Dataset for CDS E1B19K of organism Human mastadenovirus D

[Download (right click)] [Edit] [Sequences] [Repertoires]

30 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A384ZUF2_E1B19K-      --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      atgactcatgggcggggcttagtcctatataagtggcaacacctgggcac
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        atgactcatgggcggggcttagtcctatataagtggcaacacctgggcac
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
                                                                          

A0A384ZUF2_E1B19K-      ----------------------------atggagccaggacacccaactg
A0A384ZUM9_E1B19K-      ----------------------------atggagccaggacacccaactg
T1UG22_E1B19K-01        ----------------------------atggat----------------
T1UGY3_E1B19K-01        ----------------------------atggat----------------
T1UGU0_E1B19K-01        ----------------------------atggag----------------
T1UK99_E1B19K-01        ----------------------------atggag----------------
T1UKQ0_E1B19K-01        ----------------------------atggat----------------
X4YVU5_E1B19K-01        ----------------------------atggag----------------
A0A291B0H2_E1B19K-      ----------------------------atggat----------------
T1UKV6_E1B19K-01        ----------------------------atggat----------------
A0A0G2UY10_E1B19K-      ttgggcacagaccttcagggagttcctgatggat----------------
A0A1J0MS84_E1B19K-      ----------------------------atggat----------------
T1UKP8_E1B19K-01        ----------------------------atggat----------------
T1UHQ8_E1B19K-01        ----------------------------atggat----------------
A0A384ZUM9_E1B19K-      ----------------------------atggat----------------
T1UHG3_E1B19K-01        ----------------------------atggat----------------
A0A384ZUF2_E1B19K-      ----------------------------atggat----------------
E1CIR1_E1B19K-01        ----------------------------atggat----------------
X4Y9D2_E1B19K-01        tcgggcacagaccttcagggagttcctgatggat----------------
T1UHH6_E1B19K-01        ----------------------------atggat----------------
T1ULJ8_E1B19K-01        ----------------------------atggat----------------
A0A075TSZ1_E1B19K-      ----------------------------atggat----------------
T1ULP4_E1B19K-01        ----------------------------atggat----------------
B6DU90_E1B19K-01        ----------------------------atggat----------------
T1UHZ2_E1B19K-01        ----------------------------atggat----------------
A0A097I4T0_E1B19K-      ----------------------------atggat----------------
F8UFP5_E1B19K-01        ----------------------------atggag----------------
T1UGT5_E1B19K-01        ----------------------------atggag----------------
G3CK71_E1B19K-01        ----------------------------atggag----------------
T1UGX3_E1B19K-01        ----------------------------atggat----------------
                                                    *****                 

A0A384ZUF2_E1B19K-      agcaggggcta-catcctggacttcgcagccatgcacctgtggagggcct
A0A384ZUM9_E1B19K-      agcaggggcta-catcctggacttcgcagccatgcacctgtggagggcct
T1UG22_E1B19K-01        -gtgtggagtattcttggggaatt--taacaagacac-----gccggctt
T1UGY3_E1B19K-01        -gtgtggagtattcttggggaatt--taacaagacac-----gccggctt
T1UGU0_E1B19K-01        -gtgtggactatccttgcggactt--taacaagacac-----gccggctt
T1UK99_E1B19K-01        -gtgtggactatccttggggactt--taacaagacac-----gccggctt
T1UKQ0_E1B19K-01        -gtgtggactatccttgcggactt--taacaagacac-----gccggctt
X4YVU5_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A291B0H2_E1B19K-      -gtgtggactatccttggggactt--tagcaagacac-----gccggctt
T1UKV6_E1B19K-01        -gtgtggactatccttggggattt--taacaagacac-----gccggctt
A0A0G2UY10_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A1J0MS84_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1UKP8_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1UHQ8_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A384ZUM9_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1UHG3_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A384ZUF2_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
E1CIR1_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
X4Y9D2_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1UHH6_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1ULJ8_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A075TSZ1_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
T1ULP4_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
B6DU90_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccgactt
T1UHZ2_E1B19K-01        -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
A0A097I4T0_E1B19K-      -gtgtggactatccttgcagactt--tagcaagacac-----gccggctt
F8UFP5_E1B19K-01        -gtgtggactatccttgcagactt--taacaagacac-----gccggctt
T1UGT5_E1B19K-01        -gtgtggactatccttgcagactt--taacaagacac-----gccggctt
G3CK71_E1B19K-01        -gtgtggactatccttggagactt--taacaagacac-----gccggctt
T1UGX3_E1B19K-01        -gtgtggactatccttgcagactt--tagccagacac-----gccggctt
                         *   **  **   *    ** **   * * *  ***     *  * * *

A0A384ZUF2_E1B19K-      ggatcaggcagcggggacagagaatcttgaattactggcttctacagcca
A0A384ZUM9_E1B19K-      ggatcaggcagcggggacagagaatcttgagttactggcttctacagcca
T1UG22_E1B19K-01        gtg---------gaggatag----------------------ttcagacg
T1UGY3_E1B19K-01        gtg---------gaggatag----------------------ttcagacg
T1UGU0_E1B19K-01        gtg---------gaggatag----------------------ttcagacg
T1UK99_E1B19K-01        gtg---------gaggatag----------------------ttcagacg
T1UKQ0_E1B19K-01        gta---------gaggatag----------------------ttcagacg
X4YVU5_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A291B0H2_E1B19K-      gta---------gaggatag----------------------ttcagacg
T1UKV6_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A0G2UY10_E1B19K-      gta---------gaggatag----------------------ttcagacg
A0A1J0MS84_E1B19K-      gta---------gaggatag----------------------ttcagacg
T1UKP8_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1UHQ8_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A384ZUM9_E1B19K-      gta---------gaggatag----------------------ttcagacg
T1UHG3_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A384ZUF2_E1B19K-      gta---------gaggatag----------------------ttcagacg
E1CIR1_E1B19K-01        gta---------gaggatag----------------------ttcagacg
X4Y9D2_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1UHH6_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1ULJ8_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A075TSZ1_E1B19K-      gta---------gaggatag----------------------ttcagacg
T1ULP4_E1B19K-01        gta---------gaggatag----------------------ttcagacg
B6DU90_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1UHZ2_E1B19K-01        gta---------gaggatag----------------------ttcagacg
A0A097I4T0_E1B19K-      gta---------gaggatag----------------------ttcagacg
F8UFP5_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1UGT5_E1B19K-01        gta---------gaggatag----------------------ttcagacg
G3CK71_E1B19K-01        gta---------gaggatag----------------------ttcagacg
T1UGX3_E1B19K-01        gta---------gaggatag----------------------ttcagacg
                        *           * *** **                      * *** * 

A0A384ZUF2_E1B19K-      gcagctccggttcttcttcgtctacacagacaaacatccatgttggagga
A0A384ZUM9_E1B19K-      gcagctccgggtcttcttcgtctacacagacaaacatccatgttggagga
T1UG22_E1B19K-01        ggtgctccgggtttt-----------------------------------
T1UGY3_E1B19K-01        ggtgctccgggtttt-----------------------------------
T1UGU0_E1B19K-01        ggtgctccggtttct-----------------------------------
T1UK99_E1B19K-01        ggtgctccggtttct-----------------------------------
T1UKQ0_E1B19K-01        ggtgctccggtttct-----------------------------------
X4YVU5_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A291B0H2_E1B19K-      ggtgctccgggttct-----------------------------------
T1UKV6_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A0G2UY10_E1B19K-      ggtgctccgggttct-----------------------------------
A0A1J0MS84_E1B19K-      ggtgctccgggttct-----------------------------------
T1UKP8_E1B19K-01        ggtgctccgggttct-----------------------------------
T1UHQ8_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A384ZUM9_E1B19K-      ggtgctccgggttct-----------------------------------
T1UHG3_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A384ZUF2_E1B19K-      ggtgctccgggttct-----------------------------------
E1CIR1_E1B19K-01        ggtgctccgggttct-----------------------------------
X4Y9D2_E1B19K-01        ggtgctccgggttct-----------------------------------
T1UHH6_E1B19K-01        ggtgctccgggttct-----------------------------------
T1ULJ8_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A075TSZ1_E1B19K-      ggtgctccgggttct-----------------------------------
T1ULP4_E1B19K-01        ggtgctccgggttct-----------------------------------
B6DU90_E1B19K-01        ggtgctccgggttct-----------------------------------
T1UHZ2_E1B19K-01        ggtgctccgggttct-----------------------------------
A0A097I4T0_E1B19K-      ggtgctccgggttct-----------------------------------
F8UFP5_E1B19K-01        ggtgctccgggttct-----------------------------------
T1UGT5_E1B19K-01        ggtgctccggtttct-----------------------------------
G3CK71_E1B19K-01        ggtgctccgggttct-----------------------------------
T1UGX3_E1B19K-01        ggtgctccgggttct-----------------------------------
                        *  ******* *  *                                   

A0A384ZUF2_E1B19K-      agaaatgaggcaggccatggacgagaacccgaggagcggcctggaccctc
A0A384ZUM9_E1B19K-      agaaatgaggcaggccatggacgagaacccgaggagcggcctggaccctc
T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
                                                                          

A0A384ZUF2_E1B19K-      cgtcggaagaggagctggattgaa--tcaggtatccagcctgtacccaga
A0A384ZUM9_E1B19K-      cgtcggaagaggagctggattgaa--tcaggtagccagcctgtacccaga
T1UG22_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UGY3_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UGU0_E1B19K-01        -------ggagacactggtttggaactcctctagctcgtct---------
T1UK99_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UKQ0_E1B19K-01        -------ggagacactggtttggatctcctctatctcgcct---------
X4YVU5_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
A0A291B0H2_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
T1UKV6_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
A0A0G2UY10_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
A0A1J0MS84_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
T1UKP8_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UHQ8_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
A0A384ZUM9_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
T1UHG3_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
A0A384ZUF2_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
E1CIR1_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
X4Y9D2_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UHH6_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1ULJ8_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
A0A075TSZ1_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
T1ULP4_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
B6DU90_E1B19K-01        -------ggagacactggtttggaactcctctatctcgtct---------
T1UHZ2_E1B19K-01        -------ggagacactggtttggaactcctctatctcgact---------
A0A097I4T0_E1B19K-      -------ggagacactggtttggaactcctctatctcgcct---------
F8UFP5_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UGT5_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
G3CK71_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
T1UGX3_E1B19K-01        -------ggagacactggtttggaactcctctatctcgcct---------
                                ***   **** *** *  **   ** *  * **         

A0A384ZUF2_E1B19K-      gcttagcaaggtgctgacatccatggccaggggagttaagagggagagga
A0A384ZUM9_E1B19K-      gcttagcaaggtgctgacatccatggccaggggagtgaagagggagagga
T1UG22_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UGY3_E1B19K-01        ---------ggtgtacac---------------agttaaaa---------
T1UGU0_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UK99_E1B19K-01        ---------ggtgtacac---------------tgttaaga---------
T1UKQ0_E1B19K-01        ---------ggtgtacac---------------tgttaaga---------
X4YVU5_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
A0A291B0H2_E1B19K-      ---------ggtgtacac---------------agttaaga---------
T1UKV6_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
A0A0G2UY10_E1B19K-      ---------ggtgtacac---------------agttaaga---------
A0A1J0MS84_E1B19K-      ---------ggtgtacac---------------agttaaga---------
T1UKP8_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UHQ8_E1B19K-01        ---------ggtgtacac---------------agttaaaa---------
A0A384ZUM9_E1B19K-      ---------ggtgtacac---------------agttaaga---------
T1UHG3_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
A0A384ZUF2_E1B19K-      ---------ggtgtacac---------------agttaaga---------
E1CIR1_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
X4Y9D2_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UHH6_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1ULJ8_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
A0A075TSZ1_E1B19K-      ---------ggtgtacac---------------agttaaga---------
T1ULP4_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
B6DU90_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UHZ2_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
A0A097I4T0_E1B19K-      ---------ggtgtacac---------------agttaaga---------
F8UFP5_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UGT5_E1B19K-01        ---------ggtgtatac---------------agttaaga---------
G3CK71_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
T1UGX3_E1B19K-01        ---------ggtgtacac---------------agttaaga---------
                                 ****   **                ** ** *         

A0A384ZUF2_E1B19K-      gcgatgggggtaataccgggatgatgaccgagctgacggccagcctgatg
A0A384ZUM9_E1B19K-      gcgatgggggcaataccgggatgatgaccgagttgacggccagcctgatg
T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
                                                                          

A0A384ZUF2_E1B19K-      aatcggaagcgcccagagcgccttacctggtacgagctacagcaggagtg
A0A384ZUM9_E1B19K-      aatcgtaagcgcccagagcgcattacctggcacgagctacagcaggagtg
T1UG22_E1B19K-01        -------------------------------------------aggatta
T1UGY3_E1B19K-01        -------------------------------------------aggatta
T1UGU0_E1B19K-01        -------------------------------------------aggatta
T1UK99_E1B19K-01        -------------------------------------------aggatta
T1UKQ0_E1B19K-01        -------------------------------------------aggatta
X4YVU5_E1B19K-01        -------------------------------------------aggatta
A0A291B0H2_E1B19K-      -------------------------------------------aggatta
T1UKV6_E1B19K-01        -------------------------------------------aggatta
A0A0G2UY10_E1B19K-      -------------------------------------------aggatta
A0A1J0MS84_E1B19K-      -------------------------------------------aggatta
T1UKP8_E1B19K-01        -------------------------------------------aggatta
T1UHQ8_E1B19K-01        -------------------------------------------aggatta
A0A384ZUM9_E1B19K-      -------------------------------------------aggatta
T1UHG3_E1B19K-01        -------------------------------------------aggatta
A0A384ZUF2_E1B19K-      -------------------------------------------aggatta
E1CIR1_E1B19K-01        -------------------------------------------aggatta
X4Y9D2_E1B19K-01        -------------------------------------------aggatta
T1UHH6_E1B19K-01        -------------------------------------------aggatta
T1ULJ8_E1B19K-01        -------------------------------------------aggatta
A0A075TSZ1_E1B19K-      -------------------------------------------aggatta
T1ULP4_E1B19K-01        -------------------------------------------aggatta
B6DU90_E1B19K-01        -------------------------------------------aggatta
T1UHZ2_E1B19K-01        -------------------------------------------aggatta
A0A097I4T0_E1B19K-      -------------------------------------------aggatta
F8UFP5_E1B19K-01        -------------------------------------------aggatta
T1UGT5_E1B19K-01        -------------------------------------------aggatta
G3CK71_E1B19K-01        -------------------------------------------aggatta
T1UGX3_E1B19K-01        -------------------------------------------aggatta
                                                                   **** * 

A0A384ZUF2_E1B19K-      cagggatgagttgggcctgatgcaggataaatatggcctggagcagataa
A0A384ZUM9_E1B19K-      cagggatgagataggcttgatgcaggataaatatggcctggagcagataa
T1UG22_E1B19K-01        tagcgaggaatt-----------------------------------tga
T1UGY3_E1B19K-01        tagcgaggaatt-----------------------------------tga
T1UGU0_E1B19K-01        tcaggaggaatt-----------------------------------tga
T1UK99_E1B19K-01        tcaggaggaatt-----------------------------------tga
T1UKQ0_E1B19K-01        tcaggaggaatt-----------------------------------tga
X4YVU5_E1B19K-01        taacgaggaatt-----------------------------------tga
A0A291B0H2_E1B19K-      tagcgaggaatt-----------------------------------tga
T1UKV6_E1B19K-01        tagcgaggaatt-----------------------------------tga
A0A0G2UY10_E1B19K-      taacgaggaatt-----------------------------------tga
A0A1J0MS84_E1B19K-      taacgaggaatt-----------------------------------tga
T1UKP8_E1B19K-01        taacgaggaatt-----------------------------------tga
T1UHQ8_E1B19K-01        taacgaggaatt-----------------------------------tga
A0A384ZUM9_E1B19K-      taaagaggaatt-----------------------------------tga
T1UHG3_E1B19K-01        taaagaggaatt-----------------------------------tga
A0A384ZUF2_E1B19K-      taaagaggaatt-----------------------------------tga
E1CIR1_E1B19K-01        taaagaggaatt-----------------------------------tga
X4Y9D2_E1B19K-01        taacgaggaatt-----------------------------------tga
T1UHH6_E1B19K-01        taaagaggaatt-----------------------------------tga
T1ULJ8_E1B19K-01        taaagaggaatt-----------------------------------tga
A0A075TSZ1_E1B19K-      taaagaggaatt-----------------------------------tga
T1ULP4_E1B19K-01        taaagaggaatt-----------------------------------tga
B6DU90_E1B19K-01        taacgaggaatt-----------------------------------tga
T1UHZ2_E1B19K-01        taacgaggaatt-----------------------------------tga
A0A097I4T0_E1B19K-      taacgaggaatt-----------------------------------tga
F8UFP5_E1B19K-01        tagcgaggaatt-----------------------------------tga
T1UGT5_E1B19K-01        taacgaggaatt-----------------------------------tga
G3CK71_E1B19K-01        taacgaggaatt-----------------------------------tga
T1UGX3_E1B19K-01        taaagaggaatt-----------------------------------tga
                            ** **  *                                   * *

A0A384ZUF2_E1B19K-      aaacccattggttgaacccagatgaggattgggaggaggctattaagaag
A0A384ZUM9_E1B19K-      aaacccattggttgaacccagatgaggattgggaggaggccattaagaag
T1UG22_E1B19K-01        aaatctttttgcc-------------------------------------
T1UGY3_E1B19K-01        aaatctttttgcc-------------------------------------
T1UGU0_E1B19K-01        aaatctttttgcc-------------------------------------
T1UK99_E1B19K-01        aaatctttttgct-------------------------------------
T1UKQ0_E1B19K-01        aaatctttttgcc-------------------------------------
X4YVU5_E1B19K-01        aaatctttttgtc-------------------------------------
A0A291B0H2_E1B19K-      aaatcttttttcc-------------------------------------
T1UKV6_E1B19K-01        aaatcttttttcc-------------------------------------
A0A0G2UY10_E1B19K-      aaatctttttgct-------------------------------------
A0A1J0MS84_E1B19K-      aaatctttttgct-------------------------------------
T1UKP8_E1B19K-01        aaatctttttgct-------------------------------------
T1UHQ8_E1B19K-01        aaatctttttgct-------------------------------------
A0A384ZUM9_E1B19K-      aaatctttttgct-------------------------------------
T1UHG3_E1B19K-01        aaatatttttgct-------------------------------------
A0A384ZUF2_E1B19K-      aaatatttttgct-------------------------------------
E1CIR1_E1B19K-01        aaatatttttgct-------------------------------------
X4Y9D2_E1B19K-01        aaatctttttgct-------------------------------------
T1UHH6_E1B19K-01        aaatatttttgct-------------------------------------
T1ULJ8_E1B19K-01        aaatctttttgct-------------------------------------
A0A075TSZ1_E1B19K-      aaatctttttgct-------------------------------------
T1ULP4_E1B19K-01        aaatctttttgct-------------------------------------
B6DU90_E1B19K-01        aaatctttttgct-------------------------------------
T1UHZ2_E1B19K-01        aaatctttttgct-------------------------------------
A0A097I4T0_E1B19K-      aaatctttttgct-------------------------------------
F8UFP5_E1B19K-01        aaatcttttttcc-------------------------------------
T1UGT5_E1B19K-01        aaatctttttgcc-------------------------------------
G3CK71_E1B19K-01        aaatctttttgcc-------------------------------------
T1UGX3_E1B19K-01        aaatctttttgcc-------------------------------------
                        ***    **                                         

A0A384ZUF2_E1B19K-      tatgccaagatagccctgcgcccagattgcaagtacatagtgaccaagac
A0A384ZUM9_E1B19K-      tatgccaagatagccctgcgcccagattgcaagtacatagtgaccaagac
T1UG22_E1B19K-01        --------gactgctctg--------------------------------
T1UGY3_E1B19K-01        --------gactgctctg--------------------------------
T1UGU0_E1B19K-01        --------gactgttctg--------------------------------
T1UK99_E1B19K-01        --------gactgctctg--------------------------------
T1UKQ0_E1B19K-01        --------gattgctctg--------------------------------
X4YVU5_E1B19K-01        --------gactgctctg--------------------------------
A0A291B0H2_E1B19K-      --------gactgctctg--------------------------------
T1UKV6_E1B19K-01        --------gactgctctg--------------------------------
A0A0G2UY10_E1B19K-      --------gactgctctg--------------------------------
A0A1J0MS84_E1B19K-      --------gactgctctg--------------------------------
T1UKP8_E1B19K-01        --------gactgctctg--------------------------------
T1UHQ8_E1B19K-01        --------gattgctctg--------------------------------
A0A384ZUM9_E1B19K-      --------gactgctctg--------------------------------
T1UHG3_E1B19K-01        --------gactgctctg--------------------------------
A0A384ZUF2_E1B19K-      --------gactgctctg--------------------------------
E1CIR1_E1B19K-01        --------gactgctctg--------------------------------
X4Y9D2_E1B19K-01        --------gactgctctg--------------------------------
T1UHH6_E1B19K-01        --------gactgctctg--------------------------------
T1ULJ8_E1B19K-01        --------gactgctctg--------------------------------
A0A075TSZ1_E1B19K-      --------gactgctctg--------------------------------
T1ULP4_E1B19K-01        --------gactgctctg--------------------------------
B6DU90_E1B19K-01        --------gattgctctg--------------------------------
T1UHZ2_E1B19K-01        --------gattgctctg--------------------------------
A0A097I4T0_E1B19K-      --------gattgctctg--------------------------------
F8UFP5_E1B19K-01        --------gactgctctg--------------------------------
T1UGT5_E1B19K-01        --------gactgctctg--------------------------------
G3CK71_E1B19K-01        --------gactgctctg--------------------------------
T1UGX3_E1B19K-01        --------gactgctctg--------------------------------
                                **  *  ***                                

A0A384ZUF2_E1B19K-      cgtgaatatcagacatgcctgctacatctcggggaacggggcagaggtgg
A0A384ZUM9_E1B19K-      cgtgaatatcagacatgcctgctacatctcggggaacggggcagaggtgg
T1UG22_E1B19K-01        ----------------gcctgctagattctttaaatt---------ttgg
T1UGY3_E1B19K-01        ----------------gcctgctagattctttaaatt---------ttgg
T1UGU0_E1B19K-01        ----------------gccttcttgattcactgaatc---------ttgg
T1UK99_E1B19K-01        ----------------gcctgctagattctctgaatt---------tcgg
T1UKQ0_E1B19K-01        ----------------gcctgcttgattcactgaatc---------tcgg
X4YVU5_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
A0A291B0H2_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
T1UKV6_E1B19K-01        ----------------gcctgctagattctctgaatt---------ttgg
A0A0G2UY10_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
A0A1J0MS84_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
T1UKP8_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
T1UHQ8_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
A0A384ZUM9_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
T1UHG3_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
A0A384ZUF2_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
E1CIR1_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
X4Y9D2_E1B19K-01        ----------------gcctgctagattctctgaatc---------ttgg
T1UHH6_E1B19K-01        ----------------gtctgctagattctctgaatc---------ttgg
T1ULJ8_E1B19K-01        ----------------gtctgctagattctctgaatc---------ttgg
A0A075TSZ1_E1B19K-      ----------------gcctgctagattctctgaatc---------ttgg
T1ULP4_E1B19K-01        ----------------gtctgctagattctctgaatc---------ttgg
B6DU90_E1B19K-01        ----------------gcctgctagattctctgaatc---------tcgg
T1UHZ2_E1B19K-01        ----------------gcctgctagattctctgaatc---------tcgg
A0A097I4T0_E1B19K-      ----------------gcctactagattctctgaatc---------tcgg
F8UFP5_E1B19K-01        ----------------gcctgcttgattcactgaatt---------ttgg
T1UGT5_E1B19K-01        ----------------gcctgcttgattctctgaatt---------ttgg
G3CK71_E1B19K-01        ----------------gcctgcttgattctttgaatt---------ttgg
T1UGX3_E1B19K-01        ----------------gcctgcttgattctctgaatt---------ttgg
                                        * ** **  **       *             **

A0A384ZUF2_E1B19K-      tcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaatg
A0A384ZUM9_E1B19K-      tcatcgataccctggacaagtcagccttcaggtgttgcatgatgggaatg
T1UG22_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UGY3_E1B19K-01        tcaccagtccctt---------------------ttccaggaaagg----
T1UGU0_E1B19K-01        ccaccaggctcta---------------------ttccaggaaagg----
T1UK99_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UKQ0_E1B19K-01        ccaccaggctctt---------------------ttccaggaaagg----
X4YVU5_E1B19K-01        ccaccaggctcta---------------------ttccaggaaagg----
A0A291B0H2_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
T1UKV6_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
A0A0G2UY10_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
A0A1J0MS84_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
T1UKP8_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UHQ8_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
A0A384ZUM9_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
T1UHG3_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
A0A384ZUF2_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
E1CIR1_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
X4Y9D2_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UHH6_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1ULJ8_E1B19K-01        ccaccaggctcta---------------------ttccaggaaagg----
A0A075TSZ1_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
T1ULP4_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
B6DU90_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UHZ2_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
A0A097I4T0_E1B19K-      ccaccagtccctt---------------------ttccaggaaagg----
F8UFP5_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UGT5_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
G3CK71_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
T1UGX3_E1B19K-01        ccaccagtccctt---------------------ttccaggaaagg----
                         ** *     *                       ** ** **  **    

A0A384ZUF2_E1B19K-      agagcaggagtgatgaatatgaattccatgatcttcatgaacatgaagtt
A0A384ZUM9_E1B19K-      agagccggagtgatgaatatgaattccatgatctttatgaatatgaagtt
T1UG22_E1B19K-01        --------------------gtactccacagccttgat------------
T1UGY3_E1B19K-01        --------------------gtactccacagccttgat------------
T1UGU0_E1B19K-01        --------------------gtcctccacagccttgat------------
T1UK99_E1B19K-01        --------------------gtactccacagccttgat------------
T1UKQ0_E1B19K-01        --------------------gtactccacagccttgat------------
X4YVU5_E1B19K-01        --------------------gtactccacagccttgat------------
A0A291B0H2_E1B19K-      --------------------gtactccacagccttgat------------
T1UKV6_E1B19K-01        --------------------gtccttcacagccttgat------------
A0A0G2UY10_E1B19K-      --------------------gtactccacagtcttgat------------
A0A1J0MS84_E1B19K-      --------------------gtactccacagtcttgat------------
T1UKP8_E1B19K-01        --------------------gtacttcacagccttgat------------
T1UHQ8_E1B19K-01        --------------------gtactccacagccttgat------------
A0A384ZUM9_E1B19K-      --------------------gtactccacagccttgat------------
T1UHG3_E1B19K-01        --------------------gtactccacagccttgat------------
A0A384ZUF2_E1B19K-      --------------------gtactccacagccttgat------------
E1CIR1_E1B19K-01        --------------------gtactccacagccttgat------------
X4Y9D2_E1B19K-01        --------------------gtactccacagccttgat------------
T1UHH6_E1B19K-01        --------------------gtactccacagccttgat------------
T1ULJ8_E1B19K-01        --------------------gtactccacagccttgat------------
A0A075TSZ1_E1B19K-      --------------------gtactccacagccttgat------------
T1ULP4_E1B19K-01        --------------------gtactccacagccttgat------------
B6DU90_E1B19K-01        --------------------gtactccacagccttgat------------
T1UHZ2_E1B19K-01        --------------------gtactccacagccttgat------------
A0A097I4T0_E1B19K-      --------------------gtactccacagccttgat------------
F8UFP5_E1B19K-01        --------------------gtcctccacagccttgat------------
T1UGT5_E1B19K-01        --------------------gtcctccacagccttgat------------
G3CK71_E1B19K-01        --------------------gtcctccacagccttgat------------
T1UGX3_E1B19K-01        --------------------gtcctccacagccttgat------------
                                            *   * **    *** **            

A0A384ZUF2_E1B19K-      caatggagagaagtttaatggggtgctgttcatggccaacagccacatga
A0A384ZUM9_E1B19K-      caatggagagaagtttaatggggtgctgttcatggccaacagccacatga
T1UG22_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UGY3_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UGU0_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UK99_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UKQ0_E1B19K-01        --------------------------ttttc--------cagcc-caggt
X4YVU5_E1B19K-01        --------------------------ttttc--------cagcc-caggg
A0A291B0H2_E1B19K-      --------------------------ttttc--------atctc-ccggg
T1UKV6_E1B19K-01        --------------------------ttttc--------atctc-ccgga
A0A0G2UY10_E1B19K-      --------------------------ttttc--------cagcc-caggg
A0A1J0MS84_E1B19K-      --------------------------ttttc--------cagcc-caggg
T1UKP8_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UHQ8_E1B19K-01        --------------------------ttttc--------cagcc-caggg
A0A384ZUM9_E1B19K-      --------------------------ttttc--------cagcc-caggg
T1UHG3_E1B19K-01        --------------------------ttttc--------cagcc-caggg
A0A384ZUF2_E1B19K-      --------------------------ttttc--------cagcc-caggg
E1CIR1_E1B19K-01        --------------------------ttttc--------cagcc-caggg
X4Y9D2_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UHH6_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1ULJ8_E1B19K-01        --------------------------ttttc--------cagcc-caggg
A0A075TSZ1_E1B19K-      --------------------------ttttc--------cagcc-caggg
T1ULP4_E1B19K-01        --------------------------ttttc--------cagcc-caggg
B6DU90_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UHZ2_E1B19K-01        --------------------------ttttc--------cagcc-caggg
A0A097I4T0_E1B19K-      --------------------------ttttc--------cagtc-caggg
F8UFP5_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UGT5_E1B19K-01        --------------------------ttttc--------cagcc-caggg
G3CK71_E1B19K-01        --------------------------ttttc--------cagcc-caggg
T1UGX3_E1B19K-01        --------------------------ttttc--------cagcc-caggg
                                                  * ***            * *  * 

A0A384ZUF2_E1B19K-      ccctgcatggctgcagtttcttcggcttcaacaatatgtgcgcagaggtc
A0A384ZUM9_E1B19K-      ccctgcatggctgcagcttctttggtttcaacaacatgtgtgcagaggtc
T1UG22_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UGY3_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UGU0_E1B19K-01        cgcactacagccggtgttgcttt---------------------------
T1UK99_E1B19K-01        cgcactacagccggtgttgcatt---------------------------
T1UKQ0_E1B19K-01        cgcactacagccggtgttgcatt---------------------------
X4YVU5_E1B19K-01        cgcactacagccggggttgcgtt---------------------------
A0A291B0H2_E1B19K-      cgcactacagccggggttgcttt---------------------------
T1UKV6_E1B19K-01        cgcactacagccggggttgcttt---------------------------
A0A0G2UY10_E1B19K-      cgcactacagccggggttgcttt---------------------------
A0A1J0MS84_E1B19K-      cgcactacagccggggttgcttt---------------------------
T1UKP8_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UHQ8_E1B19K-01        cgcactacagccggggttgcttt---------------------------
A0A384ZUM9_E1B19K-      cgcactacagccggggttgcttt---------------------------
T1UHG3_E1B19K-01        cgcactacagccggggttgcttt---------------------------
A0A384ZUF2_E1B19K-      cgcactacagccggggttgcttt---------------------------
E1CIR1_E1B19K-01        cgcactacagccggggttgcttt---------------------------
X4Y9D2_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UHH6_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1ULJ8_E1B19K-01        cgcactacagccggggttgcttt---------------------------
A0A075TSZ1_E1B19K-      cgcactacagccggggttgcttt---------------------------
T1ULP4_E1B19K-01        cgcactacagccggggttgcttt---------------------------
B6DU90_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UHZ2_E1B19K-01        cgcactacagccggggttgcttt---------------------------
A0A097I4T0_E1B19K-      cgcactacagccggggttgcttt---------------------------
F8UFP5_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UGT5_E1B19K-01        cgcactacagccggggttgcttt---------------------------
G3CK71_E1B19K-01        cgcactacagccggggttgcttt---------------------------
T1UGX3_E1B19K-01        cgcactacagccggggttgcttt---------------------------
                        * *   *  ** *  * * * *                            

A0A384ZUF2_E1B19K-      tggggcgcttccaagatcaggggatgtaagttttatggctgctggatggg
A0A384ZUM9_E1B19K-      tggggagctgctaagatcaggggctgtaagttttatggctgctggatggg
T1UG22_E1B19K-01        ------------------------tgtggtttttttggttgacaaatgg-
T1UGY3_E1B19K-01        ------------------------tgtggtttttttggttgacaaatgg-
T1UGU0_E1B19K-01        ------------------------tgtggtgtttctggttgacaaatgg-
T1UK99_E1B19K-01        ------------------------tgtggtgtttctggttgacaaatgg-
T1UKQ0_E1B19K-01        ------------------------tgtggtgtttctggttgacaaatgg-
X4YVU5_E1B19K-01        ------------------------tgtggtgtttctggttgacaaatgg-
A0A291B0H2_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
T1UKV6_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
A0A0G2UY10_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
A0A1J0MS84_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
T1UKP8_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1UHQ8_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
A0A384ZUM9_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
T1UHG3_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
A0A384ZUF2_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
E1CIR1_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
X4Y9D2_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1UHH6_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1ULJ8_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
A0A075TSZ1_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
T1ULP4_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
B6DU90_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1UHZ2_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
A0A097I4T0_E1B19K-      ------------------------tgtggtttttctggttgacaaatgg-
F8UFP5_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1UGT5_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
G3CK71_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
T1UGX3_E1B19K-01        ------------------------tgtggtttttctggttgacaaatgg-
                                                ***    *** *** **    **** 

A0A384ZUF2_E1B19K-      cgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtttg
A0A384ZUM9_E1B19K-      agtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtttg
T1UG22_E1B19K-01        ---agccaggacacccaa--------------------------------
T1UGY3_E1B19K-01        ---agccaggacacccaa--------------------------------
T1UGU0_E1B19K-01        ---agccagcaaacccac--------------------------------
T1UK99_E1B19K-01        ---agccagcaaacccac--------------------------------
T1UKQ0_E1B19K-01        ---agccagcaaacccac--------------------------------
X4YVU5_E1B19K-01        ---agccagcaaacccat--------------------------------
A0A291B0H2_E1B19K-      ---agccaggacacccaa--------------------------------
T1UKV6_E1B19K-01        ---agccaggacacccaa--------------------------------
A0A0G2UY10_E1B19K-      ---agccagaacacccaa--------------------------------
A0A1J0MS84_E1B19K-      ---agccagaacacccaa--------------------------------
T1UKP8_E1B19K-01        ---agccaggacacccaa--------------------------------
T1UHQ8_E1B19K-01        ---agccaggacacccaa--------------------------------
A0A384ZUM9_E1B19K-      ---agccaggacacccaa--------------------------------
T1UHG3_E1B19K-01        ---agccaggacacccaa--------------------------------
A0A384ZUF2_E1B19K-      ---agccaggacacccaa--------------------------------
E1CIR1_E1B19K-01        ---agccaggacacccaa--------------------------------
X4Y9D2_E1B19K-01        ---cgccaggacacccaa--------------------------------
T1UHH6_E1B19K-01        ---agccaggacacccaa--------------------------------
T1ULJ8_E1B19K-01        ---agccaggacacccaa--------------------------------
A0A075TSZ1_E1B19K-      ---agccaggacacccaa--------------------------------
T1ULP4_E1B19K-01        ---agccaggacacccaa--------------------------------
B6DU90_E1B19K-01        ---agccagaacacccaa--------------------------------
T1UHZ2_E1B19K-01        ---agccagaacacccaa--------------------------------
A0A097I4T0_E1B19K-      ---agccagaacacccaa--------------------------------
F8UFP5_E1B19K-01        ---agccagaacacccaa--------------------------------
T1UGT5_E1B19K-01        ---agccagaacacccaa--------------------------------
G3CK71_E1B19K-01        ---agccagaacacccaa--------------------------------
T1UGX3_E1B19K-01        ---agccagaacacccaa--------------------------------
                            * * * * *****                                 

A0A384ZUF2_E1B19K-      agaaatgctacctgggagtctctaccgagggcaatgctagagtgagacac
A0A384ZUM9_E1B19K-      agaagtgctacctgggggtgtctaccgagggcaatgctagagtgagacac
T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
                                                                          

A0A384ZUF2_E1B19K-      tgctcttccctggagacgggctgcttctgcctggtgaagggcacagcctc
A0A384ZUM9_E1B19K-      tgctcttccctggagacgggctgcttctgcctggtgaagggcacagcctc
T1UG22_E1B19K-01        ---------ctaagcaggggct----------------------------
T1UGY3_E1B19K-01        ---------ctaagcaggggct----------------------------
T1UGU0_E1B19K-01        ---------ctaaccagggatt----------------------------
T1UK99_E1B19K-01        ---------ttaaccagggatt----------------------------
T1UKQ0_E1B19K-01        ---------ttaaccagggatt----------------------------
X4YVU5_E1B19K-01        ---------ctgaccagggatt----------------------------
A0A291B0H2_E1B19K-      ---------ctgagcaggggat----------------------------
T1UKV6_E1B19K-01        ---------ctgagcaggggct----------------------------
A0A0G2UY10_E1B19K-      ---------ctgagcaggggct----------------------------
A0A1J0MS84_E1B19K-      ---------ctgagcaggggct----------------------------
T1UKP8_E1B19K-01        ---------ctgagcaggggat----------------------------
T1UHQ8_E1B19K-01        ---------ctgagcaggggct----------------------------
A0A384ZUM9_E1B19K-      ---------ctgagcaggggct----------------------------
T1UHG3_E1B19K-01        ---------ctgagcaggggct----------------------------
A0A384ZUF2_E1B19K-      ---------ctgagcaggggct----------------------------
E1CIR1_E1B19K-01        ---------ctgagcaggggct----------------------------
X4Y9D2_E1B19K-01        ---------ctgagcaggggct----------------------------
T1UHH6_E1B19K-01        ---------ctgagcaggggct----------------------------
T1ULJ8_E1B19K-01        ---------ctgagcaggggct----------------------------
A0A075TSZ1_E1B19K-      ---------ctgagcaggggct----------------------------
T1ULP4_E1B19K-01        ---------ctgagcaggggct----------------------------
B6DU90_E1B19K-01        ---------ctgagcaggggct----------------------------
T1UHZ2_E1B19K-01        ---------ctgagcaggggct----------------------------
A0A097I4T0_E1B19K-      ---------ctgagcaggggct----------------------------
F8UFP5_E1B19K-01        ---------ctgagcaggggct----------------------------
T1UGT5_E1B19K-01        ---------ctgagcaggggct----------------------------
G3CK71_E1B19K-01        ---------ctgagcaggggct----------------------------
T1UGX3_E1B19K-01        ---------ctgagcaggggct----------------------------
                                  *    * **  *                            

A0A384ZUF2_E1B19K-      tctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaaca
A0A384ZUM9_E1B19K-      tctgaagcataatgtggtgaagggctgtacggatgagcgcatgtacaaca
T1UG22_E1B19K-01        -----------------------------------------------aca
T1UGY3_E1B19K-01        -----------------------------------------------aca
T1UGU0_E1B19K-01        -----------------------------------------------aca
T1UK99_E1B19K-01        -----------------------------------------------aca
T1UKQ0_E1B19K-01        -----------------------------------------------aca
X4YVU5_E1B19K-01        -----------------------------------------------aca
A0A291B0H2_E1B19K-      -----------------------------------------------aca
T1UKV6_E1B19K-01        -----------------------------------------------aca
A0A0G2UY10_E1B19K-      -----------------------------------------------aca
A0A1J0MS84_E1B19K-      -----------------------------------------------aca
T1UKP8_E1B19K-01        -----------------------------------------------aca
T1UHQ8_E1B19K-01        -----------------------------------------------aca
A0A384ZUM9_E1B19K-      -----------------------------------------------aca
T1UHG3_E1B19K-01        -----------------------------------------------aca
A0A384ZUF2_E1B19K-      -----------------------------------------------aca
E1CIR1_E1B19K-01        -----------------------------------------------aca
X4Y9D2_E1B19K-01        -----------------------------------------------aca
T1UHH6_E1B19K-01        -----------------------------------------------aca
T1ULJ8_E1B19K-01        -----------------------------------------------aca
A0A075TSZ1_E1B19K-      -----------------------------------------------aca
T1ULP4_E1B19K-01        -----------------------------------------------aca
B6DU90_E1B19K-01        -----------------------------------------------aca
T1UHZ2_E1B19K-01        -----------------------------------------------aca
A0A097I4T0_E1B19K-      -----------------------------------------------aca
F8UFP5_E1B19K-01        -----------------------------------------------aca
T1UGT5_E1B19K-01        -----------------------------------------------aca
G3CK71_E1B19K-01        -----------------------------------------------aca
T1UGX3_E1B19K-01        -----------------------------------------------aca
                                                                       ***

A0A384ZUF2_E1B19K-      tgctgacctgcgattcgggggtctgccatatcctgaagaacatccatgtg
A0A384ZUM9_E1B19K-      tgctgacctgcgattcaggggtctgccatatcctgaagaacatccatgtg
T1UG22_E1B19K-01        ttctggactttg----------cagccat---------------------
T1UGY3_E1B19K-01        ttctggactttg----------cagccat---------------------
T1UGU0_E1B19K-01        tcctggacttca----------cggccat---------------------
T1UK99_E1B19K-01        tcctggacttca----------cggccat---------------------
T1UKQ0_E1B19K-01        tcctggacttca----------cggccat---------------------
X4YVU5_E1B19K-01        tcctggacttca----------cggccat---------------------
A0A291B0H2_E1B19K-      tcctggacttcg----------cagccat---------------------
T1UKV6_E1B19K-01        tcctggacttcg----------cagccat---------------------
A0A0G2UY10_E1B19K-      ttctggacttcg----------cggccat---------------------
A0A1J0MS84_E1B19K-      tcctggacttcg----------cggccat---------------------
T1UKP8_E1B19K-01        tcctggacttcg----------cagccat---------------------
T1UHQ8_E1B19K-01        tcctggacttcg----------cagccat---------------------
A0A384ZUM9_E1B19K-      tcctggacttcg----------cagccat---------------------
T1UHG3_E1B19K-01        tcctggacttcg----------cagccat---------------------
A0A384ZUF2_E1B19K-      tcctggacttcg----------cagccat---------------------
E1CIR1_E1B19K-01        tcctggacttcg----------cagccat---------------------
X4Y9D2_E1B19K-01        tcctggacttcg----------cagccat---------------------
T1UHH6_E1B19K-01        tcctggacttcg----------cagccat---------------------
T1ULJ8_E1B19K-01        tcctggacttcg----------cagccat---------------------
A0A075TSZ1_E1B19K-      tcctggacttcg----------cagccat---------------------
T1ULP4_E1B19K-01        tcctggacttcg----------cagccat---------------------
B6DU90_E1B19K-01        ttctggacttcg----------cagccat---------------------
T1UHZ2_E1B19K-01        ttctggacttcg----------cagccat---------------------
A0A097I4T0_E1B19K-      ttctggacttcg----------cagccat---------------------
F8UFP5_E1B19K-01        tcctggacttcg----------cggccat---------------------
T1UGT5_E1B19K-01        tcctggacttcg----------cggccat---------------------
G3CK71_E1B19K-01        ttctggacttcg----------cggccat---------------------
T1UGX3_E1B19K-01        ttctggacttcg----------cagccat---------------------
                        * ***  **             * *****                     

A0A384ZUF2_E1B19K-      acctcccaccccagaaagaagtggccagtgtttgagaataacctgctgat
A0A384ZUM9_E1B19K-      acctcccacgccagaaagaagtggccagtgtttgagaataacctgctgat
T1UG22_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
T1UGY3_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
T1UGU0_E1B19K-01        ---------------------------gcatctgtggaaggcctg--ggt
T1UK99_E1B19K-01        ---------------------------gcacctgtggaaggcctg--ggt
T1UKQ0_E1B19K-01        ---------------------------gcacctgtggaaggcctg--ggt
X4YVU5_E1B19K-01        ---------------------------gcatctgtggaaggcctg--ggt
A0A291B0H2_E1B19K-      ---------------------------gcatctgtggagggcctg--gat
T1UKV6_E1B19K-01        ---------------------------gcatctgtggagggcctg--gat
A0A0G2UY10_E1B19K-      ---------------------------gcacctgtggaggtcctg--gat
A0A1J0MS84_E1B19K-      ---------------------------gcacctgtggaggtcctg--ggt
T1UKP8_E1B19K-01        ---------------------------gcacctgtggaggtcctg--gat
T1UHQ8_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
A0A384ZUM9_E1B19K-      ---------------------------gcacctgtggagggcctg--gat
T1UHG3_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
A0A384ZUF2_E1B19K-      ---------------------------gcacctgtggagggcctg--gat
E1CIR1_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
X4Y9D2_E1B19K-01        ---------------------------gcacctgtggaggtcctg--gat
T1UHH6_E1B19K-01        ---------------------------gcacctgtggaggtcctg--gat
T1ULJ8_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
A0A075TSZ1_E1B19K-      ---------------------------gcacctgtggaggtcctg--gat
T1ULP4_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
B6DU90_E1B19K-01        ---------------------------gcacctgtggagggcatg--ggt
T1UHZ2_E1B19K-01        ---------------------------gcacctgtggagggcatg--ggt
A0A097I4T0_E1B19K-      ---------------------------gcacctgtggagggcatg--ggt
F8UFP5_E1B19K-01        ---------------------------gcacctgtggagggcctg--gat
T1UGT5_E1B19K-01        ---------------------------gcacctgtggagggcctg--ggt
G3CK71_E1B19K-01        ---------------------------gcacctgtggagggcctg--ggt
T1UGX3_E1B19K-01        ---------------------------gcacctgtggagggcctg--ggt
                                                   *    ** * *   * **  * *

A0A384ZUF2_E1B19K-      caagtgccatatgcacctgggagccagaaggggcaccttccagccgtacc
A0A384ZUM9_E1B19K-      caagtgccatatgcacctgggcgccagaaggggcacctttcagccgtacc
T1UG22_E1B19K-01        gagg------------------------------------cagcggggac
T1UGY3_E1B19K-01        gagg------------------------------------cagcggggac
T1UGU0_E1B19K-01        cagg------------------------------------cagcggggac
T1UK99_E1B19K-01        cagg------------------------------------cagcggggac
T1UKQ0_E1B19K-01        cagg------------------------------------cagcggggac
X4YVU5_E1B19K-01        cagg------------------------------------cagcggggac
A0A291B0H2_E1B19K-      cagg------------------------------------cagcggggac
T1UKV6_E1B19K-01        cagg------------------------------------cagcggggac
A0A0G2UY10_E1B19K-      cagg------------------------------------cagcggggac
A0A1J0MS84_E1B19K-      cagg------------------------------------cagcggggac
T1UKP8_E1B19K-01        cagg------------------------------------cagcggggac
T1UHQ8_E1B19K-01        cagg------------------------------------cagcggggac
A0A384ZUM9_E1B19K-      cagg------------------------------------cagcggggac
T1UHG3_E1B19K-01        cagg------------------------------------cagcggggac
A0A384ZUF2_E1B19K-      cagg------------------------------------cagcggggac
E1CIR1_E1B19K-01        cagg------------------------------------cagcggggac
X4Y9D2_E1B19K-01        cagg------------------------------------cagcggggac
T1UHH6_E1B19K-01        cagg------------------------------------cagcggggac
T1ULJ8_E1B19K-01        cagg------------------------------------cagcggggac
A0A075TSZ1_E1B19K-      cagg------------------------------------cagcggggac
T1ULP4_E1B19K-01        cagg------------------------------------cagcggggac
B6DU90_E1B19K-01        gagg------------------------------------cagcggggac
T1UHZ2_E1B19K-01        gagg------------------------------------cagcggggac
A0A097I4T0_E1B19K-      cagg------------------------------------cagcggggac
F8UFP5_E1B19K-01        cagg------------------------------------cagcggggac
T1UGT5_E1B19K-01        cagg------------------------------------cagcggggac
G3CK71_E1B19K-01        cagg------------------------------------cagcggggac
T1UGX3_E1B19K-01        cagg------------------------------------cagcggggac
                         * *                                    **** *   *

A0A384ZUF2_E1B19K-      agtgcaactttagccagaccaagctgctgttggagaacgatgccttctcc
A0A384ZUM9_E1B19K-      agtgcaactttagccagaccaagctgctgttggagaacgatgccttctcc
T1UG22_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UGY3_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UGU0_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UK99_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UKQ0_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
X4YVU5_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
A0A291B0H2_E1B19K-      agagaatcttgaacta-----------------------ctggcttctac
T1UKV6_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
A0A0G2UY10_E1B19K-      agagaatcttgaacta-----------------------ctggcttctac
A0A1J0MS84_E1B19K-      agagaatcttgaacta-----------------------ctggcttctac
T1UKP8_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UHQ8_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
A0A384ZUM9_E1B19K-      agagaatcttgagtta-----------------------ctggcttctac
T1UHG3_E1B19K-01        agagaatcttgaatta-----------------------ctggcttctac
A0A384ZUF2_E1B19K-      agagaatcttgaatta-----------------------ctggcttctac
E1CIR1_E1B19K-01        agagaatcttgaatta-----------------------ctggcttctac
X4Y9D2_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UHH6_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1ULJ8_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
A0A075TSZ1_E1B19K-      agagaatcttgaacta-----------------------ctggcttctac
T1ULP4_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
B6DU90_E1B19K-01        agagaatcttgaacta-----------------------ctggcttatac
T1UHZ2_E1B19K-01        agagaatcttgaacta-----------------------ctggcttatac
A0A097I4T0_E1B19K-      agagaatcttgaacta-----------------------ctggcttatac
F8UFP5_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UGT5_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
G3CK71_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
T1UGX3_E1B19K-01        agagaatcttgaacta-----------------------ctggcttctac
                        ** * * *** *   *                        ** *** * *

A0A384ZUF2_E1B19K-      agggtgaacctgaacggcatctttgacatggatgtctcggtgtacaagat
A0A384ZUM9_E1B19K-      agggtgaacctgaacggcatctttgacatggatgtctcggtgtacaagat
T1UG22_E1B19K-01        ag-----------ccagcagcttcg----ggtcttcttcatctacac---
T1UGY3_E1B19K-01        ag-----------ccagcagcttcg----ggtcttcttcatctacac---
T1UGU0_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UK99_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcatctacac---
T1UKQ0_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
X4YVU5_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
A0A291B0H2_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UKV6_E1B19K-01        ag-----------ccagcagttccg----ggtcttcttcgtctacac---
A0A0G2UY10_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
A0A1J0MS84_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UKP8_E1B19K-01        ag-----------ccagcagctcca----ggtcttcttcgtctacac---
T1UHQ8_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
A0A384ZUM9_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UHG3_E1B19K-01        ag-----------ccagcagctccg----ggtcttctttgtctacac---
A0A384ZUF2_E1B19K-      ag-----------ccagcagctccg----gttcttcttcgtctacac---
E1CIR1_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
X4Y9D2_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UHH6_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1ULJ8_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
A0A075TSZ1_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1ULP4_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
B6DU90_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UHZ2_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
A0A097I4T0_E1B19K-      ag-----------ccagcagctccg----ggtcttcttcgtctacac---
F8UFP5_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcatctacac---
T1UGT5_E1B19K-01        ag-----------ccagcagttccg----ggtcttcttcgtctacac---
G3CK71_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
T1UGX3_E1B19K-01        ag-----------ccagcagctccg----ggtcttcttcgtctacac---
                        **            * ***  *       *    ***   * ****    

A0A384ZUF2_E1B19K-      cctgagatacgatgagaccaa-gtccagggtgcgcgcttgcgagtgcggg
A0A384ZUM9_E1B19K-      cctgagatacgatgagaccaa-gtccagggtgcgcgcttgcgagtgcggg
T1UG22_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGY3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGU0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UK99_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UKQ0_E1B19K-01        --------------agacaaacatccatgtt----------------gga
X4YVU5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A291B0H2_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UKV6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A0G2UY10_E1B19K-      --------------agacaaacatccatgtt----------------gga
A0A1J0MS84_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UKP8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHQ8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A384ZUM9_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1UHG3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A384ZUF2_E1B19K-      --------------agacaaacatccatgtt----------------gga
E1CIR1_E1B19K-01        --------------agacaaacatccatgtt----------------gga
X4Y9D2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHH6_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1ULJ8_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A075TSZ1_E1B19K-      --------------agacaaacatccatgtt----------------gga
T1ULP4_E1B19K-01        --------------agacaaacatccatgtt----------------gga
B6DU90_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UHZ2_E1B19K-01        --------------agacaaacatccatgtt----------------gga
A0A097I4T0_E1B19K-      --------------agacaaacatccatgtt----------------gga
F8UFP5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGT5_E1B19K-01        --------------agacaaacatccatgtt----------------gga
G3CK71_E1B19K-01        --------------agacaaacatccatgtt----------------gga
T1UGX3_E1B19K-01        --------------agacaaacatccatgtt----------------gga
                                      **** **  **** * *                ** 

A0A384ZUF2_E1B19K-      ggcagacacaccaggatgcagccagtggccctggatgtga--ccgaggag
A0A384ZUM9_E1B19K-      ggcagacacaccaggatgcaaccggtggccctggatgtga--ccgaggag
T1UG22_E1B19K-01        ggaagaaat-----gaggga------ggccatggacaagaacccgaggag
T1UGY3_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
T1UGU0_E1B19K-01        ggaagagat-----gaggga------ggccatggacgagaacccgaggag
T1UK99_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
T1UKQ0_E1B19K-01        ggaagagat-----gaggga------ggccatggacgagaacccgaggag
X4YVU5_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
A0A291B0H2_E1B19K-      ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
T1UKV6_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
A0A0G2UY10_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
A0A1J0MS84_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1UKP8_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1UHQ8_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
A0A384ZUM9_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1UHG3_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
A0A384ZUF2_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
E1CIR1_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
X4Y9D2_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1UHH6_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1ULJ8_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
A0A075TSZ1_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1ULP4_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
B6DU90_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
T1UHZ2_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
A0A097I4T0_E1B19K-      ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
F8UFP5_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgacaacccgaggag
T1UGT5_E1B19K-01        ggaagaaat-----gaggga------ggccatggacgagaacccgaggag
G3CK71_E1B19K-01        ggaagaaat-----gaggca------ggccatgtacgagaacccgaggag
T1UGX3_E1B19K-01        ggaagaaat-----gaggca------ggccatggacgagaacccgaggag
                        ** *** *      ** * *      **** ** *    *  ********

A0A384ZUF2_E1B19K-      ctgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctc
A0A384ZUM9_E1B19K-      ctgcggcccgaccacctggtgatggcctgtaccgggaccgagttcagctc
T1UG22_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UGY3_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UGU0_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UK99_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UKQ0_E1B19K-01        c----------------------ggcctggacc--------------ctc
X4YVU5_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A291B0H2_E1B19K-      c----------------------ggcctggacc--------------ctc
T1UKV6_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A0G2UY10_E1B19K-      c----------------------ggcctggacc--------------ctc
A0A1J0MS84_E1B19K-      c----------------------ggcctggacc--------------ctc
T1UKP8_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UHQ8_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A384ZUM9_E1B19K-      c----------------------ggcctggacc--------------ctc
T1UHG3_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A384ZUF2_E1B19K-      c----------------------ggcctggacc--------------ctc
E1CIR1_E1B19K-01        c----------------------ggcctggacc--------------ctc
X4Y9D2_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UHH6_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1ULJ8_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A075TSZ1_E1B19K-      c----------------------ggcctggacc--------------ctc
T1ULP4_E1B19K-01        c----------------------ggcctggacc--------------ctc
B6DU90_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UHZ2_E1B19K-01        c----------------------ggcctggacc--------------ctc
A0A097I4T0_E1B19K-      c----------------------ggcctggacc--------------ctc
F8UFP5_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UGT5_E1B19K-01        c----------------------ggcctggacc--------------ctc
G3CK71_E1B19K-01        c----------------------ggcctggacc--------------ctc
T1UGX3_E1B19K-01        c----------------------ggcctggacc--------------ctc
                        *                      ****** ***              ***

A0A384ZUF2_E1B19K-      cagtgg-ggaggacacagattag
A0A384ZUM9_E1B19K-      cagtgg-ggaggacacagattag
T1UG22_E1B19K-01        cgtcggaagaggagctggattaa
T1UGY3_E1B19K-01        cgtcggaagaggagctggattaa
T1UGU0_E1B19K-01        cgtcggaagaggagctggattga
T1UK99_E1B19K-01        cgtcggaagaggagctggattga
T1UKQ0_E1B19K-01        cgtcggaagaggagctggattga
X4YVU5_E1B19K-01        cgtcggaagaggagctggattga
A0A291B0H2_E1B19K-      cgtcggaagaggagctggattga
T1UKV6_E1B19K-01        cgtcggaagaggagttggattga
A0A0G2UY10_E1B19K-      cgtcggaagaggagctggattga
A0A1J0MS84_E1B19K-      cgtcggaagaggagctggattga
T1UKP8_E1B19K-01        cgtcggaagaggagctggattga
T1UHQ8_E1B19K-01        cgtcggaagaggagctggattga
A0A384ZUM9_E1B19K-      cgtcggaagaggagctggattga
T1UHG3_E1B19K-01        cgtcggaagaggagctggattga
A0A384ZUF2_E1B19K-      cgtcggaagaggagctggattga
E1CIR1_E1B19K-01        cgtcggaagaggagctggattga
X4Y9D2_E1B19K-01        cgtcggaagaggagctggattga
T1UHH6_E1B19K-01        cgtcggaagaggagctggattga
T1ULJ8_E1B19K-01        cgtcggaagaggagctggattga
A0A075TSZ1_E1B19K-      cgtcggaagaggagctggattga
T1ULP4_E1B19K-01        cgtcggaagaggagctggattga
B6DU90_E1B19K-01        cgtcggaagaggagctggattga
T1UHZ2_E1B19K-01        cgtcggaagaggagctgaattga
A0A097I4T0_E1B19K-      cgccggaagaggagctggattga
F8UFP5_E1B19K-01        cgtcggaagaggagctggattga
T1UGT5_E1B19K-01        cgtcggaagaggagctggattga
G3CK71_E1B19K-01        cgtcggaagaggagctggattga
T1UGX3_E1B19K-01        cgtcggaagaggagctggattga
                        *   **  *****     ***  

© 1998-2019