Dataset for CDS E1B19K of organism Human adenovirus B serotype 7

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q5EY83_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactact
A0A220VZ73_E1B19K-      atggaggtttgggctatcttggaagacctcagacagactaggctactgct
I1V161_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
P03248_E1B19K-02        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
Q6RK98_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
                        *********************************************** **

Q5EY83_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
A0A220VZ73_E1B19K-      agaaaacgcctcggacggagtctctggcctttggagattctgcttcggtg
I1V161_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
P03248_E1B19K-02        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
Q6RK98_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
                        ****************************************** *******

Q5EY83_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
A0A220VZ73_E1B19K-      gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
I1V161_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
P03248_E1B19K-02        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
Q6RK98_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
                        ******************************************* * ****

Q5EY83_E1B19K-01        tttgaaaagttattggacgacattccaggactttttgaagctcttaactt
A0A220VZ73_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
I1V161_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
P03248_E1B19K-02        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
Q6RK98_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
                        ********************** ***************************

Q5EY83_E1B19K-01        gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
A0A220VZ73_E1B19K-      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
I1V161_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
P03248_E1B19K-02        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
Q6RK98_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
                        *** **********************************************

Q5EY83_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
A0A220VZ73_E1B19K-      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
I1V161_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
P03248_E1B19K-02        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
Q6RK98_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg

Q5EY83_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
A0A220VZ73_E1B19K-      gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
I1V161_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
P03248_E1B19K-02        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
Q6RK98_E1B19K-01        gataaatggatccgccaaactcacttcagcaagggatacgttttggattt

Q5EY83_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
A0A220VZ73_E1B19K-      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
I1V161_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
P03248_E1B19K-02        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
Q6RK98_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa

Q5EY83_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
A0A220VZ73_E1B19K-      tcttaaattactggccagtgcagcctctaggagtagcagggatactgaga
I1V161_E1B19K-01        tcttaaattactggccagtgcagcctctaggagtagcagggatactgaga
P03248_E1B19K-02        tcttagattactggccagtgcagcctctaggagtagcagggatactgaga
Q6RK98_E1B19K-01        tcttagattactggccagtgcagcctctaggagtagcagggatactgaga
                        ***** ********************** *********************

Q5EY83_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
A0A220VZ73_E1B19K-      cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
I1V161_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
P03248_E1B19K-02        cacccacctaccatgccagcggttctgcaggaggagcagcaggaggacaa
Q6RK98_E1B19K-01        cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
                        ******** *****************************************

Q5EY83_E1B19K-01        tccgagagccggcctggaccctccggtggaggagtag
A0A220VZ73_E1B19K-      tccgagagccggcctggaccctccggtggaggagtag
I1V161_E1B19K-01        tccgagagccggcctggaccctccggtggaggagtag
P03248_E1B19K-02        tccgagagccggcctggaccctccggtggaggagtag
Q6RK98_E1B19K-01        tccgagagccggcctggaccctccggtggaggagtag

© 1998-2019