Dataset for CDS adenoviridae of organism Human adenovirus 55

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

C7SRS7_E1B19K-01      atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
J7H4R9_E1B19K-01      atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt

C7SRS7_E1B19K-01      agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
J7H4R9_E1B19K-01      agagaacgcttcggacggagtctccggtttttggagattctggttcgcta

C7SRS7_E1B19K-01      gtgaaatagctagggtagtttttaggataaaacaggactataaagaagaa
J7H4R9_E1B19K-01      gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
                      ***** ********************************************

C7SRS7_E1B19K-01      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
J7H4R9_E1B19K-01      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt

C7SRS7_E1B19K-01      gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
J7H4R9_E1B19K-01      gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt

C7SRS7_E1B19K-01      cgaccccaggtagaactgctgctgctgtggcttttcttacttttatatta
J7H4R9_E1B19K-01      cgaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
                      ******************* ******************************

C7SRS7_E1B19K-01      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
J7H4R9_E1B19K-01      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt

C7SRS7_E1B19K-01      cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
J7H4R9_E1B19K-01      cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa

C7SRS7_E1B19K-01      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
J7H4R9_E1B19K-01      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg

C7SRS7_E1B19K-01      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
J7H4R9_E1B19K-01      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa

C7SRS7_E1B19K-01      cccgagagccggcctggaccctccagtggaggaggcggagtag
J7H4R9_E1B19K-01      cccgagagccggcctggaccctccagtggaggaggcggagtag

© 1998-2019