Dataset for CDS adenoviridae of organism Human mastadenovirus B

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

T1UJX4_E1B19K-01        atggaggtttgggccattttggaagaccttaggaagactaggcaactgtt
Q5UW22_E1B19K-01        atggaggtttgggccattttggaagaccttaggaagactaggcaactgtt
T1UE63_E1B19K-01        atggaggtttgggccattttggaagaccttaggaagactaggcaactgtt
J7I6W7_E1B19K-01        atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
A0A1L7NRH1_E1B19K-      atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
T1UFS4_E1B19K-01        atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
T2CI10_E1B19K-01        atggaggtttgggccatcttggaagatcttaggcagactaggcaactgct
A0A0K0PX35_E1B19K-      atggaggtttgggctatcttggaagaccttagacagactaggctactgct
A0A0K0PX99_E1B19K-      atggaggtttgggctatcttggaagaccttagacagactaggctactgct
T1UIP3_E1B19K-01        atggaggtttgggctatcttggaagacctgagacagactaggctactgct
J7I6Q4_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
J7I6S4_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
J7ID56_E1B19K-01        atggaggtttgggctatcttggaagacctcaaacagactaggctactgct
I6LEP5_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
I6LES1_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
T1UF50_E1B19K-01        atgaaggtttgggctatcttggaagacctcagacagactaggctactgct
                        *** ********** ** ******** ** *   ********* **** *

T1UJX4_E1B19K-01        ggagaacgcttcggacggagtctccggtttttggagattctggttcgcta
Q5UW22_E1B19K-01        agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
T1UE63_E1B19K-01        agagagcgcttcggacggagtctccggtttttggagattctggttcgcta
J7I6W7_E1B19K-01        agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
A0A1L7NRH1_E1B19K-      agaggacgcttcggacggagtctccggtttttggagattctggttcgcta
T1UFS4_E1B19K-01        agaggacgcttcggacggagtctccggtttttggagattctggttcgcta
T2CI10_E1B19K-01        agaaaacgcctcggacggagtctctggtctttggagattctggttcggtg
A0A0K0PX35_E1B19K-      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
A0A0K0PX99_E1B19K-      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
T1UIP3_E1B19K-01        agaaaacgcctcggacggagtctctggcttttggagattctggttcggtg
J7I6Q4_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
J7I6S4_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
J7ID56_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
I6LEP5_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
I6LES1_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
T1UF50_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
                         **   *** ************** **  ****************** * 

T1UJX4_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
Q5UW22_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaacaagaa
T1UE63_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaacaagaa
J7I6W7_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
A0A1L7NRH1_E1B19K-      gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
T1UFS4_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
T2CI10_E1B19K-01        gtgatctggctagactagtctttagaataaaacaggattacaggcaagaa
A0A0K0PX35_E1B19K-      gtgatctagctaggctagtctttaggataaaacaggactacagggaagaa
A0A0K0PX99_E1B19K-      gtgatctagctaggctagtctttaggataaaacaggactacagggaagaa
T1UIP3_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
J7I6Q4_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
J7I6S4_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
J7ID56_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
I6LEP5_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
I6LES1_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
T1UF50_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
                        ****  * *****  **** ***** *********** ** *    ****

T1UJX4_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
Q5UW22_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
T1UE63_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
J7I6W7_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
A0A1L7NRH1_E1B19K-      tttgaaaagttgttgctagattgcccaggactttttgaagctcttaattt
T1UFS4_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
T2CI10_E1B19K-01        tttgaaaagttattggacgactgtccaggactttttgaagctcttaactt
A0A0K0PX35_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
A0A0K0PX99_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
T1UIP3_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
J7I6Q4_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
J7I6S4_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
J7ID56_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
I6LEP5_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
I6LES1_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
T1UF50_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
                        *********** ***   **  * *********************** **

T1UJX4_E1B19K-01        gggccaccaggttcactttaaagaaaaagttttatcagttttagactttt
Q5UW22_E1B19K-01        gggccatcaggttcactttaaagaaaaagttttatcagttttagactttt
T1UE63_E1B19K-01        gggccatcaggttcactttaaagaaaaagttttatcagttttagactttt
J7I6W7_E1B19K-01        gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
A0A1L7NRH1_E1B19K-      gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
T1UFS4_E1B19K-01        gggccatcaagttcactttaaagaaaaagttttatcagttttagactttt
T2CI10_E1B19K-01        gggccaccaggctcattttaaggagaaggttttatcagttttggattttt
A0A0K0PX35_E1B19K-      gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
A0A0K0PX99_E1B19K-      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
T1UIP3_E1B19K-01        gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
J7I6Q4_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
J7I6S4_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
J7ID56_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
I6LEP5_E1B19K-01        gggtcatcgggctcattttaaggagaaggttttatcagttttagattttt
I6LES1_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
T1UF50_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
                        *** ** *  * *** ***** ** ** ************** ** ****

T1UJX4_E1B19K-01        caaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
Q5UW22_E1B19K-01        caaccccaggtagaactgctgctgctgtggcttttcttacttttatatta
T1UE63_E1B19K-01        caaccccaggtagaactgctgctgctgtggcttttcttacttttatatta
J7I6W7_E1B19K-01        cgaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
A0A1L7NRH1_E1B19K-      caaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
T1UFS4_E1B19K-01        caaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
T2CI10_E1B19K-01        ctacccctggtagaactgctgctgctgtagctttccttacattcatattt
A0A0K0PX35_E1B19K-      ctactcctggtagaactgctgctgctgtagcctttcttacttttatattg
A0A0K0PX99_E1B19K-      ctactcctggtagaactgctgctgctgtagcctttcttacttttatattg
T1UIP3_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
J7I6Q4_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
J7I6S4_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
J7ID56_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
I6LEP5_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
I6LES1_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
T1UF50_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
                        * ** ** *********** ******** ** ** ***** ** ***** 

T1UJX4_E1B19K-01        gacaaatggatcccgcagactcatttcagcaggggatacgttttggattt
Q5UW22_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
T1UE63_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
J7I6W7_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
A0A1L7NRH1_E1B19K-      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
T1UFS4_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
T2CI10_E1B19K-01        gataaatggatcccacagacccacttcagcaagggatacgttttggattt
A0A0K0PX35_E1B19K-      gataaatggatccgccaaacccacttcagcaagggatacgttttggattt
A0A0K0PX99_E1B19K-      gataaatggatccgccaaacccacttcagcaggggatacgttttggattt
T1UIP3_E1B19K-01        gataaatggatccgccaaacccacttcagcaagggatacgttttggattt
J7I6Q4_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
J7I6S4_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
J7ID56_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
I6LEP5_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
I6LES1_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
T1UF50_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
                        ** **********  ** ** ** ******* ******************

T1UJX4_E1B19K-01        catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
Q5UW22_E1B19K-01        catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
T1UE63_E1B19K-01        catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
J7I6W7_E1B19K-01        cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
A0A1L7NRH1_E1B19K-      catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
T1UFS4_E1B19K-01        cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
T2CI10_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
A0A0K0PX35_E1B19K-      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
A0A0K0PX99_E1B19K-      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
T1UIP3_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
J7I6Q4_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
J7I6S4_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
J7ID56_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
I6LEP5_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
I6LES1_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
T1UF50_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
                        * ****  **** ******************* ***** ***********

T1UJX4_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
Q5UW22_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
T1UE63_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
J7I6W7_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
A0A1L7NRH1_E1B19K-      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
T1UFS4_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
T2CI10_E1B19K-01        tcttagattactggccagtacagcctctgggcgtagcagggatcctgaga
A0A0K0PX35_E1B19K-      tcttagattactggccagtgcagcctctgggcgtagcagggatcctgaga
A0A0K0PX99_E1B19K-      tcttagattactggccagtgcagcctctgggcgtagcagggatcctgaga
T1UIP3_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
J7I6Q4_E1B19K-01        tcttagattactggccagtgcagcctctaggagtagcagggatactgaga
J7I6S4_E1B19K-01        tcttaaattactggccagtgcagcctctaggagtagcagggatactgaga
J7ID56_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
I6LEP5_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
I6LES1_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
T1UF50_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
                        *****  ************ ****** * ** ***** ** ** ***** 

T1UJX4_E1B19K-01        catccacctgtcatgccagcggttctggaggaggaacagcaagaggacaa
Q5UW22_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
T1UE63_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
J7I6W7_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
A0A1L7NRH1_E1B19K-      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
T1UFS4_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
T2CI10_E1B19K-01        cacccaccgaccatgccagcggttttggaggaggagcaccaagaggacaa
A0A0K0PX35_E1B19K-      cacccacctgccatgccatcggttctggaggaggagcagcaggaggacaa
A0A0K0PX99_E1B19K-      cacccaccggcaatgccagcggttctggaggaggagcagcaggaggacaa
T1UIP3_E1B19K-01        cacccaccggccatgccagcggttctggaggaggagcagcaggaggacaa
J7I6Q4_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
J7I6S4_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
J7ID56_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
I6LEP5_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
I6LES1_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
T1UF50_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
                        ** *****    ****** ***** ** ******* ** ** ********

T1UJX4_E1B19K-01        tccgagagccggcctggaccctccagtggagga---ggcggagtag
Q5UW22_E1B19K-01        cccgagagccggcctggaccctccagtggagga---ggcggagtag
T1UE63_E1B19K-01        cccgagagccggcctggaccctccagtggagga---ggcggagtag
J7I6W7_E1B19K-01        cccgagagccggcctggaccctccagtggagga---ggcggagtag
A0A1L7NRH1_E1B19K-      cccgagagccggcctggaccctccagtggagga---ggcggagtag
T1UFS4_E1B19K-01        cccgagagccggcctggaccctccagtggagga---ggcggagtag
T2CI10_E1B19K-01        tccgagagtcggcctggaccctccggtggaggaggcggaggagtag
A0A0K0PX35_E1B19K-      tccgagagccggcctggaccctccggtggaggaggcggaggagtag
A0A0K0PX99_E1B19K-      tccgagagccggcctggaccctccggtggaggaggcggaggagtag
T1UIP3_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
J7I6Q4_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
J7I6S4_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
J7ID56_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
I6LEP5_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
I6LES1_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
T1UF50_E1B19K-01        tccgagagccggcctggaccctccggt---------ggaggagtag
                         ******* *************** **         ** *******

© 1998-2018