Dataset for CDS E1B19K of organism Human adenovirus 22

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

C5HDR2_E1B19K-01      atgactcatgggcggggcttagttctatataagtggcaacacctgggcac
D3GBW3_E1B19K-01      --------------------------------------------------

C5HDR2_E1B19K-01      ttgggcacagaccttcagggagttcctgatggatgtgtggactatccttg
D3GBW3_E1B19K-01      ----------------------------atggatgtgtggactatccttg

C5HDR2_E1B19K-01      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
D3GBW3_E1B19K-01      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc

C5HDR2_E1B19K-01      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
D3GBW3_E1B19K-01      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta

C5HDR2_E1B19K-01      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt
D3GBW3_E1B19K-01      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt

C5HDR2_E1B19K-01      gctctggcctactagattctctgaatctcggccaccagtcccttttccag
D3GBW3_E1B19K-01      gctctggcctactagattctctgaatctcggccaccagtcccttttccag

C5HDR2_E1B19K-01      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
D3GBW3_E1B19K-01      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc

C5HDR2_E1B19K-01      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
D3GBW3_E1B19K-01      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc

C5HDR2_E1B19K-01      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
D3GBW3_E1B19K-01      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg

C5HDR2_E1B19K-01      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca
D3GBW3_E1B19K-01      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca

C5HDR2_E1B19K-01      gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg
D3GBW3_E1B19K-01      gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg

C5HDR2_E1B19K-01      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
D3GBW3_E1B19K-01      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac

C5HDR2_E1B19K-01      cctccgtcggaagaggagctggattga
D3GBW3_E1B19K-01      cctccgtcggaagaggagctggattga

© 1998-2019