Dataset for CDS E1B19K of organism Human mastadenovirus C

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0G2R248_E1B19K-      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
J9Z4N4_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgtt
E1ARN8_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
A0A291P1B2_E1B19K-      atggagacttgggagtgtttggaagatttttctgctgtgcgtaacttgct
T1UG63_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
J9Z5H0_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
J9Z4H6_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
A0A2H4PJ75_E1B19K-      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
J7I6T8_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
                        ****** ***************************************** *

A0A0G2R248_E1B19K-      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
J9Z4N4_E1B19K-01        ggaacagagctctaacagtacctcctggttttggaggtttctgtggggct
E1ARN8_E1B19K-01        ggaacagagctctaacagtacctcctggttttggaggtttctgtggggct
A0A291P1B2_E1B19K-      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
T1UG63_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
J9Z5H0_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
J9Z4H6_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
A0A2H4PJ75_E1B19K-      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
J7I6T8_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
                        ************************ *************************

A0A0G2R248_E1B19K-      catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
J9Z4N4_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
E1ARN8_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
A0A291P1B2_E1B19K-      cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
T1UG63_E1B19K-01        cctcccaggcaaagttagtttgcagaattaaggaggattacaagtgggaa
J9Z5H0_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
J9Z4H6_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
A0A2H4PJ75_E1B19K-      cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
J7I6T8_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
                        * ***************** ******************************

A0A0G2R248_E1B19K-      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
J9Z4N4_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
E1ARN8_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
A0A291P1B2_E1B19K-      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
T1UG63_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
J9Z5H0_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
J9Z4H6_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
A0A2H4PJ75_E1B19K-      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
J7I6T8_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
                        **************************************************

A0A0G2R248_E1B19K-      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
J9Z4N4_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
E1ARN8_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
A0A291P1B2_E1B19K-      gggtcaccaggcgcttttccaagagaaggtcattaagactttggattttt
T1UG63_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
J9Z5H0_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
J9Z4H6_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
A0A2H4PJ75_E1B19K-      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
J7I6T8_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
                        ********************************* ****************

A0A0G2R248_E1B19K-      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
J9Z4N4_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
E1ARN8_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
A0A291P1B2_E1B19K-      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
T1UG63_E1B19K-01        ccacaccggggcgcactgcggctgctgttgcttttttgagttttataaag
J9Z5H0_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
J9Z4H6_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
A0A2H4PJ75_E1B19K-      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
J7I6T8_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
                        ************** ***********************************

A0A0G2R248_E1B19K-      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
J9Z4N4_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
E1ARN8_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
A0A291P1B2_E1B19K-      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
T1UG63_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
J9Z5H0_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
J9Z4H6_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
A0A2H4PJ75_E1B19K-      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
J7I6T8_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
                        **************************************************

A0A0G2R248_E1B19K-      tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
J9Z4N4_E1B19K-01        tctggccatgcatttgtggagagcagtggtgagacacaagaatcgcctgc
E1ARN8_E1B19K-01        tctggccatgcatttgtggagagcggtggtgagacacaagaatcgcctac
A0A291P1B2_E1B19K-      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
T1UG63_E1B19K-01        tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
J9Z5H0_E1B19K-01        tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
J9Z4H6_E1B19K-01        tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
A0A2H4PJ75_E1B19K-      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
J7I6T8_E1B19K-01        tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
                        ************* ********** ** ******************** *

A0A0G2R248_E1B19K-      tactgttgtcttccgtccgcccggcgataataccgacggagg--------
J9Z4N4_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggagg--------
E1ARN8_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggagg---agcag
A0A291P1B2_E1B19K-      tactgttgtcttccgtccgcccggcaataataccgacggagg--------
T1UG63_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggagg---agcag
J9Z5H0_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggagg--------
J9Z4H6_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggaagagcagcag
A0A2H4PJ75_E1B19K-      tactgttgtcttccgtccgcccggcaataataccgacggagg--------
J7I6T8_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggagg------ag
                        ************************* ************** *        

A0A0G2R248_E1B19K-      ----agcagcagcagcagcaggaggaagcca------ggcggcggcggca
J9Z4N4_E1B19K-01        ----agcagcagcagcagcaggaggaagcca---ggcggcggcggcggca
E1ARN8_E1B19K-01        cagcagcaacagcagcagcaggaggaagcca---ggcggcggcggcggca
A0A291P1B2_E1B19K-      ----------agcaacagcaggaggaagcca---ggcggcggcggcggca
T1UG63_E1B19K-01        cagcagcagcagcagcagcaggaggaagccaggcggcggcggcggcggca
J9Z5H0_E1B19K-01        ----------agcaacagcaggaggaagcca---ggcggcggcggcggca
J9Z4H6_E1B19K-01        cagcagcagcagcagcagcaggaggaagcca---ggcggcggcggcggca
A0A2H4PJ75_E1B19K-      -agcagcagcagcagcagcaggaggaagcca---ggcggcggcggcggca
J7I6T8_E1B19K-01        cagcagcagcagcagcagcaggaggaagcca---ggcggcggcggcggca
                                  **** ****************      *************

A0A0G2R248_E1B19K-      ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
J9Z4N4_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
E1ARN8_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
A0A291P1B2_E1B19K-      ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
T1UG63_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
J9Z5H0_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
J9Z4H6_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
A0A2H4PJ75_E1B19K-      ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
J7I6T8_E1B19K-01        ggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
                        *************************************************

© 1998-2018