Dataset for CDS adenoviridae of organism Human adenovirus B serotype 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q2KSL3_E1B19K-01      atggaggtttgggctatcttggaagacctcagacagactaggctactgct
Q2Y0J3_E1B19K-01      atggaggtttgggctatcttggaagacctcagacagactaagctactgct
                      **************************************** *********

Q2KSL3_E1B19K-01      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
Q2Y0J3_E1B19K-01      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg

Q2KSL3_E1B19K-01      gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
Q2Y0J3_E1B19K-01      gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa

Q2KSL3_E1B19K-01      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
Q2Y0J3_E1B19K-01      tttgaaaagttattggacgatagtccgggactttttgaagctcttaactt
                      ******************** ***** ***********************

Q2KSL3_E1B19K-01      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
Q2Y0J3_E1B19K-01      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt

Q2KSL3_E1B19K-01      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
Q2Y0J3_E1B19K-01      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg

Q2KSL3_E1B19K-01      gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
Q2Y0J3_E1B19K-01      gataaatggatccgccaaactcacttcagcaagggatacgttttggattt

Q2KSL3_E1B19K-01      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
Q2Y0J3_E1B19K-01      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa

Q2KSL3_E1B19K-01      tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
Q2Y0J3_E1B19K-01      tcttagattactggccagtgcagcctctgggagtagcagggatactgaga

Q2KSL3_E1B19K-01      cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
Q2Y0J3_E1B19K-01      cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa

Q2KSL3_E1B19K-01      tccgagagccggcctggaccctccggtggaggagtag
Q2Y0J3_E1B19K-01      tccgagagccggcctggaccctccggtggaggagtag

© 1998-2019