Dataset for CDS E1B19K of organism Human adenovirus F serotype 41

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1S6ELT2_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
F4ZCJ8_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
B5SNR1_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
P10544_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
W0S1G8_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct

A0A1S6ELT2_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
F4ZCJ8_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
B5SNR1_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
P10544_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
W0S1G8_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt

A0A1S6ELT2_E1B19K-      caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
F4ZCJ8_E1B19K-01        caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
B5SNR1_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
P10544_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
W0S1G8_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
                        **************************** *********************

A0A1S6ELT2_E1B19K-      tttgctgagcttttgtcttttaaccctggaatatttgcatctttaaattt
F4ZCJ8_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
B5SNR1_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
P10544_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
W0S1G8_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
                        ******************************** *****************

A0A1S6ELT2_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
F4ZCJ8_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
B5SNR1_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
P10544_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
W0S1G8_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt

A0A1S6ELT2_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
F4ZCJ8_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
B5SNR1_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
P10544_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
W0S1G8_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg

A0A1S6ELT2_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
F4ZCJ8_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
B5SNR1_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggagggatatactctggatta
P10544_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggagggatatactctggatta
W0S1G8_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
                        *********************************** **************

A0A1S6ELT2_E1B19K-      catgacaatggctctgtggagaaccctgctgcggaggaagagggtcttag
F4ZCJ8_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
B5SNR1_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
P10544_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
W0S1G8_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
                        ************ *************************************

A0A1S6ELT2_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg---ggag
F4ZCJ8_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggag
B5SNR1_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg---ggag
P10544_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------
W0S1G8_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------

A0A1S6ELT2_E1B19K-      gaggaggaggaggaggaggagagggagaacctgagggccggtctggatcc
F4ZCJ8_E1B19K-01        gaggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
B5SNR1_E1B19K-01        gaggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
P10544_E1B19K-01        --ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
W0S1G8_E1B19K-01        --ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
                          *******************  ***************************

A0A1S6ELT2_E1B19K-      tcaaacggaattgtaa
F4ZCJ8_E1B19K-01        tcaaacggaattgtaa
B5SNR1_E1B19K-01        tcaaacggaattgtaa
P10544_E1B19K-01        tcaaacggaattgtaa
W0S1G8_E1B19K-01        tcaaacggaattgtaa

© 1998-2019