Dataset for CDS adenoviridae of organism Human mastadenovirus E

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2L1F392_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A2L1F3A2_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A2R3WN16_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A2R3WN62_E1B19K-      atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q6H1D7_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
                        ***************** ************ *******************

A0A2L1F392_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A2L1F3A2_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A2R3WN16_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A2R3WN62_E1B19K-      agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q6H1D7_E1B19K-01        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
                        ********************* ***************** ******** *

A0A2L1F392_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A2L1F3A2_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A2R3WN16_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A2R3WN62_E1B19K-      gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q6H1D7_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
                        * ************************ *************** *******

A0A2L1F392_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A2L1F3A2_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A2R3WN16_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A2R3WN62_E1B19K-      tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q6H1D7_E1B19K-01        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
                        ***** ******** * *********************************

A0A2L1F392_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A2L1F3A2_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A2R3WN16_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A2R3WN62_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q6H1D7_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta

A0A2L1F392_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A2L1F3A2_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A2R3WN16_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A2R3WN62_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q6H1D7_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
                        ******************************************** ** **

A0A2L1F392_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A2L1F3A2_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A2R3WN16_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A2R3WN62_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q6H1D7_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
                        ****************************************** *******

A0A2L1F392_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A2L1F3A2_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A2R3WN16_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A2R3WN62_E1B19K-      cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q6H1D7_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
                        ********************** ***************************

A0A2L1F392_E1B19K-      tc----------tgccggtacagccgctag--------------------
A0A2L1F3A2_E1B19K-      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
A0A2R3WN16_E1B19K-      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
A0A2R3WN62_E1B19K-      tc-ccggctacttgccggtacagccgctag--------------------
Q6H1D7_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
                        **          ******************                    

A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2L1F3A2_E1B19K-      ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
A0A2R3WN16_E1B19K-      ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        ctc---------------------------------cagcagcaggagga

A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2L1F3A2_E1B19K-      tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg
A0A2R3WN16_E1B19K-      tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg

A0A2L1F392_E1B19K-      -----
A0A2L1F3A2_E1B19K-      agtag
A0A2R3WN16_E1B19K-      agtag
A0A2R3WN62_E1B19K-      -----
Q6H1D7_E1B19K-01        agtag

© 1998-2018