Dataset for CDS E1B19K of organism Human adenovirus C serotype 5

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P03246_E1B19K-01      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
Q6VGV8_E1B19K-01      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
Q6WQ37_E1B19K-01      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct

P03246_E1B19K-01      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
Q6VGV8_E1B19K-01      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
Q6WQ37_E1B19K-01      ggaacagagctctaacagtacctcttggttctggaggtttctgtggggct
                      ****************************** *******************

P03246_E1B19K-01      catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
Q6VGV8_E1B19K-01      catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
Q6WQ37_E1B19K-01      catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa

P03246_E1B19K-01      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
Q6VGV8_E1B19K-01      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
Q6WQ37_E1B19K-01      ttcgaagagcttttgaagtcctgtggtgagctgtttgattctttgaatct
                      ** ************** ********************************

P03246_E1B19K-01      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
Q6VGV8_E1B19K-01      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
Q6WQ37_E1B19K-01      gggtcaccaggcgcttctccaagagaaggtcatcaagactttggattttt
                      **************** *********************************

P03246_E1B19K-01      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
Q6VGV8_E1B19K-01      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
Q6WQ37_E1B19K-01      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag

P03246_E1B19K-01      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
Q6VGV8_E1B19K-01      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
Q6WQ37_E1B19K-01      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt

P03246_E1B19K-01      tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
Q6VGV8_E1B19K-01      tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
Q6WQ37_E1B19K-01      tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc

P03246_E1B19K-01      tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcag
Q6VGV8_E1B19K-01      tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcag
Q6WQ37_E1B19K-01      tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcag

P03246_E1B19K-01      cagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaa
Q6VGV8_E1B19K-01      cagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaa
Q6WQ37_E1B19K-01      cagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaa

P03246_E1B19K-01      cccgagagccggcctggaccctcgggaatga
Q6VGV8_E1B19K-01      cccgagagccggcctggaccctcgggaatga
Q6WQ37_E1B19K-01      cccgagagccggcctggaccctcgggaatga

© 1998-2019