Dataset for CDS E1B19K of organism Human adenovirus 53

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E5RWD9_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccgacttgt
E5RWL1_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccgacttgt

E5RWD9_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
E5RWL1_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa

E5RWD9_E1B19K-01      ctcctctatctcgtctggtgtacacagttaagaaggattataacgaggaa
E5RWL1_E1B19K-01      ctcctctatctcgtctggtgtacacagttaagaaggattataacgaggaa

E5RWD9_E1B19K-01      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
E5RWL1_E1B19K-01      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct

E5RWD9_E1B19K-01      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt
E5RWL1_E1B19K-01      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt

E5RWD9_E1B19K-01      ccagcccagggcgcactacagccggggttgcttgtgtggtttttctggtt
E5RWL1_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
                      ********************************* ****************

E5RWD9_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
E5RWL1_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt

E5RWD9_E1B19K-01      cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
E5RWL1_E1B19K-01      cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa

E5RWD9_E1B19K-01      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
E5RWL1_E1B19K-01      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta

E5RWD9_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
E5RWL1_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

E5RWD9_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
E5RWL1_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga

© 1998-2018