Dataset for CDS adenoviridae of organism Human adenovirus A serotype 12

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3G8WH01_E1B19K-      atggagttggaaactgtgctgcaaagttttcagagcgttcgccagctctt
P04492_E1B19K-01        atggagttggaaactgtgctgcaaagttttcagagcgttcgccagctctt
                        **************************************************

A0A3G8WH01_E1B19K-      gcagtatacctctaagaacacttcaggtttttggagatatctgtttggct
P04492_E1B19K-01        gcagtatacctctaaaaacacttcaggtttttggaggtatctgtttggct
                        *************** ******************** *************

A0A3G8WH01_E1B19K-      ctaccttaagcaaggtggtaaatagggtgaaagaagactatagagaggaa
P04492_E1B19K-01        ctaccttaagcaaggtggtaaatagggtgaaagaagactatagagaggaa
                        **************************************************

A0A3G8WH01_E1B19K-      tttgaaaacatattggccgactgtccagggcttttggcttcactagacct
P04492_E1B19K-01        tttgaaaacatattggccgactgtccagggcttttggcttcactagactt
                        ************************************************ *

A0A3G8WH01_E1B19K-      ttgtcaccacttggtgtttcaggaaaaagtggtcagatccttagattttt
P04492_E1B19K-01        gtgttaccacttggtgtttcaggaaaaagtggtcagatccttagattttt
                         *** *********************************************

A0A3G8WH01_E1B19K-      catctgtgggacgaacggttgcttctattgcttttttggcaaccatattg
P04492_E1B19K-01        catctgtgggacgaacggttgcttctattgcttttttggcaaccatattg
                        **************************************************

A0A3G8WH01_E1B19K-      gataaatggagcgagaaatcccacttgagttgggattacatgctggatta
P04492_E1B19K-01        gataaatggagcgagaaatcccacctgagttgggattacatgctggatta
                        ************************ *************************

A0A3G8WH01_E1B19K-      catgtcaatgcagctgtggagggcatggctgaagaggagggtttgcattt
P04492_E1B19K-01        catgtcaatgcagctgtggagggcatggctgaagaggagggtttgcattt
                        **************************************************

A0A3G8WH01_E1B19K-      actcgctggcgcggcctttgaccatgcccccgctgccgacgttgcaagag
P04492_E1B19K-01        actcgctggcgcggcctttgaccatgccgccgctgccgacgttgcaagag
                        **************************** *********************

A0A3G8WH01_E1B19K-      gagaaggaggaggagcggaaccctgcggtggtggagaagtaa
P04492_E1B19K-01        gagaaggaggaggagcggaaccctgcggtggtggagaagtaa
                        ******************************************

© 1998-2019