Dataset for CDS adenoviridae of organism Simian adenovirus 13

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0M3TH18_E1B19K-      ---atgaagaggcctgtggctgcagaagtccaaatggagcttgacaggct
A0A1W5PVU4_E1B19K-      atgatgaagaggcctgtggctgcagaagtccaaatggagcttgacaggct

A0A0M3TH18_E1B19K-      gttagagaattataacagcttaagaagggttttagaagaggcgtctgaag
A0A1W5PVU4_E1B19K-      gttagagaattataacagtttaagaagggttttagaagaggcgtctgagg
                        ****************** ***************************** *

A0A0M3TH18_E1B19K-      atacttcagtttggtggcgcaagttgtttgggtgtagagttagtcagtta
A0A1W5PVU4_E1B19K-      atacttcagtttggtggcgtaggctgtttgggtgtagggttagtcagtta
                        ******************* * * ************* ************

A0A0M3TH18_E1B19K-      gtagttcaggctaaagttgaatataaggaagaatttgagaaacttttttc
A0A1W5PVU4_E1B19K-      gtagtgcaggctaaagttgaatataaggaagaatttgagaaacttttttc
                        ***** ********************************************

A0A0M3TH18_E1B19K-      agaggtgcctggacttgtggactctctaaatttttgccatcacgcttttt
A0A1W5PVU4_E1B19K-      ggaagtgcctggacttgtggactctttgaatttttgccatcacgcttttt
                         ** ********************* * **********************

A0A0M3TH18_E1B19K-      tttacgagaaggttatttgcggcttggatttttgcactcccggacgcact
A0A1W5PVU4_E1B19K-      tttacgagaaggttatttgcggcttggatttttgtactcctggacgcact
                        ********************************** ***** *********

A0A0M3TH18_E1B19K-      attgcagctttggctttttgcgcttttattttagataagtggaataagga
A0A1W5PVU4_E1B19K-      attgcagctttggctttttgtgcttttattttagataagtggaataagga
                        ******************** *****************************

A0A0M3TH18_E1B19K-      gactcatctcagtaaaggatatactttagattacattagtttgcagctat
A0A1W5PVU4_E1B19K-      gactcatctgagtagaggatatactttagattacattagtttgcagctat
                        ********* **** ***********************************

A0A0M3TH18_E1B19K-      ggaaggcttacatgaggaaggggaagatctacaccttctcgcaggggccg
A0A1W5PVU4_E1B19K-      ggaaggcttacatgaggaaggggaagatctacacattctcgcaggggccg
                        ********************************** ***************

A0A0M3TH18_E1B19K-      cggtcgctgccgcagcgggtgcggaggcggttggggttcaagacagagga
A0A1W5PVU4_E1B19K-      cggtcgctgccgcagcgggtgcggaggcggctggggttccagacagagga
                        ****************************** ******** **********

A0A0M3TH18_E1B19K-      ccaaacgcgcttgctggaggccgaggaggagcccagggcggggacggatc
A0A1W5PVU4_E1B19K-      tcaaacccgcttgctggaggccgaggaggagccccgggcgggaatggatc
                         ***** *************************** ******* * *****

A0A0M3TH18_E1B19K-      ccccgagcgagacttga
A0A1W5PVU4_E1B19K-      ccccgagcgagacttga

© 1998-2018