Dataset for CDS E1B19K of organism Human adenovirus B serotype 16

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2KRU2_E1B19K-01      atggaggtttgggctatcttggaagacctgagacagactaggctactgct
R4HLE1_E1B19K-01      atggaggtttgggctatcttggaagacctcaggcagactaggctactgct
                      ***************************** ** *****************

Q2KRU2_E1B19K-01      agaaaacgcctcggacggagtctctggcttttggagattctggttcggtg
R4HLE1_E1B19K-01      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
                      **************************** *********************

Q2KRU2_E1B19K-01      gcgatctagctaggctagtgtttaggataaaacaggactatagggaagaa
R4HLE1_E1B19K-01      gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
                      * ************************************** *********

Q2KRU2_E1B19K-01      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
R4HLE1_E1B19K-01      tttgaaaagttattggacaacagtccaggactttttgaagctcttaactt
                      ****************** *******************************

Q2KRU2_E1B19K-01      gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
R4HLE1_E1B19K-01      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
                      *** **********************************************

Q2KRU2_E1B19K-01      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
R4HLE1_E1B19K-01      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
                      **************************************************

Q2KRU2_E1B19K-01      gataaatggatccgccaaacccacttcagcaagggatacgttttggattt
R4HLE1_E1B19K-01      gataaatggatccgccaaactcacttcagcaagggatacgttttggattt
                      ******************** *****************************

Q2KRU2_E1B19K-01      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
R4HLE1_E1B19K-01      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
                      **************************************************

Q2KRU2_E1B19K-01      tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
R4HLE1_E1B19K-01      tcttagattactggccagtgcagcctctaggagtagcagggatattgaga
                      **************************** *************** *****

Q2KRU2_E1B19K-01      cacccaccggccatgccagcggttctggaggaggagcagcaggaggacaa
R4HLE1_E1B19K-01      cacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaa
                      ********* ***************** **********************

Q2KRU2_E1B19K-01      tccgagagccggcctggaccctccggtggaggagtag
R4HLE1_E1B19K-01      tccgagagccggcctggaccctccggtggaggagtag
                      *************************************

© 1998-2018