaggagctgga-------------------
D4N3H6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
C4P207_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1ULP4_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A384ZUM9_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
X4Y9D2_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UHL7_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
B9A5Q1_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QUB4_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QVK6_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A075TSZ1_E1B19K-      ------ctcc---gtcggaagaggagctgga-------------------
F1DT57_E1B19K-01        ------ctcc---gtcggaagaggagttgga-------------------
M0QUF3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E5RWD9_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E5RWL1_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
B6DU90_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
B9A5T7_E1B19K-01        ------ctcc---gtcggaagaggagctgaa-------------------
B6C6W8_E1B19K-01        ------ctcc---gtcggaagaggagctgaa-------------------
B9A681_E1B19K-01        ------ctcc---gtcggaagaggagctgaa-------------------
A0A1Y1BYF1_E1B19K-      ------ctcc---gtcggaagaggagctgaa-------------------
T1UHZ2_E1B19K-01        ------ctcc---gtcggaagaggagctgaa-------------------
B2VQE3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QU76_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QVC7_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QU41_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
C5HDR2_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
D3GBW3_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
A0A097I4T0_E1B19K-      ------ctcc---gccggaagaggagctgga-------------------
T1UK99_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
G1FBW4_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UKQ0_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QVP5_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
H5T740_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QUW8_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
E1CIJ0_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
T1UGU0_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------
M0QV47_E1B19K-01        ------ctcc---gtcggaagaggagctgga-------------------

A0A097IW62_E1B19K-      --ttaa
A0A0M3TH18_E1B19K-      --ttga
A0A1W5PVU4_E1B19K-      --ttga
Q6QPF3_E1B19K-01        --gtag
Q6QPB7_E1B19K-01        --gtag
Q6QPI9_E1B19K-01        --gtag
G9G841_E1B19K-01        --g---
Q2KSM8_E1B19K-02        ------
Q2KSG6_E1B19K-01        --gtag
Q2KSM8_E1B19K-01        --gtag
A0A2L1F3A2_E1B19K-      --gtag
A0A2R3WN16_E1B19K-      --gtag
Q2KSG6_E1B19K-02        ------
A0A2L1F392_E1B19K-      ------
Q8UY91_E1B19K-01        --gtag
P10406_E1B19K-01        ------
Q5GFC7_E1B19K-01        ------
A0A2R3WN62_E1B19K-      ------
Q5GFC8_E1B19K-01        ------
Q6H1D7_E1B19K-01        ------
T1UJX4_E1B19K-01        --gtag
Q7T951_E1B19K-01        --gtag
T1UE63_E1B19K-01        --gtag
Q7T8D8_E1B19K-01        --gtag
Q5UW22_E1B19K-01        --gtag
Q8B8U7_E1B19K-01        --gtag
C7SRS7_E1B19K-01        --gtag
Q32UI6_E1B19K-01        --gtag
J7H4R9_E1B19K-01        --gtag
D2DM83_E1B19K-01        --gtag
J7I6W7_E1B19K-01        --gtag
W6EIX6_E1B19K-01        --gtag
A0A1L7NRH1_E1B19K-      --gtag
Q3ZL02_E1B19K-01        --gtag
T1UFS4_E1B19K-01        --gtag
T2CI10_E1B19K-01        --gtag
A0A0K0PX35_E1B19K-      --gtag
A0A0K0PX99_E1B19K-      --gtag
Q3ZKW2_E1B19K-01        --gtag
Q2KRU2_E1B19K-01        --gtag
K7NG43_E1B19K-01        --gtag
Q2KS85_E1B19K-01        --gtag
A0A0B4SJH1_E1B19K-      --gtag
A0A075IQ70_E1B19K-      --gtag
T1UIP3_E1B19K-01        --gtag
R4HLE1_E1B19K-01        --gtag
Q5EY83_E1B19K-01        --gtag
Q2Y0J3_E1B19K-01        --gtag
J7ID56_E1B19K-01        --gtag
I6LEP5_E1B19K-01        --gtag
R4HLJ6_E1B19K-01        --gtag
R4HLA0_E1B19K-01        --gtag
Q2KSL3_E1B19K-01        --gtag
I6LES1_E1B19K-01        --gtag
T1UF50_E1B19K-01        --gtag
R4HMC6_E1B19K-01        --gtag
I1V161_E1B19K-01        --gtag
J7I6S4_E1B19K-01        --gtag
A0A220VZ73_E1B19K-      --gtag
P03248_E1B19K-02        --gtag
Q6RK98_E1B19K-01        --gtag
J7I6Q4_E1B19K-01        --gtag
A0A1S6ELT2_E1B19K-      --gtaa
F4ZCJ8_E1B19K-01        --gtaa
B5SNR1_E1B19K-01        --gtaa
P10544_E1B19K-01        --gtaa
W0S1G8_E1B19K-01        --gtaa
A0A142G3J2_E1B19K-      --gtaa
P10543_E1B19K-01        --gtaa
D3JIR7_E1B19K-01        --gtga
A0A076V686_E1B19K-      --gtga
P04492_E1B19K-01        --gtaa
G1DE13_E1B19K-01        --gtaa
D0Z5R9_E1B19K-01        --gtaa
T1UEX7_E1B19K-01        --gtaa
A0A2H5AI99_E1B19K-      --ctag
A0A0A1EUE4_E1B19K-      --ctag
A0MK43_E1B19K-01        --ctag
A0A2H5AID8_E1B19K-      --ctag
A0A2H5AIL0_E1B19K-      --ctag
A0A2H5AIC5_E1B19K-      --ctag
A0A2H5AI40_E1B19K-      --ctag
A0A2H5AII9_E1B19K-      --ctag
A0A2H5AIN5_E1B19K-      --ctag
A0A2H5AIU0_E1B19K-      --ctag
A0A2H5AIS9_E1B19K-      --ctag
A0A2H5AIT6_E1B19K-      --ctag
Q5C8R2_E1B19K-01        --ctag
A0A2H5AI21_E1B19K-      --ctag
A0A0M5L3Y4_E1B19K-      --ctag
A0A0A1EUC8_E1B19K-      --ctag
A0A2H5AI04_E1B19K-      --ctag
A0A2H5AI72_E1B19K-      --ctag
A0A2H5AIL3_E1B19K-      --ctag
A0A0A1EUB2_E1B19K-      --ctag
Q71BY5_E1B19K-01        --ctga
P06501_E1B19K-01        --ctga
A0A0M4N3Z1_E1B19K-      --ctga
Q8B6X5_E1B19K-01        --ctga
A0A0M4NHE0_E1B19K-      --ctag
H9AAD9_E1B19K-01        --ctag
H9AAK5_E1B19K-01        --ctag
H9AAH3_E1B19K-01        --ctag
F2WTJ7_E1B19K-01        --ttaa
F2WTM9_E1B19K-01        --ttaa
A0A1C8EG46_E1B19K-      --ttaa
H9AAA8_E1B19K-01        --ttaa
H9AA76_E1B19K-01        --ttaa
H9AAN8_E1B19K-01        --ttaa
H9AAS0_E1B19K-01        --ttaa
H9AAV3_E1B19K-01        --ttaa
H9AAY5_E1B19K-01        --ttaa
M9YVA3_E1B19K-01        --ttaa
M9YVF6_E1B19K-01        ------
A0A0M3TH31_E1B19K-      ------
M9YXY5_E1B19K-01        ------
G0ZAH2_E1B19K-01        gcataa
A0A1L3INW0_E1B19K-      --ctag
A0A2H4CJZ0_E1B19K-      ------
H8PFZ1_E1B19K-01        ------
F6KST6_E1B19K-01        ------
F2WTG5_E1B19K-01        ------
Q695T5_E1B19K-01        ------
H9TER0_E1B19K-01        ------
Q6WQ37_E1B19K-01        --atga
J9Z4N4_E1B19K-01        --atga
Q71BY5_E1B19K-02        --atga
E1ARN8_E1B19K-01        --atga
P03246_E1B19K-01        --atga
Q6VGV8_E1B19K-01        --atga
A0A0G2R248_E1B19K-      --atga
A0A291P1B2_E1B19K-      --atga
T1UG63_E1B19K-01        --atga
A0A1U9ALK7_E1B19K-      --atga
P03247_E1B19K-01        --atga
J9Z5H0_E1B19K-01        --atga
J9Z4H6_E1B19K-01        --atga
A0A2H4PJ75_E1B19K-      --atga
J7I6T8_E1B19K-01        --atga
A0A384ZUF2_E1B19K-      --ttag
A0A384ZUM9_E1B19K-      --ttag
B9A5L5_E1B19K-01        --ttaa
T1UGY3_E1B19K-01        --ttaa
A0A1P7YYY5_E1B19K-      --ttaa
A0A1P7YWY2_E1B19K-      --ttaa
A0A1P7YWR9_E1B19K-      --ttaa
A0A1P7YXN8_E1B19K-      --ttaa
A0A1P8C849_E1B19K-      --ttaa
B9A5A7_E1B19K-01        --ttaa
T1UG22_E1B19K-01        --ttaa
M0QVG6_E1B19K-01        --ttga
X4YVU5_E1B19K-01        --ttga
M0QUS9_E1B19K-01        --ttga
M0QU02_E1B19K-01        --ttga
A0A291B0H2_E1B19K-      --ttga
M0QV87_E1B19K-01        --ttga
T1UKV6_E1B19K-01        --ttga
W8VNG2_E1B19K-01        --ttga
F8UFP5_E1B19K-01        --ttga
T1UGT5_E1B19K-01        --ttga
T1UGX3_E1B19K-01        --ttga
W8CZB0_E1B19K-01        --ttga
G3CK71_E1B19K-01        --ttga
M0QTS5_E1B19K-01        --ttga
M0QV08_E1B19K-01        --ttga
G9JUV5_E1B19K-01        --ttga
G1FC01_E1B19K-01        --ttga
A0A0G2UY10_E1B19K-      --ttga
A0A1J0MS84_E1B19K-      --ttga
M0QUJ3_E1B19K-01        --ttga
H0PPE7_E1B19K-01        --ttga
T1UKP8_E1B19K-01        --ttga
T1UHQ8_E1B19K-01        --ttga
Q4KSL0_E1B19K-01        --ttga
T1UHG3_E1B19K-01        --ttga
A0A384ZUF2_E1B19K-      --ttga
M0QUN2_E1B19K-01        --ttga
E1CIM6_E1B19K-01        --ttga
E1AI10_E1B19K-01        --ttga
Q9YL99_E1B19K-01        --ttga
K7ZLN6_E1B19K-01        --ttga
E1CIR1_E1B19K-01        --ttga
A0A1Y1BXT7_E1B19K-      --ttga
T1UHH6_E1B19K-01        --ttga
M0QVT4_E1B19K-01        --ttga
T1ULJ8_E1B19K-01        --ttga
E9P585_E1B19K-01        --ttga
D4N3H6_E1B19K-01        --ttga
C4P207_E1B19K-01        --ttga
T1ULP4_E1B19K-01        --ttga
A0A384ZUM9_E1B19K-      --ttga
X4Y9D2_E1B19K-01        --ttga
T1UHL7_E1B19K-01        --ttga
B9A5Q1_E1B19K-01        --ttga
M0QUB4_E1B19K-01        --ttga
M0QVK6_E1B19K-01        --ttga
A0A075TSZ1_E1B19K-      --ttga
F1DT57_E1B19K-01        --ttga
M0QUF3_E1B19K-01        --ttga
E5RWD9_E1B19K-01        --ttga
E5RWL1_E1B19K-01        --ttga
B6DU90_E1B19K-01        --ttga
B9A5T7_E1B19K-01        --ttga
B6C6W8_E1B19K-01        --ttga
B9A681_E1B19K-01        --ttga
A0A1Y1BYF1_E1B19K-      --ttga
T1UHZ2_E1B19K-01        --ttga
B2VQE3_E1B19K-01        --ttga
M0QU76_E1B19K-01        --ttga
M0QVC7_E1B19K-01        --ttga
M0QU41_E1B19K-01        --ttga
C5HDR2_E1B19K-01        --ttga
D3GBW3_E1B19K-01        --ttga
A0A097I4T0_E1B19K-      --ttga
T1UK99_E1B19K-01        --ttga
G1FBW4_E1B19K-01        --ttga
T1UKQ0_E1B19K-01        --ttga
M0QVP5_E1B19K-01        --ttga
H5T740_E1B19K-01        --ttga
M0QUW8_E1B19K-01        --ttga
E1CIJ0_E1B19K-01        --ttga
T1UGU0_E1B19K-01        --ttga
M0QV47_E1B19K-01        --ttga

© 1998-2019