Dataset for CDS E1B19K of organism Human adenovirus E serotype 4

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2KSM8_E1B19K-02      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSG6_E1B19K-01      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSM8_E1B19K-01      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSG6_E1B19K-02      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
P10406_E1B19K-01      atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC7_E1B19K-01      atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC8_E1B19K-01      atggagatttggacggttttggaagactttcacaagactaggcagctgct
                      ***************** ************ *******************

Q2KSM8_E1B19K-02      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSG6_E1B19K-01      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSM8_E1B19K-01      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSG6_E1B19K-02      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
P10406_E1B19K-01      agagaacgcctcgaacggagtctctcacctgtggagattctgcttcggcg
Q5GFC7_E1B19K-01      agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q5GFC8_E1B19K-01      agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
                      ********************* *** ************* ******** *

Q2KSM8_E1B19K-02      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSG6_E1B19K-01      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSM8_E1B19K-01      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSG6_E1B19K-02      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
P10406_E1B19K-01      gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC7_E1B19K-01      gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC8_E1B19K-01      gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
                      * ************************ *************** *******

Q2KSM8_E1B19K-02      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSG6_E1B19K-01      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSM8_E1B19K-01      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSG6_E1B19K-02      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
P10406_E1B19K-01      tttgaggatattttgagagagtgtcctagtctttttgacgctcttaactt
Q5GFC7_E1B19K-01      tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q5GFC8_E1B19K-01      tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
                      ***** ******** * ********** **********************

Q2KSM8_E1B19K-02      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSG6_E1B19K-01      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSM8_E1B19K-01      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSG6_E1B19K-02      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
P10406_E1B19K-01      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC7_E1B19K-01      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC8_E1B19K-01      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
                      **************************************************

Q2KSM8_E1B19K-02      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSG6_E1B19K-01      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSM8_E1B19K-01      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSG6_E1B19K-02      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
P10406_E1B19K-01      ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC7_E1B19K-01      ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC8_E1B19K-01      ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
                      ******************************************** ** **

Q2KSM8_E1B19K-02      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-01      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSM8_E1B19K-01      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-02      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
P10406_E1B19K-01      gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-01      gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC8_E1B19K-01      gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
                      ****************************************** *******

Q2KSM8_E1B19K-02      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-01      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-01      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-02      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
P10406_E1B19K-01      cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-01      cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC8_E1B19K-01      cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
                      ********************** ***************************

Q2KSM8_E1B19K-02      tc-ccggctacttgccggtacagccgctag--------------------
Q2KSG6_E1B19K-01      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSM8_E1B19K-01      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSG6_E1B19K-02      tc----------tgccggtacagccgctag--------------------
P10406_E1B19K-01      tc-ccggctacttgccggtacagccgctag--------------------
Q5GFC7_E1B19K-01      tc-ccggctacttgccggtacagccgctag--------------------
Q5GFC8_E1B19K-01      tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
                      **          ******************                    

Q2KSM8_E1B19K-02      --------------------------------------------------
Q2KSG6_E1B19K-01      ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSM8_E1B19K-01      ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSG6_E1B19K-02      --------------------------------------------------
P10406_E1B19K-01      --------------------------------------------------
Q5GFC7_E1B19K-01      --------------------------------------------------
Q5GFC8_E1B19K-01      ctc---------------------------------cagcagcaggagga
                                                                        

Q2KSM8_E1B19K-02      --------------------------------------------------
Q2KSG6_E1B19K-01      tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg
Q2KSM8_E1B19K-01      tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSG6_E1B19K-02      --------------------------------------------------
P10406_E1B19K-01      --------------------------------------------------
Q5GFC7_E1B19K-01      --------------------------------------------------
Q5GFC8_E1B19K-01      tcaagaagagaatccgagagccggcctggaccctccggcggaggagtag-
                                                                        

Q2KSM8_E1B19K-02      -----
Q2KSG6_E1B19K-01      agtag
Q2KSM8_E1B19K-01      agtag
Q2KSG6_E1B19K-02      -----
P10406_E1B19K-01      -----
Q5GFC7_E1B19K-01      -----
Q5GFC8_E1B19K-01      -----
                           

© 1998-2018