Dataset for CDS E1B19K of organism Human adenovirus C serotype 2

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U9ALK7_E1B19K-      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
P03247_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
                        **************************************************

A0A1U9ALK7_E1B19K-      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
P03247_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
                        **************************************************

A0A1U9ALK7_E1B19K-      cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
P03247_E1B19K-01        cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
                        **************************************************

A0A1U9ALK7_E1B19K-      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
P03247_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
                        **************************************************

A0A1U9ALK7_E1B19K-      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
P03247_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
                        **************************************************

A0A1U9ALK7_E1B19K-      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
P03247_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
                        **************************************************

A0A1U9ALK7_E1B19K-      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
P03247_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
                        **************************************************

A0A1U9ALK7_E1B19K-      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
P03247_E1B19K-01        tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
                        **************************************************

A0A1U9ALK7_E1B19K-      tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag
P03247_E1B19K-01        tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag
                        **************************************************

A0A1U9ALK7_E1B19K-      caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc
P03247_E1B19K-01        caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc
                        **************************************************

A0A1U9ALK7_E1B19K-      gagagccggcctggaccctcgggaatga
P03247_E1B19K-01        gagagccggcctggaccctcgggaatga
                        ****************************

© 1998-2018