Dataset for CDS E1B19K of organism Human adenovirus D37

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B2VQE3_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
B9A681_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt

B2VQE3_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
B9A681_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa

B2VQE3_E1B19K-01      ctcctctatctcgactggtgtacacagttaagaaggattataacgaggaa
B9A681_E1B19K-01      ctcctctatctcgactggtgtacacagttaagaaggattataacgaggaa

B2VQE3_E1B19K-01      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
B9A681_E1B19K-01      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct

B2VQE3_E1B19K-01      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt
B9A681_E1B19K-01      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt

B2VQE3_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
B9A681_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt

B2VQE3_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
B9A681_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt

B2VQE3_E1B19K-01      cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
B9A681_E1B19K-01      cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa

B2VQE3_E1B19K-01      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
B9A681_E1B19K-01      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta

B2VQE3_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
B9A681_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

B2VQE3_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
B9A681_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctgaattga
                      ******************************************* *****

© 1998-2019