Dataset for CDS MCL-1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

135 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B6V6J0_MCL1-01          atgatg-----------------------caccagtcagtaattgccaag
F7ETY1_MCL1-01          atgatg-----------------------cgccagtcggtcattgccaag
J7H260_MCL1-01          atgggc--------------------------------------------
D2ITA0_MCL1-03          atgctg--------------------------------------------
D2ITA0_MCL1-04          atgctg--------------------------------------------
F8W4Q8_MCL1-02          at------------------------------------------------
Q8UWD6_MCL1-01          atgttc--------------------------------------gctgga
F8W4Q8_MCL1-01          atgttc--------------------------------------gctgga
Q568W5_MCL1-01          atgttc--------------------------------------gctgga
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          atgttt---------------------------------cctttgcaaaa
H2MLZ3_MCL1-02          atgttt---------------------------------cctttgcaaaa
Q0KFR9_MCL1-01          atgagy------------------------ctgtcgaactcgattacacg
A0A087X830_MCL1-01      atgac-------------------------------ggctaattcgacaa
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          atga--------------------------------gcctctcctcgctg
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      atgttt---------------------------------gcagtcaagcg
A0A1L1RNM6_MCL1-02      atgttt---------------------------------gcagtcaagcg
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ------------------------------------------------at
R4GAJ0_MCL1-01          atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          atgtta------------------------------ggccctttcaagaa
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          atgttt------------------------------ggcc---ccaaaag
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          atgttt------------------------------ggcc---ttcggag
P97287_MCL1-02          atgttt------------------------------ggcc---tgcggag
P97287_MCL1-01          atgttt------------------------------ggcc---tgcggag
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      atgttt------------------------------ggct---tccaa--
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          atgttt------------------------------agcc---tgagaag
G1T2Q0_MCL1-01          atgttt------------------------------agcc---tgagaag
A0A287DCH9_MCL1-01      atgttc------------------------------ggcc---ttaagag
A0A287DCH9_MCL1-02      atgttc------------------------------ggcc---ttaagag
G3T756_MCL1-01          atgttc------------------------------ggct---tcaagag
W5QI41_MCL1-01          -----g------------------------------ggag---ccggaaa
A5PJR2_MCL1-01          atgttc------------------------------ggcc---tcaagag
F1MQX4_MCL1-01          -tgtc---------------------------------------------
A0A1S3F3I1_MCL1-01      atgttt------------------------------ggcc---tcagaag
J9PBC4_MCL1-01          atgttc------------------------------ggcc---tcaagag
J9PBC4_MCL1-02          atgttc------------------------------ggcc---tcaagag
Q8HYS5_MCL1-01          atgttt------------------------------ggcc---tcaagag
M3XAP4_MCL1-02          atgttt------------------------------ggcc---tcaagag
Q7YRZ9_MCL1-01          atgttt------------------------------ggcc---tcaagag
M3XAP4_MCL1-01          atgttt------------------------------ggcc---tcaagag
M3XAP4_MCL1-03          atgttt------------------------------ggcc---tcaagag
F7AVA6_MCL1-01          atgttt------------------------------ggcc---tgaaaag
G1L3M8_MCL1-01          atgttt------------------------------ggcc---tcaaaag
G1L3M8_MCL1-02          atgttt------------------------------ggcc---tcaaaag
M3XZZ5_MCL1-01          atgttt------------------------------ggcc---tcaaaag
Q95KR3_MCL1-01          atgttt------------------------------ggcc---tccagag
K9IWB2_MCL1-02          atgttt------------------------------ggcc---tccagag
K9IWB2_MCL1-01          atgttt------------------------------ggcc---tccagag
K9IWB2_MCL1-03          atgttt------------------------------ggcc---tccagag
A0A2K5C7L5_MCL1-01      atgttt------------------------------ggcc---tccaaag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          atgttt------------------------------ggcc---tcaagag
A0A2K6GI15_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2K6GI15_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2K6GI15_MCL1-03      atgttt------------------------------ggcc---tcaaaag
H2N5Y9_MCL1-01          atgttc------------------------------ggcc---tcaaaag
A0A2K5I9Q7_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2K5I9Q7_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2K5I9Q7_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A2K6KRW9_MCL1-02      atgttt------------------------------ggct---tcaaaag
A0A2K6PPL1_MCL1-02      atgttt------------------------------ggct---tcaaaag
A0A2K6KRW9_MCL1-01      atgttt------------------------------ggct---tcaaaag
A0A2K6PPL1_MCL1-01      atgttt------------------------------ggct---tcaaaag
A0A2K6KRW9_MCL1-03      atgttt------------------------------ggct---tcaaaag
A0A2K6PPL1_MCL1-03      atgttt------------------------------ggct---tcaaaag
A0A2I3GB35_MCL1-01      atgttt------------------------------ggcc---tcagaag
A0A2I3GB35_MCL1-02      atgttt------------------------------ggcc---tcagaag
A0A2I3GB35_MCL1-03      atgttt------------------------------ggcc---tcagaag
A0A2K5LXU8_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2K5XSC7_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2K5W0W9_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2K6ECR0_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2I3M3D6_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2K5LXU8_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2K5LXU8_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A0D9RZP5_MCL1-01      atgttt------------------------------ggcc---tcaaaag
I7G687_MCL1-01          atgttt------------------------------ggcc---tcaaaag
A0A2K5W0W9_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2K5W0W9_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A2K6ECR0_MCL1-01      atgttt------------------------------ggcc---tcaaaag
F7HUE9_MCL1-02          atgttt------------------------------ggcc---tcaaaag
A0A2K6ECR0_MCL1-03      atgttt------------------------------ggcc---tcaaaag
F7HUE9_MCL1-01          atgttt------------------------------ggcc---tcaaaag
A0A2K5XSC7_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A2K5XSC7_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2I3M3D6_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A2I3M3D6_MCL1-02      atgttt------------------------------ggcc---tcaaaag
G2HFR3_MCL1-01          at------------------------------------------------
C8YZ26_MCL1-01          atgttt------------------------------ggcc---tcaaaag
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      atgttt------------------------------ggcc---tcaaaag
A0A2I2YQH7_MCL1-03      atgttt------------------------------ggcc---tcaaaag
A0A2I2YQH7_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2R9BYH6_MCL1-02      atgttt------------------------------ggcc---tcaaaag
K7DE58_MCL1-02          atgttt------------------------------ggcc---tcaaaag
Q07820_MCL1-03          atgttt------------------------------ggcc---tcaaaag
K7DE58_MCL1-01          atgttt------------------------------ggcc---tcaaaag
A0A2R9BYH6_MCL1-01      atgttt------------------------------ggcc---tcaaaag
A0A2R9BYH6_MCL1-03      atgttt------------------------------ggcc---tcaaaag
K7DE58_MCL1-03          atgttt------------------------------ggcc---tcaaaag
B4DU51_MCL1-01          atgttt------------------------------ggcc---tcaaaag
Q07820_MCL1-04          atgttt------------------------------ggcc---tcaaaag
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          atgttt------------------------------ggcc---tcaaaag
Q07820_MCL1-01          atgttt------------------------------ggcc---tcaaaag
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      atgttc------------------------------ggcc---tccaaag
A0A2K6V5Y3_MCL1-03      atgttc------------------------------ggcc---tccaaag
A0A2K6V5Y3_MCL1-01      atgttc------------------------------ggcc---tccaaag
A0A2K5CFH3_MCL1-03      atgttt------------------------------ggcc---tccaaag
A0A2K5CFH3_MCL1-02      atgttt------------------------------ggcc---tccaaag
A0A2K5CFH3_MCL1-01      atgttt------------------------------ggcc---tccaaag
F7GTF7_MCL1-01          atgttt------------------------------ggcc---tccaaag
F7GTF7_MCL1-02          atgttt------------------------------ggcc---tccaaag
F7GTF7_MCL1-03          atgttt------------------------------ggcc---tccaaag
I3JHR5_MCL1-01          atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagact-
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          atgagcgttat------cgcgaaccgcaccgcgatagacaccatgaatg-
G3PJT0_MCL1-01          atgaatataattcagagaccgaaactggccgcgttaaac---atgaccgg
A0A2U9CJ81_MCL1-01      atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccgg
                                                                          

B6V6J0_MCL1-01          cagcgcccctcgactagtttcctcattcc--ctgccagttttactgctcg
F7ETY1_MCL1-01          cagcgtacctctgcgggcttcctcatccc--ctgccagttctactgctcg
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          -----------tcacagaaactaacttcaaactacggaaccagcttagtc
D2ITA0_MCL1-04          -----------tcacagaaactaacttcaaactacggaaccagcttagtc
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          agaaacaacgacaacggcttttggccatgcactggattacaaagcaaacc
F8W4Q8_MCL1-01          agaaacaacgacaacggcttttggccatgcactggattacaaagcaaacc
Q568W5_MCL1-01          agaaacaacgacaacggcttttggccatgcactggattacaaagcaaacc
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------atggctctgagtttggattttaggcgaacggccacg
Q9I9N3_MCL1-01          --------------atggctctgagtttggattttaggcgaacggccacg
H2MLZ3_MCL1-01          acagatggttaacagctacatcacgtctaa-ctgtggatttacgggacac
H2MLZ3_MCL1-02          acagatggttaacagctacatcacgtctaa-ctgtggatttacgggacac
Q0KFR9_MCL1-01          agccacaactac-gatgttgcattttcaaaatggaggatcttcgtaccta
A0A087X830_MCL1-01      ccgcattaaactatctaattttttctcaaaatggagtcggggatggacaa
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          aagcgca----------cctcggccagcg--ccgtgatacagctctattg
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gaacgccgtcat--cggcttcaacctcta---------------------
A0A1L1RNM6_MCL1-02      gaacgccgtcat--cggcttcaacctcta---------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ggccccgaacac-gccggcctcacctggagccggcggaggcgtcggagaa
R4GAJ0_MCL1-01          ggccccgaacac-gccggcctcacctggagccggcggaggcgtcggagaa
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          gaacgccgtcat--cggcctcaaccttta--ctgtggcggggcagggatg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          aaatgcattcat--cggactcaacctcca--ctgcgggggggcag--ttg
G1PZ39_MCL1-01          ----------------gccccgccctctc--ccat---------------
Q9Z1P3_MCL1-01          aaacgcggtaat--cggcttgaacctgta--ctgcggcggcgctagcctc
P97287_MCL1-02          aaacgcggtcat--cggcttgaacctgta--ctgcggc------------
P97287_MCL1-01          aaacgcggtcat--cggcttgaacctgta--ctgcggcggcgccagcctc
A0A2K6F6N9_MCL1-01      ---------gat-------------------ctgtggattaacc----tg
A0A2K5DMS4_MCL1-01      ----gtggtaat--cagactcaacctcta--ct-----------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          aaacgcggtaat--cggactcaacctcta--cttgggggggcccgggttg
G1T2Q0_MCL1-01          aaacgcggtaat--cggactcaacctcta--cttgggggggcccgggttg
A0A287DCH9_MCL1-01      gaacgcggtcat--cggactcaacctcta--ctgcgggggcgccgggctg
A0A287DCH9_MCL1-02      gaacgcggtcat--cggactcaacctcta--ctgcggg------------
G3T756_MCL1-01          aaacgcagtaat--cggactcaaccttta--ctgtgggggggccggcttg
W5QI41_MCL1-01          ccccgccctgcc-ccaggccccgcccctg--ccttgaccccgccggttag
A5PJR2_MCL1-01          aaacgcagtaat--cggactaaacctcta--ttgtgggggagccggatta
F1MQX4_MCL1-01          ---------------------aacct------------------------
A0A1S3F3I1_MCL1-01      aaacgcggtaat--cggactcaacttcta--ctgtgggggcgccgggctg
J9PBC4_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggctg
J9PBC4_MCL1-02          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggctg
Q8HYS5_MCL1-01          aaacgcagtaat-ccggactcaa-ctcta--ctgtgggggggccgggctg
M3XAP4_MCL1-02          aaacgctgtaat--cggactcaacctcta--ctgtgggggggccgggttg
Q7YRZ9_MCL1-01          aaacgctgtaat--cggactcaacctcta--ctgtgggggggccgggttg
M3XAP4_MCL1-01          aaacgctgtaat--cggactcaacctcta--ctgtgggggggccgggttg
M3XAP4_MCL1-03          aaacgctgtaat--cggactcaacctcta--ctgtgggggggccgggttg
F7AVA6_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggttg
G1L3M8_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggttg
G1L3M8_MCL1-02          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggttg
M3XZZ5_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccgggctg
Q95KR3_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccggattg
K9IWB2_MCL1-02          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccggattg
K9IWB2_MCL1-01          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccggattg
K9IWB2_MCL1-03          aaacgcagtaat--cggactcaacctcta--ctgtgggggggccggattg
A0A2K5C7L5_MCL1-01      aaacgcgctaat--cggactcaacctcta--ctgtgagtgggccggcttg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          aaacgcagtgat--cggactcaacctcta--ctgtgggggcgccgggctg
A0A2K6GI15_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggattg
A0A2K6GI15_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggattg
A0A2K6GI15_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggattg
H2N5Y9_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5I9Q7_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5I9Q7_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5I9Q7_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6KRW9_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6PPL1_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6KRW9_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6PPL1_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6KRW9_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6PPL1_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3GB35_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3GB35_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3GB35_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5LXU8_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5XSC7_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5W0W9_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgcgggggggccggcttg
A0A2K6ECR0_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3M3D6_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5LXU8_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5LXU8_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A0D9RZP5_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
I7G687_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5W0W9_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgcgggggggccggcttg
A0A2K5W0W9_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgcgggggggccggcttg
A0A2K6ECR0_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
F7HUE9_MCL1-02          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6ECR0_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
F7HUE9_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5XSC7_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5XSC7_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3M3D6_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I3M3D6_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
G2HFR3_MCL1-01          ---------------ggac--------------------------atttg
C8YZ26_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I2YQH7_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2I2YQH7_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2R9BYH6_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
K7DE58_MCL1-02          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
Q07820_MCL1-03          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
K7DE58_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2R9BYH6_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2R9BYH6_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
K7DE58_MCL1-03          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
B4DU51_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
Q07820_MCL1-04          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
Q07820_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6V5Y3_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K6V5Y3_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5CFH3_MCL1-03      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5CFH3_MCL1-02      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
A0A2K5CFH3_MCL1-01      aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
F7GTF7_MCL1-01          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
F7GTF7_MCL1-02          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
F7GTF7_MCL1-03          aaacgcggtaat--cggactcaacctcta--ctgtgggggggccggcttg
I3JHR5_MCL1-01          ---------------atcttcttcctcaaaatggagtcctggagggacca
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ------------------ttatgtttcaaaatggagtcggg---------
G3PJT0_MCL1-01          agtcatgagctg-cattattctccctcaaaatggagtcgcg---------
A0A2U9CJ81_MCL1-01      agtcatgggctg-cctcattcttcctcaaaatggagtcgtggagggagcg
                                                                          

B6V6J0_MCL1-01          ggcggcgg------------------------------------------
F7ETY1_MCL1-01          ggtggcggcggcg-------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          cagacctgctggt-------------------------------------
D2ITA0_MCL1-04          cagacctgctggt-------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          actggtt-------------------------------------------
F8W4Q8_MCL1-01          actggtt-------------------------------------------
Q568W5_MCL1-01          actggtt-------------------------------------------
Q568V1_MCL1-01          atgagc--------------------------------------------
Q1L8X3_MCL1-01          atgagc--------------------------------------------
Q9I9N3_MCL1-01          atgagc--------------------------------------------
H2MLZ3_MCL1-01          atcctcggcagcagagcgggaga---------------------------
H2MLZ3_MCL1-02          atcctcggcagcagagcgggaga---------------------------
Q0KFR9_MCL1-01          gctgatgatgcta-------------------------------------
A0A087X830_MCL1-01      acacactacgacc-------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          agtagcggcgggaataataacgac--------------ggcggcggcgtc
R4GAJ0_MCL1-01          agtagcggcgggaataataacgac--------------ggcggcggcgtc
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          ggcgccggcggcggcgccagcggt----cccccgtccggcgggcgcctgc
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ggggcctgtggcggcagcgaagcctacatctccttcaggaaggaggtccc
G1PZ39_MCL1-01          --------tagcg-------------------------------------
Q9Z1P3_MCL1-01          ggcgcgggcggcg----------------gctctccggccgggacgcgcc
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          ggcgcgggcggcg----------------gttctccggcaggggcgcgcc
A0A2K6F6N9_MCL1-01      gggatcagctgcg-------------------------------------
A0A2K5DMS4_MCL1-01      ----------------gcggtgcc----atccctccaggaccgcggcttt
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          ggagccggtggcg---gcggcgtc----gcccctccggcagagcggcttt
G1T2Q0_MCL1-01          ggagccggtggcg---gcggcgtc----gcccctccggcagagcggcttt
A0A287DCH9_MCL1-01      ggggccagcggcg------gcgcc----accccgccgggagcgcagctct
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          ggggccggcggct------gcgcc----acccctccgggagggcgacttc
W5QI41_MCL1-01          g-------------------------------------------------
A5PJR2_MCL1-01          ggacagggcagcg------gcgcc----tcctctccgggggggcggcttt
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      ggcgccggcagcg---gggccgcc----gccgcgccgggagggcggctct
J9PBC4_MCL1-01          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
J9PBC4_MCL1-02          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
Q8HYS5_MCL1-01          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
M3XAP4_MCL1-02          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
Q7YRZ9_MCL1-01          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
M3XAP4_MCL1-01          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
M3XAP4_MCL1-03          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
F7AVA6_MCL1-01          ggggccggcggcg---gcggcgcc----tcgtcgccgggagggcggcttt
G1L3M8_MCL1-01          ggggccggcagcggcgggggggna----t------cgggagggcggcttt
G1L3M8_MCL1-02          ggggccggcagcggcgggggggna----t------cgggagggcggcttt
M3XZZ5_MCL1-01          ggggccggcaccg---ggggcgcc----tcctcttcgggagggcggcttt
Q95KR3_MCL1-01          gggcctggaagcggcagcagc-----------------------------
K9IWB2_MCL1-02          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
K9IWB2_MCL1-01          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
K9IWB2_MCL1-03          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
A0A2K5C7L5_MCL1-01      gggactggcagtg---gcggcacc----acccctccgggagggcggcttt
A0A2K5EPY9_MCL1-01      ------------------aatgcc----tcatgttccagac---------
A0A2K5EPY9_MCL1-02      ------------------ag---------------ccagag---------
H0XFB7_MCL1-01          ggggctggcagcg---gcggcgcc----acacccccgggagggcggcttt
A0A2K6GI15_MCL1-01      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
A0A2K6GI15_MCL1-02      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
A0A2K6GI15_MCL1-03      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
H2N5Y9_MCL1-01          ggtgctggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-03      ggggccggcagcg---gc--------------------------------
A0A2K5LXU8_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5LXU8_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5LXU8_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A0D9RZP5_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
I7G687_MCL1-01          ggggccggcagca---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7HUE9_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7HUE9_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
G2HFR3_MCL1-01          ccggctctcagca---gcaatgc-------------------gtgaattt
C8YZ26_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2I2YQH7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2I2YQH7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
K7DE58_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
Q07820_MCL1-03          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
K7DE58_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
K7DE58_MCL1-03          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
B4DU51_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
Q07820_MCL1-04          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
Q07820_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K6V5Y3_MCL1-03      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K6V5Y3_MCL1-01      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K5CFH3_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5CFH3_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5CFH3_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-03          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
I3JHR5_MCL1-01          atgcactatggatcggggaaatcc--------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ---------gacgcggatctttct--------------------------
G3PJT0_MCL1-01          ---------------------ccc--------------------------
A0A2U9CJ81_MCL1-01      atgcactacggctcaggaaattcc--------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          tcggttc-------------------------------------------
R4GAJ0_MCL1-01          tcggttc-------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          tagcttctggcaaaggccctacggttgagagtactccgccgcagcgcgat
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          tgcc-----------------------------------cccaagagtca
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          tggcggccg---aggaggccaagg---------------cgcggcgcgag
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          tggtggccg---aggaggccaagg---------------cgcggcgcgag
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      t-------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          tggctgcggagaaggaggccgcgg---------------cccggctagag
G1T2Q0_MCL1-01          tggctgcggagaaggaggccgcgg---------------cccggctagag
A0A287DCH9_MCL1-01      tagccgccgagaaggaggccgcgg---------------cccggcgagag
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          cagctcctggaaaggaggccacgg---------------cccggcaagag
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          tggctgcggggaaggaggccacgg---------------cgcggcgagag
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      tg---acggcggaggaggccagtg---------------cccggcgggag
J9PBC4_MCL1-01          tggcttcggggaaggaggccacga---------------ccagacgggag
J9PBC4_MCL1-02          tggcttcggggaaggaggccacga---------------ccagacgggag
Q8HYS5_MCL1-01          tggcttcggggagggaggccacga---------------ccagacgggag
M3XAP4_MCL1-02          tggctgtggggaaggaggccacgg---------------ccaggcgagag
Q7YRZ9_MCL1-01          tggctgtggggaaggaggccacgg---------------ccaggcgagag
M3XAP4_MCL1-01          tggctgtggggaaggaggccacgg---------------ccaggcgagag
M3XAP4_MCL1-03          t-------------------------------------------------
F7AVA6_MCL1-01          tggctgcggggaaggaggccacgg---------------cccggcgagag
G1L3M8_MCL1-01          tggcttcggggaaggaggccacgg---------------cccggagggag
G1L3M8_MCL1-02          tggcttcggggaaggaggccacgg---------------cccggagggag
M3XZZ5_MCL1-01          tggcttcggggaaggaggccacgg---------------cccggcgggag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          tggctacgggaaaagaggccacgg---------------cccggcaagag
K9IWB2_MCL1-01          tggctacgggaaaagaggccacgg---------------cccggcaagag
K9IWB2_MCL1-03          tggctacgggaaaagaggccacgg---------------cccggcaagag
A0A2K5C7L5_MCL1-01      tggccacggagaaggaggcctcgg---------------cccagcgagag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          tggctgcggagaaggaggccgcgg---------------cccggcgagag
A0A2K6GI15_MCL1-01      tggctgccgagaaggaggccacgg---------------cccggcgagag
A0A2K6GI15_MCL1-02      tggctgccgagaaggaggccacgg---------------cccggcgagag
A0A2K6GI15_MCL1-03      t-------------------------------------------------
H2N5Y9_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-03      t-------------------------------------------------
A0A2K6KRW9_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6PPL1_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6KRW9_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6PPL1_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6KRW9_MCL1-03      t-------------------------------------------------
A0A2K6PPL1_MCL1-03      t-------------------------------------------------
A0A2I3GB35_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3GB35_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5XSC7_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6ECR0_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3M3D6_MCL1-01      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5LXU8_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5LXU8_MCL1-03      t-------------------------------------------------
A0A0D9RZP5_MCL1-01      tggctacggagaaggaggcctcgg---------------ctcggcgagag
I7G687_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-03      t-------------------------------------------------
A0A2K6ECR0_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
F7HUE9_MCL1-02          t-------------------------------------------------
A0A2K6ECR0_MCL1-03      t-------------------------------------------------
F7HUE9_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5XSC7_MCL1-03      t-------------------------------------------------
A0A2K5XSC7_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3M3D6_MCL1-03      ta------------------------------------------------
A0A2I3M3D6_MCL1-02      tagctacggagaaggaggcctcgg---------------cccggcgagag
G2HFR3_MCL1-01          ta------------------------------------------------
C8YZ26_MCL1-01          t-------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I2YQH7_MCL1-03      ta------------------------------------------------
A0A2I2YQH7_MCL1-01      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
K7DE58_MCL1-02          tggctacggagaaggaggcctcgg---------------cccggcgagag
Q07820_MCL1-03          tggctacggagaaggaggcctcgg---------------cccggcgagag
K7DE58_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-03      t-------------------------------------------------
K7DE58_MCL1-03          t-------------------------------------------------
B4DU51_MCL1-01          tggctacggag---------------------------------------
Q07820_MCL1-04          t-------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
Q07820_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      tggccgcggagaaggaggcctcgg---------------cccagcgagag
A0A2K6V5Y3_MCL1-03      t-------------------------------------------------
A0A2K6V5Y3_MCL1-01      tggccgcggagaaggaggcctcgg---------------cccagcgagag
A0A2K5CFH3_MCL1-03      tggccacggagaaggaggcctcgg---------------cccagcgagag
A0A2K5CFH3_MCL1-02      t-------------------------------------------------
A0A2K5CFH3_MCL1-01      tggccacggagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-01          tggccacagagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-02          tggccacagagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-03          t-------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      -----------------------------------------ctgcggcgg
A0A1L1RNM6_MCL1-02      -----------------------------------------ctgcggcgg
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------cgaagg
R4GAJ0_MCL1-01          --------------------------------------------cgaagg
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          ggaggggaagtggaaacagggacggcgggggcagggttgattggcggagg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ggggcggggagggaaacgggcacgg------------tgattggctggag
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          gggggaggggagg-------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          gggggaggggagg-------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          gtagggggaggggaggccggcgcgg------------tgattggcggaag
G1T2Q0_MCL1-01          gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A287DCH9_MCL1-01      gcagggggaggggaagccg-------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          gtagggggagggga------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          gtagggggaggggaagccggcacgg------------tgattggcggaag
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      gcggggggaggggaagccggcgcgg------------ggattggcggaag
J9PBC4_MCL1-01          ggagggggaggggaagccggtgcgg------------tgattggcggaag
J9PBC4_MCL1-02          ggagggggaggggaagccggtgcgg------------tgattggcggaag
Q8HYS5_MCL1-01          ggagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-02          gtagggggaggggaagccggtgcgg------------tgattggcggaag
Q7YRZ9_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ggagggggaggggaggccggcgcgg------------tgattggcggaag
G1L3M8_MCL1-01          atagggggaggggaagccggtgcgg------------tgattggcggaag
G1L3M8_MCL1-02          atagggggaggggaagccggtgcgg------------tgattggcggaag
M3XZZ5_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gtagggggaggggaagccggcatgg------------tgattggcggaag
K9IWB2_MCL1-01          gtagggggaggggaagccggcatgg------------tgattggcggaag
K9IWB2_MCL1-03          gtagggggaggggaagccggcatgg------------tgattggcggaag
A0A2K5C7L5_MCL1-01      gtagggggaggggaggccggcgtgg------------tgattggcggaag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gcagggggaggggaagccggcgagg------------tgattggcggaag
A0A2K6GI15_MCL1-01      gtagggggaggggaagacggcacgg------------tgattggcggaag
A0A2K6GI15_MCL1-02      gtagggggaggggaagacggcacgg------------tgattggcggaag
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6PPL1_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6KRW9_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6PPL1_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I3GB35_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5XSC7_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K6ECR0_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2I3M3D6_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaac
A0A2K5LXU8_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
I7G687_MCL1-01          atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaac
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
K7DE58_MCL1-02          atagggggaggggaggccggcgcgg------------tgattggcggaag
Q07820_MCL1-03          atagggggaggggaggccggcgcgg------------tgattggcggaag
K7DE58_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
Q07820_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5CFH3_MCL1-03      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gtagggggaggggaggccggcgcgg------------tgattggcggaag
F7GTF7_MCL1-01          gtagggggaggggaggccggcgcgg------------tgactggcggaag
F7GTF7_MCL1-02          gtagggggaggggaggccggcgcgg------------tgactggcggaag
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      aggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccccgc
A0A1L1RNM6_MCL1-02      aggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccccgc
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          cctcaggtcttttctcagagaggccgcgccctctgattggcggggggcct
R4GAJ0_MCL1-01          cctcaggtcttttctcagagaggccgcgccctctgattggcggggggcct
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          aatccgtgcgagtcctccgaatcctgtctcgccgggcgcccggggggtcg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          cgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcg
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------ccgctctgctgcccggcgcgcgggtggtcg
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------ccgccctgctgcccggcgcgcgggtggtcg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcg
G1T2Q0_MCL1-01          cccgggcgct----------------------------------------
A0A287DCH9_MCL1-01      -----------------------cccagccgcccagcgcccgcagggtcg
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          cgccggcgcgagccccccggccgctgtcgctccggacggccggagggtcg
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcg
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      cgccggcgcgagcccctcgaccaccctggcgccggacgcccggagggtcg
J9PBC4_MCL1-01          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
J9PBC4_MCL1-02          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
Q8HYS5_MCL1-01          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
M3XAP4_MCL1-02          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
Q7YRZ9_MCL1-01          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
M3XAP4_MCL1-01          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          cgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcg
G1L3M8_MCL1-01          cgccggcgctagtcccccggn-----------------------------
G1L3M8_MCL1-02          cgccggcgctagtcccccggcc------nnnnnnnnnnnnnnnnnnnnnn
M3XZZ5_MCL1-01          cgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcg
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
K9IWB2_MCL1-01          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
K9IWB2_MCL1-03          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
A0A2K5C7L5_MCL1-01      cgccggcgctagcccctcggccgccctcacgcctgacgcccgg-gggtcg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcg
A0A2K6GI15_MCL1-01      ccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcg
A0A2K6GI15_MCL1-02      ccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcg
A0A2K5I9Q7_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5I9Q7_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6PPL1_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6KRW9_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6PPL1_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcg
A0A2I3GB35_MCL1-02      cgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5XSC7_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6ECR0_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2I3M3D6_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
I7G687_MCL1-01          cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-02      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
K7DE58_MCL1-02          cgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
Q07820_MCL1-03          cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
K7DE58_MCL1-01          cgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-01      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          cgccggcgcaagccccccgtccaccctcacgccagactcccggagg----
Q07820_MCL1-01          cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      cgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcg
A0A2K5CFH3_MCL1-03      cgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcg
F7GTF7_MCL1-01          cgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcg
F7GTF7_MCL1-02          cgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcg
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          -------------------------ctcctcagagaagacattgagcgcg
F7ETY1_MCL1-01          ---------------------ggaacgcctcagagaaggcagtgaatgac
J7H260_MCL1-01          ------------------------ggctctctgccctccccgcagtcc--
D2ITA0_MCL1-03          ------------------------------ttaacagccctcaaaatgga
D2ITA0_MCL1-04          ------------------------------ttaacagccctcaaaatgga
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------gatgtccgcgcgcgtgcc
H2MLZ3_MCL1-02          --------------------------------gatgtccgcgcgcgtgcc
Q0KFR9_MCL1-01          -----------------------ggccgttgtactatttccagggggc--
A0A087X830_MCL1-01      ------------------------aggggctcgttgtgcctgaagtcgca
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          ----------------------------ccccaacgccaccaccattcac
U3IRH3_MCL1-01          ------------cattttgggctggtttcacccaactcagaagcgagctc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggta
A0A1L1RNM6_MCL1-02      cgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggta
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          cgcgccggacccctgagggcgctgattggcc------------------c
R4GAJ0_MCL1-01          cgcgccggacccctgagggcgctgattggcc------------------c
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          cgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatc--
G3WBC5_MCL1-01          --------------------------------gacgtcaccgccccgc--
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ctcgcccctcgcccatgggcacggagggtcccgatggcaccgcggccc-c
G1PZ39_MCL1-01          --------------------gccgagggccccgacgtcatcgggaccctt
Q9Z1P3_MCL1-01          cccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcgg-c
P97287_MCL1-02          -----------------ggcgccgaggaccccgacgtcaccgcgtcgg-c
P97287_MCL1-01          cccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcgg-c
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cgcggccggcgcccattggcgccgagctccccgacgtcagcgcgaccc-c
G1T2Q0_MCL1-01          --------------attggcgccgagctccccgacgtcagcgcgaccc-c
A0A287DCH9_MCL1-01      cgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A287DCH9_MCL1-02      -----------------ggcgccgaggtccccgacgtcaccgcgaccc-c
G3T756_MCL1-01          tgcggccggcgcccattggcgccgagggccccgacgtcactgcgattc-c
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
F1MQX4_MCL1-01          ---------------------------------------------ccc-c
A0A1S3F3I1_MCL1-01      cgcgtcccgcgcccattggcgccgaggtccccgacgtcaccgggaccc-c
J9PBC4_MCL1-01          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
J9PBC4_MCL1-02          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
Q8HYS5_MCL1-01          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
M3XAP4_MCL1-02          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
Q7YRZ9_MCL1-01          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
M3XAP4_MCL1-01          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          cgcggccctcccccattggcgccgagggccccgacgtcaccgcgccct-c
G1L3M8_MCL1-01          ----------------tggcgccgagggtcccgacgtcacggcgaccc-c
G1L3M8_MCL1-02          nnnnnnnnnnnnnnnntggcgccgagggtcccgacgtcacggcgaccc-c
M3XZZ5_MCL1-01          cgcggccctcgcccattggcgccgagggccccaacgtcaccgcgaccc-c
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
K9IWB2_MCL1-01          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
K9IWB2_MCL1-03          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
A0A2K5C7L5_MCL1-01      tgcggccgctgc--------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          cgcggccgccgcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-01      cgcggccggctcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-02      cgcggccggctcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6PPL1_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6KRW9_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6PPL1_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgcggccgccgcccattggcgccgaggtctccgacgtcactgcgaccc-c
A0A2I3GB35_MCL1-02      cgcggccgccgcccattggcgccgaggtctccgacgtcactgcgaccc-c
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5XSC7_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5W0W9_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K6ECR0_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2I3M3D6_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5LXU8_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
I7G687_MCL1-01          cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5W0W9_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
K7DE58_MCL1-02          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
Q07820_MCL1-03          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
K7DE58_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5CFH3_MCL1-03      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-01          tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-02          tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          ------------------------------------tctccgcagaatgc
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ------------------------------------tcctcgcagatccc
G3PJT0_MCL1-01          ------------------------------------atgcgacagctcgc
A0A2U9CJ81_MCL1-01      ------------------------------------ttgccgcagatcgc
                                                                          

B6V6J0_MCL1-01          cgtggggcttctccgtgggaccccgatatg--------------------
F7ETY1_MCL1-01          cgaggggcttctccgtgggacgccgatatg--------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          ggcgaagagcgaaacatggacttccactccgaaggttcacacaccacgac
D2ITA0_MCL1-04          ggcgaagagcgaaacatggacttccactccgaaggttcacacaccacgac
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          -------------ttcctcgcgcagggcgttcaaactccgacgctgaag-
Q1L8X3_MCL1-01          -------------ttcttcgcgcagggcgttcaaactccgacgctaaag-
Q9I9N3_MCL1-01          -------------ttcttcgcgcagggcgttcaaactccgacgctaaag-
H2MLZ3_MCL1-01          tctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatc
H2MLZ3_MCL1-02          tctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatc
Q0KFR9_MCL1-01          --tggggccatatgtgctggggcgtcaccgaagtctaaagtggacttggg
A0A087X830_MCL1-01      atgggagccactgtagattctcttcattcgcctaaggatccctacaagaa
H3AR18_MCL1-01          ----------------------------------atggaattaccggggg
H3AR18_MCL1-02          ---------------------------------ggttacaacgccgacgg
W5MMB7_MCL1-01          cccggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcac
U3IRH3_MCL1-01          ccgagccagctg--------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccgcggccgctgattggctccgcggggctgtgggccgccgccggccgcgc
A0A1L1RNM6_MCL1-02      ccgcggccgctgattggctccgcggggctgtgggccgccgccggccgcgc
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ctgggaggggtctcagcgggcgctgattggctgcg--acgctgagggaga
R4GAJ0_MCL1-01          ctgggaggggtctcagcgggcgctgattggctgcg--acgctgagggaga
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --cgatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccg
G3WBC5_MCL1-01          --cgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccg
H0XHA5_MCL1-01          ----------------------------------------ctaccagacc
G1QAV8_MCL1-01          tgccaggtggctgttct---cgcccatcagccg-gaattgc--cctgaag
G1PZ39_MCL1-01          cgcgcggcggctgttt---gcgccccttggctgtgcggggctgcccgcgg
Q9Z1P3_MCL1-01          agagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgagg
P97287_MCL1-02          cgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgagg
P97287_MCL1-01          cgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgagg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cgcgaggctgctgtacttggcgcccacccgccgcgcgtcgccgctcgagg
G1T2Q0_MCL1-01          cgcgaggctgctgtacttggcgcccacccgccgcgcgtcgccgctcgagg
A0A287DCH9_MCL1-01      ggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgaga
A0A287DCH9_MCL1-02      ggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgaga
G3T756_MCL1-01          cgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtgg
W5QI41_MCL1-01          ----------------------------tgccgtgcgcaaccgcc-----
A5PJR2_MCL1-01          caccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaag
F1MQX4_MCL1-01          caccaa--------------------------------------ctgaag
A0A1S3F3I1_MCL1-01      aactaagcgggtgttcttcgcgcccacccaccgtgcgccgacgccggacg
J9PBC4_MCL1-01          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
J9PBC4_MCL1-02          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
Q8HYS5_MCL1-01          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
M3XAP4_MCL1-02          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaa
Q7YRZ9_MCL1-01          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaag
M3XAP4_MCL1-01          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaa
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ctccaggctgctgttcttcgcgcccacccgctgcgcgtcgccgcctgagg
G1L3M8_MCL1-01          cccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaag
G1L3M8_MCL1-02          cccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaag
M3XZZ5_MCL1-01          cccgaggctgctgttcttcgagcctacccaccgcgcgtcgccgcctgaag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
K9IWB2_MCL1-01          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
K9IWB2_MCL1-03          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
A0A2K5C7L5_MCL1-01      ----------tggttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          cacgaggctgctgttcttcgcgcccaccctccgtgcggcgccgcgggagg
A0A2K6GI15_MCL1-01      ggagaggctgctgttcttcgcgcccacccgccgcgcattgccgtccgagg
A0A2K6GI15_MCL1-02      ggagaggctgctgttcttcgcgcccacccgccgcgcattgccgtccgagg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgcgaggctgtttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6PPL1_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6KRW9_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6PPL1_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgcgaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgagg
A0A2I3GB35_MCL1-02      cgcgaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgagg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5XSC7_MCL1-02      cgcgaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5W0W9_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K6ECR0_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2I3M3D6_MCL1-01      cgcgaggccgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5LXU8_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
I7G687_MCL1-01          cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5W0W9_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgcgaggctgcttttctttgcgcccacccgccgcgcgtcgccgcttgagg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgcgaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgcgaggccgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-02      cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
K7DE58_MCL1-02          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
Q07820_MCL1-03          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
K7DE58_MCL1-01          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-01      cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
A0A2K5CFH3_MCL1-03      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgagg
F7GTF7_MCL1-01          ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
F7GTF7_MCL1-02          ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          cacaggctcctctaaagactctagcaacgggattgt---gtctaatggta
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          gatgggctctcccagggacgctttcaacgggaacgtcgg------cgaca
G3PJT0_MCL1-01          aatgggctcggcgaaggactcccacaacggcaacgcggggacaaacgaca
A0A2U9CJ81_MCL1-01      cgtgggctccgtgatcgactcccgcggcgggaacgtcggcgccggggacg
                                                                          

B6V6J0_MCL1-01          ------------------------------------gacacgc-------
F7ETY1_MCL1-01          ------------------------------------gaggcgcataggga
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          agagggggccttgcctctaatggcgacgtt-------------caaaagc
D2ITA0_MCL1-04          agagggggccttgcctctaatggcgacgtt-------------caaaagc
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ------------------------------------attccagaactgaa
F8W4Q8_MCL1-01          ------------------------------------attccagaactgaa
Q568W5_MCL1-01          ------------------------------------attccagaactgaa
Q568V1_MCL1-01          ------------------------------------acgtgcgtcgaaga
Q1L8X3_MCL1-01          ------------------------------------acgtgcgtcgaaga
Q9I9N3_MCL1-01          ------------------------------------acgtgcgtcgaaga
H2MLZ3_MCL1-01          agctcaaaagacc----------------------------------gca
H2MLZ3_MCL1-02          agctcaaaagacc----------------------------------gca
Q0KFR9_MCL1-01          aaatgggactggcgatactccaccacgacccacg--acgttaggagtgaa
A0A087X830_MCL1-01      acgcccgacg--------------------------aatctcgcagtgtc
H3AR18_MCL1-01          acgggtgc--------ccgc------------------------------
H3AR18_MCL1-02          ctccgtgccgccttcgccgcccacc-----------ccgtcgacccccga
W5MMB7_MCL1-01          ggctgtcctggaccccatgctcaaggcg--------gactacgccgagga
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgaagccccccgcgctcccattggctccggggcggccccccacgctccga
A0A1L1RNM6_MCL1-02      cgaagccccccgcgctcccattggctccggggcggccccccacgctccga
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          aggagagcaaccaaaatggcgcccggcctccctg--ccgctgcctgaagg
R4GAJ0_MCL1-01          aggagagcaaccaaaatggcgcccggcctccctg--ccgctgcctgaagg
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          aggtgg-ccgatggggctgcggacgtccca------atgtgccctgagga
G3WBC5_MCL1-01          aggtgg-ccgatggagccgcggacgccatc------ctatcccccgagga
H0XHA5_MCL1-01          agatgg-aagcccaagttgccgatgccgtc------aagtcgcccgaagg
G1QAV8_MCL1-01          agctgg-gagctctggcagccgacgccatc------atgtcgcccggaga
G1PZ39_MCL1-01          agatggaaagccgcggccgccgacgccatc------atgtcgccggaaga
Q9Z1P3_MCL1-01          agatgg-ccgcgtcg---gccgccgccatc------atgtctcccgagga
P97287_MCL1-02          agatgg-ccgcgtcggccgccgccgccatc------gtgtctccggagga
P97287_MCL1-01          agatgg-ccgcgtcggccgccgccgccatc------gtgtctccggagga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ------------------------------------atgtcgcctgagga
G1T2Q0_MCL1-02          agatgg-aagccccggctgcggacgccatc------atgtcgcccgaaga
G1T2Q0_MCL1-01          agatgg-aagccccggctgcggacgccatc------atgtcgcccgaaga
A0A287DCH9_MCL1-01      agatgg-aagcccccgccgccgcc------------atgtcgcccgaaga
A0A287DCH9_MCL1-02      agatgg-aagcccccgccgccgcc------------atgtcgcccgaaga
G3T756_MCL1-01          agatgg-aggctctagccgccgacgccatc------atgtcgcccgaaga
W5QI41_MCL1-01          ----gg-aagctttcgctgccttccccatttacgggatgcagataaagag
A5PJR2_MCL1-01          agatgg-aatccccgatctccgacgccatc------atgtcgcccgaaga
F1MQX4_MCL1-01          agatgg-aatccctgatctccgatgccatc------atgtcgcccgaaga
A0A1S3F3I1_MCL1-01      agatgg-aagccgcggccgccggcgccatc------atgtcgcccgaaga
J9PBC4_MCL1-01          agatgg-aaggcccggccgccgacgccatc------atgtcgcccgaaga
J9PBC4_MCL1-02          agatgg-aaggcccggccgccgacgccatc------atgtcgcccgaaga
Q8HYS5_MCL1-01          agatgg-aaggcccggccgccgacgccatc------atgtcgcccgaaga
M3XAP4_MCL1-02          agatgg-aaggcccagccgccgacgccatc------atgtcgcccgaaga
Q7YRZ9_MCL1-01          agatgg-aaggcccagccgccgacgccatc------atgtcgcccgaaga
M3XAP4_MCL1-01          agatgg-aaggcccagccgccgacgccatc------atgtcgcccgaaga
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ggatgg-aagccccggccgccgacgccatc------atgtcgcccgagga
G1L3M8_MCL1-01          agatgg-aaggcccagccgccgacgccatc------atgtcgcccgaaga
G1L3M8_MCL1-02          agatgg-aaggcccagccgccgacgccatc------atgtcgcccgaaga
M3XZZ5_MCL1-01          agatgg-aaggcccagctgccgacgccatc------atgtcgcccgaaga
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          agatgg-aatccccggcctccgacgccatc------atgtctcccgaaga
K9IWB2_MCL1-01          agatgg-aatccccggcctccgacgccatc------atgtctcccgaaga
K9IWB2_MCL1-03          agatgg-aatccccggcctccgacgccatc------atgtctcccgaaga
A0A2K5C7L5_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          agatgg-aagcccctgccgccgacgccatc------atgtcgccggaaga
A0A2K6GI15_MCL1-01      agatgg-aagcccctgccgccgacgccatc------atgtcgcccgaaga
A0A2K6GI15_MCL1-02      agatgg-aagcccctgccgccgacgccatc------atgtcgcccgaaga
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5I9Q7_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5I9Q7_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6PPL1_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6KRW9_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6PPL1_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2I3GB35_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5XSC7_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5W0W9_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6ECR0_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2I3M3D6_MCL1-01      agatgg-aagccccggctgccgacgccatc------atgtcgcccgaaga
A0A2K5LXU8_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
I7G687_MCL1-01          agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5W0W9_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      agatgg-aagccccggctgccgacgccatc------atgtcgcccgaaga
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2R9BYH6_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
K7DE58_MCL1-02          agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
Q07820_MCL1-03          agatgg-aagccccggccgctgacgccatc------atgtcgcccgaaga
K7DE58_MCL1-01          agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2R9BYH6_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --atgg-aagccccggccgctgacgccatc------atgtcgcccgaaga
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --atgg-aagccccggccgctgacgccatc------atgtcgcccgaaga
B4DLY8_MCL1-01          --------------------------------------gtcgcgcg----
Q07820_MCL1-01          agatgg-aagccccggccgctgacgccatc------atgtcgcccgaaga
B4DG83_MCL1-01          --atgg-aagccccggccgctgacgccatc------atgtcgcccgaaga
A0A2K6V5Y3_MCL1-02      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcccgaaga
A0A2K5CFH3_MCL1-03      agatgg-aagccccggccgccgacgccatc------atgtcgcctgaaga
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      agatgg-aagccccggccgccgacgccatc------atgtcgcctgaaga
F7GTF7_MCL1-01          agatgg-aagccccggccgccgacgccatc------atgtcgccggaaga
F7GTF7_MCL1-02          agatgg-aagccccggccgccgacgccatc------atgtcgccggaaga
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          cccccaaacggccgaac-------------------aacctcggggtaac
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          gcccgaagcggcccagc-------------------aagctgacggtggt
G3PJT0_MCL1-01          ccccgaagcggcccagc-------------------gccctcggggtgaa
A0A2U9CJ81_MCL1-01      ccccgaagcggcccaag-------------------aacctccaggtctc
                                                                          

B6V6J0_MCL1-01          --------acaggccg------cagctgaatggcttgggctttaacaacg
F7ETY1_MCL1-01          taagctggacaggccg------cagctgaatggcttcgggtttaacagtg
J7H260_MCL1-01          -gagctggacgaggac-----------gaggattacatggacgtacagtc
D2ITA0_MCL1-03          ggagacgaacg-----------taaaccaagacccacggaactaggaagg
D2ITA0_MCL1-04          ggagacgaacg-----------taaaccaagacccacggaactaggaagg
F8W4Q8_MCL1-02          ----------------------------gattctct--------------
Q8UWD6_MCL1-01          agcgcataaccagttt------gcggtggactctctccagg---------
F8W4Q8_MCL1-01          agcgcataaccagttt------gcggtggactctctccagg---------
Q568W5_MCL1-01          agcgcataaccagttt------gcggtggactctctccagg---------
Q568V1_MCL1-01          cgaactggacgggtacattgaggaggaggaggcgcctctga--agcggct
Q1L8X3_MCL1-01          cgaactggacggatacattgaggaggaggaggcgcctctga--agcggct
Q9I9N3_MCL1-01          cgaactggacggatacactgaggaggaggaggcgcctctga--agcggct
H2MLZ3_MCL1-01          ggacctcgagtattcc------gcgaggaggtttcacgacg---------
H2MLZ3_MCL1-02          ggacctcgagtattcc------gcgaggaggtttcacgacg---------
Q0KFR9_MCL1-01          tgtcgtgaaaagcaac------ggccttgataatcatttgt---------
A0A087X830_MCL1-01      cgcatcgaatggatat------gttgcaaaaagcctccaga---------
H3AR18_MCL1-01          -----aggacggggac------atggcggagtttcgcaagg---------
H3AR18_MCL1-02          ggacggggacggggac------atggcggagtttcgcaagg---------
W5MMB7_MCL1-01          cgaactggacaactac------tcggcggagcccgtggcgaccagcgcct
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      tcggttccgccgcggc------ccgccgggcgccgccggac--tccacgt
A0A1L1RNM6_MCL1-02      tcggttccgccgcggc------ccgccgggcgccgccggac--tccacgt
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ggagctcgacggctgc------gag--gaagccgaggagga--ggaggcc
R4GAJ0_MCL1-01          ggagctcgacggctgc------gag--gaagccgaggagga--ggaggcc
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          ggaactggacggttac------gagcccgagcctcccggga--agcggcc
G3WBC5_MCL1-01          cgagctggacggttac------gagcccgagctccccggga--agcggcc
H0XHA5_MCL1-01          tgaggtggcctcgtgc------gagccggagcctctcaaga--agcaacc
G1QAV8_MCL1-01          ggagctgggcaggtat------gagccggagcc------ga--agcagcc
G1PZ39_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
Q9Z1P3_MCL1-01          ggagctggacggctgt------gagccggaggtgctcagca--aacgccc
P97287_MCL1-02          ggaactggacggctgc------gagccggaggccatcggca--agcgccc
P97287_MCL1-01          ggaactggacggctgc------gagccggaggccatcggca--agcgccc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ggagctggacgggtac------gagccggagcccctcggga--agcggcc
G1T2Q0_MCL1-02          ggagctggacggctac------gagccggagccccttgcga--agcggcc
G1T2Q0_MCL1-01          ggagctggacggctac------gagccggagccccttgcga--agcggcc
A0A287DCH9_MCL1-01      ggagctggacggctac------gagcccgagcccctcggga--agcggcc
A0A287DCH9_MCL1-02      ggagctggacggctac------gagcccgagcccctcggga--agcggcc
G3T756_MCL1-01          ggagctggacgggtac------gagccggagccgctcggga--agcggcc
W5QI41_MCL1-01          gcagcagcagtggttc------aagatgtttggcttcaaga--ggcgccc
A5PJR2_MCL1-01          ggagctggacgggtgc------gagccagaccctctcggga--agcggcc
F1MQX4_MCL1-01          ggagccggacgggtgc------aagccagaccctctcggga--agcggcc
A0A1S3F3I1_MCL1-01      ggagctggacggctac------gaacccgagcccctgggga--agaggcc
J9PBC4_MCL1-01          ggagctagacgggtac------gagccggaacctttgggga--agcggcc
J9PBC4_MCL1-02          ggagctagacgggtac------gagccggaacctttgggga--agcggcc
Q8HYS5_MCL1-01          ggagctagacgggtac------gagccggaacctttgggga--agcggcc
M3XAP4_MCL1-02          ggagctagacgggtac------gagccagaacctctgggga--agcggcc
Q7YRZ9_MCL1-01          ggagctagacgggtac------gagccagaacctctgggga--agcggcc
M3XAP4_MCL1-01          ggagctagacgggtac------gagccagaacctctgggga--agcggcc
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
G1L3M8_MCL1-01          ggagctggacgggtac------gagccggaacctttgggga--agcggcc
G1L3M8_MCL1-02          ggagctggacgggtac------gagccggaacctttgggga--agcggcc
M3XZZ5_MCL1-01          ggagctggatgggtac------gagccggaacctttgggga--agaggcc
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ggagctggacgggtac------gagccggagcccctcggga--agcggcc
K9IWB2_MCL1-01          ggagctggacgggtac------gagccggagcccctcggga--agcggcc
K9IWB2_MCL1-03          ggagctggacgggtac------gagccggagcccctcggga--agcggcc
A0A2K5C7L5_MCL1-01      agagctggacaggtac------gagccggagcctctcggga--agcggcc
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          tgagctggacgggtac------gagccggagcctttgggga--agcggcc
A0A2K6GI15_MCL1-01      tgagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6GI15_MCL1-02      tgagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5I9Q7_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5I9Q7_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6PPL1_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6KRW9_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6PPL1_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2I3GB35_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5XSC7_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5W0W9_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6ECR0_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2I3M3D6_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5LXU8_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
I7G687_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5W0W9_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2R9BYH6_MCL1-02      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
K7DE58_MCL1-02          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
Q07820_MCL1-03          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
K7DE58_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2R9BYH6_MCL1-01      ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
B4DG83_MCL1-01          ggagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6V5Y3_MCL1-02      cgagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cgagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5CFH3_MCL1-03      agagctggacgggtac------gagccggagcctctcggga--agcggcc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      agagctggacgggtac------gagccggagcctctcggga--agcggcc
F7GTF7_MCL1-01          agagctggacgggtac------gagccggagcctctcggga--agcggcc
F7GTF7_MCL1-02          agagctggacgggtac------gagccggagcctctcggga--agcggcc
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          ctcaacaaacgggtat------acaacaaaagctatccggg---------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          caaacccaaggtctgc------ctgtcgaagaccattcagg---------
G3PJT0_MCL1-01          ctccgcgaacggctac------ccatcaaaaccgcagcggg---------
A0A2U9CJ81_MCL1-01      cgcaacgaaggcgtac------gcggccaagagctgccggg---------
                                                                          

B6V6J0_MCL1-01          g-------ggggtcgctgccttgtt--------------------cccag
F7ETY1_MCL1-01          g-------ggggagccttactgcct--------------------cccag
J7H260_MCL1-01          ggactcccggggctccacctcccct-------------------------
D2ITA0_MCL1-03          gg-----------------------------------caggctggtgaac
D2ITA0_MCL1-04          gg-----------------------------------caggctggtgaac
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          tagacctggtacaaacggcct----------------gaaggggctgcag
Q1L8X3_MCL1-01          tagaccgggtacaaacggcct----------------gaaggggctgcag
Q9I9N3_MCL1-01          tagaccgggtacaaacggcct----------------gaaggggctgcag
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          ggatccccaagtcgccgcggtcgctgcccgcggggctgaagctgggcggc
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgcggcccgtcgctctgtggagccc------------cgaggaggagttg
A0A1L1RNM6_MCL1-02      cgcggcccgtcgctctgtggagccc------------cgaggaggagttg
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gcgacggtgccgtcttccaccccct--cgccggacaaagagatggcggag
R4GAJ0_MCL1-01          gcgacggtgccgtcttccaccccct--cgccggacaaagagatggcggag
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          c-------tcccgcctggctgtgct------------ggaaatagcccgg
G3WBC5_MCL1-01          c-------gctcgcctggccatgct------------gcccttggccaga
H0XHA5_MCL1-01          g-------gagggcctgcctttgct------------ggagtttgttggt
G1QAV8_MCL1-01          g-------gctgtcctgcccttgct------------ccagctggtcggg
G1PZ39_MCL1-01          g-------gccgtcctgcccttggt------------gcagctggtcggg
Q9Z1P3_MCL1-01          g-------gcggtgctgcccctact------------ggagcgcgtgagc
P97287_MCL1-02          g-------gccgtgctgcccctcct------------ggagcgcgtgagc
P97287_MCL1-01          g-------gccgtgctgcccctcct------------ggagcgcgtgagc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      g-------gccgtgctgcccttgct------------ggggctggtgggg
G1T2Q0_MCL1-02          g-------gccgtcctgcccctgct------------ggacttggtgggg
G1T2Q0_MCL1-01          g-------gccgtcctgcccctgct------------ggacttggtgggg
A0A287DCH9_MCL1-01      g-------gcggtcctgcccttgct------------ggagctcgttgga
A0A287DCH9_MCL1-02      g-------gcggtcctgcccttgct------------ggagctcgttgga
G3T756_MCL1-01          g-------gctgtttttccccggct------------ggggctggtcggg
W5QI41_MCL1-01          t-------gccgtccggcctttacc------------tttgatggtcgga
A5PJR2_MCL1-01          t-------gccgtccggcctttacc------------tttgttggtcgga
F1MQX4_MCL1-01          t-------gccgtccggcctttacc------------tttgttggtcaga
A0A1S3F3I1_MCL1-01      g-------gccgtcctgcccctgct------------ggagctggtcggg
J9PBC4_MCL1-01          g-------gcggtcctgcctctgct------------ggagttggtgggg
J9PBC4_MCL1-02          g-------gcggtcctgcctctgct------------ggagttggtgggg
Q8HYS5_MCL1-01          g-------gcggtcctgcctctgct------------ggagctggtgggg
M3XAP4_MCL1-02          g-------gctgtcctgcctttgct------------ggagttggtcggg
Q7YRZ9_MCL1-01          g-------gctgtcctgcctttgct------------ggagttggtcggg
M3XAP4_MCL1-01          g-------gctgtcctgcctttgct------------ggagttggtcggg
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          g-------gctgtcctgcccttgct------------ggagtttgtccgg
G1L3M8_MCL1-01          g-------gctgtcctgcctttgct------------ggagttggtcggg
G1L3M8_MCL1-02          g-------gctgtcctgcctttgct------------ggagttggtcggg
M3XZZ5_MCL1-01          t-------gctgtcctgcctttgct------------ggagttggtgggg
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          g-------gccgtcctgcccttgct------------ggggttagtcgag
K9IWB2_MCL1-01          g-------gccgtcctgcccttgct------------ggggttagtcgag
K9IWB2_MCL1-03          g-------gccgtcctgcccttgct------------ggggttagtcgag
A0A2K5C7L5_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtggag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          g-------gcggtcctgcctttgct------------ggagttggtcggg
A0A2K6GI15_MCL1-01      g-------gctgtcctgcctttgct------------ggagttggtcggg
A0A2K6GI15_MCL1-02      g-------gctgtcctgcctttgct------------ggagttggtcggg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          g-------gctgtcctgcctctgct------------ggagttggtcggg
A0A2K5I9Q7_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5I9Q7_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K6PPL1_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K6KRW9_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K6PPL1_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2I3GB35_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5XSC7_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5W0W9_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K6ECR0_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2I3M3D6_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5LXU8_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
I7G687_MCL1-01          g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5W0W9_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2R9BYH6_MCL1-02      g-------gctgtcctgcctctgct------------ggagttggtcggg
K7DE58_MCL1-02          g-------gctgtcctgcctctgct------------ggagttggtcggg
Q07820_MCL1-03          g-------gctgtcctgccgctgct------------ggagttggtcggg
K7DE58_MCL1-01          g-------gctgtcctgcctctgct------------ggagttggtcggg
A0A2R9BYH6_MCL1-01      g-------gctgtcctgcctctgct------------ggagttggtcggg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          g-------gctgtcctgccgctgct------------ggagttggtcggg
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          g-------gctgtcctgccgctgct------------ggagttggtcggg
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          g-------gctgtcctgccgctgct------------ggagttggtcggg
B4DG83_MCL1-01          g-------gctgtcctgccgctgct------------ggagttggtcggg
A0A2K6V5Y3_MCL1-02      g-------gctgtcctgcccctgct------------ggagctggtcggg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      g-------gctgtcctgcccctgct------------ggagctggtcggg
A0A2K5CFH3_MCL1-03      g-------gctgtcctgcccctgct------------ggagttggtcggg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      g-------gctgtcctgcccctgct------------ggagttggtcggg
F7GTF7_MCL1-01          g-------gctgtcctgcctctgct------------ggagttggtcggg
F7GTF7_MCL1-02          g-------gctgtcctgcctctgct------------ggagttggtcggg
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          ------------------------------------------------a-
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ------------------------------------------------ag
G3PJT0_MCL1-01          ------------------------------------------------ag
A0A2U9CJ81_MCL1-01      ------------------------------------------------ag
                                                                          

B6V6J0_MCL1-01          gaggatgaattagatgaggatatggataacggatcccagggttccacgtc
F7ETY1_MCL1-01          gagggagaattggatgaggatattgatggcggctcccagggttctagctc
J7H260_MCL1-01          -----------------------------ccgctcacccccacctgctcc
D2ITA0_MCL1-03          aaatcgcaagacgac---caagaaggaaacggttcgctgcctagcactcc
D2ITA0_MCL1-04          aaatcgcaagacgac---caagaaggaaacggttcgctgcctagcactcc
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -------------------------------gctcggtaccgtcctcgcc
F8W4Q8_MCL1-01          -------------------------------gctcggtaccgtcctcgcc
Q568W5_MCL1-01          -------------------------------gctcggtaccgtcctcgcc
Q568V1_MCL1-01          ctggacggtcgatttgtttctacgacagacggatctctaccgaccacccc
Q1L8X3_MCL1-01          ctggacggtcgatttgtttctgcgacagacggatctctaccgaccacccc
Q9I9N3_MCL1-01          ctggacggtcgatttgtttctgcgacagacggatctctaccgaccacccc
H2MLZ3_MCL1-01          -------------------tcgacgacgatggctctctccccaacacccc
H2MLZ3_MCL1-02          -------------------tcgacgacgatggctctctccccaacacccc
Q0KFR9_MCL1-01          ----------ctgaccgaagcaacaatgacgactctttgccgtgcactcc
A0A087X830_MCL1-01      -------agagcagcgacgacagcgacgaaggctctctgccatgcactcc
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          cacttcccggagagc---ggccacgccgacgggtccctgccctccacccc
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcc
A0A1L1RNM6_MCL1-02      gacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcc
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gaggaaggagagaaa-----gggaaaggagggccccctctcttcccgg--
R4GAJ0_MCL1-01          gaggaaggagagaaa-----gggaaaggagggccccctctcttcccgg--
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          gaaggtggggacagcccga---------acggctctttgccttcgacgcc
G3WBC5_MCL1-01          gagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgcc
H0XHA5_MCL1-01          gaggccggtaacggc---cccagcactgaca---cacttccttccacacc
G1QAV8_MCL1-01          gaggccagcgaaggc---cccg---caggtggctcactgccctcgacccc
G1PZ39_MCL1-01          gaggccagcggcggc---cccggcgcggggggctcgctgccctccacgcc
Q9Z1P3_MCL1-01          gaggcggctaagagc---tccggagctgacggctcgctgccctccacgcc
P97287_MCL1-02          gaggcggccaagagc---tccggggccgacggctctctgccctccacgcc
P97287_MCL1-01          gaggcggccaagagc---tccggggccgacggctctctgccctccacgcc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      gaggccgggaagagc---cccagcgccgacggttcgctgccctcgacgcc
G1T2Q0_MCL1-02          gaggccagtaaggtc---cctagcacggacgggtcgctgccctcgacgcc
G1T2Q0_MCL1-01          gaggccagtaaggtc---cctagcacggacgggtcgctgccctcgacgcc
A0A287DCH9_MCL1-01      gaggccgccaagagt---cccggcgcggacgggtcgctgccctcgacgcc
A0A287DCH9_MCL1-02      gaggccgccaagagt---cccggcgcggacgggtcgctgccctcgacgcc
G3T756_MCL1-01          gaggccagtaatggc---cccggtaccgacgggtcactaccctcgacgcc
W5QI41_MCL1-01          gaagccagtaacaacagtccaggctcggacggctcgctgccctcgacgcc
A5PJR2_MCL1-01          gaagccagtaacaacagtccaggctcggacggctcgctgccctcgacgcc
F1MQX4_MCL1-01          gaagccagtaacaacagtccaggctcggacggctcgctgccctcgacgcc
A0A1S3F3I1_MCL1-01      gaagccagtaagagc---tcgcgcacggacggctcgctcccttccacgcc
J9PBC4_MCL1-01          gaggccagcagtggc---cccggcatggacggctcgctaccctcgacgcc
J9PBC4_MCL1-02          gaggccagcagtggc---cccggcatggacggctcgctaccctcgacgcc
Q8HYS5_MCL1-01          gaggccagcagtggc---cccggcatggacggctcgctaccctcgacgcc
M3XAP4_MCL1-02          gaggccagcagtggc---cccggcacagacggctcactgccctcgacgcc
Q7YRZ9_MCL1-01          gaggccagcagtggc---cccggcacagacggctcactgccctcgacgcc
M3XAP4_MCL1-01          gaggccagcagtggc---cccggcacagacggctcactgccctcgacgcc
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          gaggccagcagtggc---ccctgcacggacggctcgctcccctcgacgcc
G1L3M8_MCL1-01          gaggccagcggtggc---ccttgtacggacggctcactgccctcgacgcc
G1L3M8_MCL1-02          gaggccagcggtggc---ccttgtacggacggctcactgccctcgacgcc
M3XZZ5_MCL1-01          gaggccagcagtggc---ccctgcacggacggctcactgccctcgacgcc
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gaggccagtagtggc---cccggcacggacggctcgctcccctcgacgcc
K9IWB2_MCL1-01          gaggccagtagtggc---cccggcacggacggctcgctcccctcgacgcc
K9IWB2_MCL1-03          gaggccagtagtggc---cccggcacggacggctcgctcccctcgacgcc
A0A2K5C7L5_MCL1-01      gagcctggtaatgac---tccagtacggatgggtcactaccctcgacgcc
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gaggccagtaacggc---cccagcactgatgggtcacttccttcgacacc
A0A2K6GI15_MCL1-01      gaggccagtaatggc---tccagcacggacgggtcactaccctcgacgcc
A0A2K6GI15_MCL1-02      gaggccagtaatggc---tccagcacggacgggtcactaccctcgacgcc
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2K5I9Q7_MCL1-02      gaatc---taatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K5I9Q7_MCL1-01      gaatc---taatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      gaatctggtaatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K6PPL1_MCL1-02      gaatctggtaatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K6KRW9_MCL1-01      gaatctggtaatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K6PPL1_MCL1-01      gaatctggtaatagc---tccagtacggatgggtcactaccctcgacgcc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2I3GB35_MCL1-02      gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5XSC7_MCL1-02      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5W0W9_MCL1-01      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K6ECR0_MCL1-02      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2I3M3D6_MCL1-01      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5LXU8_MCL1-01      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gaatctggtaatagc---tccagtacggatgggtcactaccctcgacgcc
I7G687_MCL1-01          gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5W0W9_MCL1-02      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      gaatctggtaatagc---cccagtacggatgggtcactaccctcgacgcc
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      gaatctggtaatgac---accagtacggacgggtcactaccctcgacgcc
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      gaatctggtaatgac---accagtacggacgggtcactaccctcgacgcc
A0A2R9BYH6_MCL1-02      gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
K7DE58_MCL1-02          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
Q07820_MCL1-03          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
K7DE58_MCL1-01          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2R9BYH6_MCL1-01      gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          gaatctggtaataac---accagtacggacgggtcactacccttgacgcc
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
B4DLY8_MCL1-01          -----------------------------------------------gcc
Q07820_MCL1-01          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
B4DG83_MCL1-01          gaatctggtaataac---accagtacggacgggtcactaccctcgacgcc
A0A2K6V5Y3_MCL1-02      gagcctggtcatggc---tccagtacggacgggtcactcccctcgacgcc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gagcctggtcatggc---tccagtacggacgggtcactcccctcgacgcc
A0A2K5CFH3_MCL1-03      gagcctggtaatggc---tccagtacggacgggtcactaccctcgacgcc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gagcctggtaatggc---tccagtacggacgggtcactaccctcgacgcc
F7GTF7_MCL1-01          gagcctgctaatggc---tccagtacggacgggtcactaccgtcgacgcc
F7GTF7_MCL1-02          gagcctgctaatggc---tccagtacggacgggtcactaccgtcgacgcc
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          -----------ccgggagga------agacggttcgttgccgagcacccc
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ga---------cagcgagga---------cggctcgctgccgtgtacgcc
G3PJT0_MCL1-01          ga---------cagcgaggacaccgacaacgactcgctgccgtgcacccc
A0A2U9CJ81_MCL1-01      gacggcggcggcggcggcgacgtcggcggcggctctctgccctccacccc
                                                                          

B6V6J0_MCL1-01          tcccccgga------------------------------------cagcc
F7ETY1_MCL1-01          ccccccgga------------------------------------cagcc
J7H260_MCL1-01          ccggacccc-----------------------------------------
D2ITA0_MCL1-03          ggaactcca---------gtcagaagtagacacggacagccaggcggggg
D2ITA0_MCL1-04          ggaactcca---------gtcagaagtagacacggacagccaggcggggg
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ttc------------------ggacgaaacgggggattatcccccc----
F8W4Q8_MCL1-01          ttc------------------ggacgaaacgggggattatcccccc----
Q568W5_MCL1-01          ttc------------------ggacgaaacgggggattatcccccc----
Q568V1_MCL1-01          agatccaga------------ggagctcgactacgccgaa----------
Q1L8X3_MCL1-01          agatccgga------------ggagctcgactacgccgaa----------
Q9I9N3_MCL1-01          agatccgga------------ggagctcgactacgccgaa----------
H2MLZ3_MCL1-01          ggagtt---------------ggagtgcgaggccagcgtttccggcgaca
H2MLZ3_MCL1-02          ggagtt---------------ggagtgcgaggccagcgtttccggcgaca
Q0KFR9_MCL1-01          ccagatggc---------gtcagaatgtgggcctgaactatcgaattgtc
A0A087X830_MCL1-01      agcgcagca------------agacagtgaaaccgacgcgtctgctgtac
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          ggacacccc-------------------------gctggactgcggcag-
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cggcacgccgcccgagctgcccgacttgatccccgacgagctgcggcag-
A0A1L1RNM6_MCL1-02      cggcacgccgcccgagctgcccgacttgatccccgacgagctgcggcag-
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          accacctgc---------------------ggaagacga-----------
R4GAJ0_MCL1-01          accacctgc---------------------ggaagacga-----------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          gcccccagctgag------gaggatgaagaagaggatgaactatacggg-
G3WBC5_MCL1-01          gcccccggccgaggaggacgaggacgaggaggaggatgagttgtacggg-
H0XHA5_MCL1-01          tcccccagc---------------agaggaggaggatgagttatactgg-
G1QAV8_MCL1-01          gccccctgc------------tgaggaggaggaggaattgtca-------
G1PZ39_MCL1-01          gccccccgc------------ggaggaggaggaggacgagctgttccgg-
Q9Z1P3_MCL1-01          gccgccgcc------------tgaggaggaagacgacgagctgtaccac-
P97287_MCL1-02          gccgccgcc------------cgaggaggaagaggacgacctataccgc-
P97287_MCL1-01          gccgccgcc------------cgaggaggaagaggacgacctataccgc-
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      gcccccggcggag------gaggaggaggaggaggacgcgctgtaccga-
G1T2Q0_MCL1-02          gccgcccgc------------agaggaggaggaggacgagttgtaccgg-
G1T2Q0_MCL1-01          gccgcccgc------------agaggaggaggaggacgagttgtaccgg-
A0A287DCH9_MCL1-01      gccgcccgc------------ggaggaggaggacgacgagctgtaccgg-
A0A287DCH9_MCL1-02      gccgcccgc------------ggaggaggaggacgacgagctgtaccgg-
G3T756_MCL1-01          gcccctagc------------agaggaggaggaggacgagttgtaccgg-
W5QI41_MCL1-01          gcccccatc------------agaggaggaggaggacgagttatatcgg-
A5PJR2_MCL1-01          gcccccagc------------agaggaggaggaggacgagttatatcgg-
F1MQX4_MCL1-01          gcccccagc------------agaggaggaggaggacaagttatattgg-
A0A1S3F3I1_MCL1-01      gcctccagc------------ggaggaggaggacgacgagttgtaccgg-
J9PBC4_MCL1-01          acccccggc------------ggaggaggaggaagatgagttgtaccgg-
J9PBC4_MCL1-02          acccccggc------------ggaggaggaggaagatgagttgtaccgg-
Q8HYS5_MCL1-01          acccccggc------------ggaggaggaggaagatgagttgtaccgg-
M3XAP4_MCL1-02          acccccagc------------agaggaggaggaggacgagttgttccgg-
Q7YRZ9_MCL1-01          acccccagc------------agaggaggaggaggacgagttgttccgg-
M3XAP4_MCL1-01          acccccagc------------agaggaggaggaggacgagttgttccgg-
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          gcccccagc------------agaggaggaggaggacgagttgtaccgg-
G1L3M8_MCL1-01          acccccagc------------agaggaggaggaagacgagttgtaccgg-
G1L3M8_MCL1-02          acccccagc------------agaggaggaggaagacgagttgtaccgg-
M3XZZ5_MCL1-01          acccccagc------------agaggaggaggaagacgagttgtaccgg-
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gcccccggc------------agaggaggaggaggacgagttataccgg-
K9IWB2_MCL1-01          gcccccggc------------agaggaggaggaggacgagttataccgg-
K9IWB2_MCL1-03          gcccccggc------------agaggaggaggaggacgagttataccgg-
A0A2K5C7L5_MCL1-01      gccgaca-------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gcccccagc------------agaggaggaggaggatgagttataccgg-
A0A2K6GI15_MCL1-01      gcccccagc------------agaggaggaggacgacgagttgtaccgg-
A0A2K6GI15_MCL1-02      gcccccagc------------agaggaggaggacgacgagttgtaccgg-
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5I9Q7_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5I9Q7_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6PPL1_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6KRW9_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6PPL1_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2I3GB35_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5XSC7_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5W0W9_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6ECR0_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2I3M3D6_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5LXU8_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
I7G687_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5W0W9_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2R9BYH6_MCL1-02      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
K7DE58_MCL1-02          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
Q07820_MCL1-03          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
K7DE58_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2R9BYH6_MCL1-01      gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
B4DLY8_MCL1-01          gccgc---------------------------------------------
Q07820_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
B4DG83_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6V5Y3_MCL1-02      gccgcccgc------------agaggaggaggaggacgagttgtaccgg-
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gccgcccgc------------agaggaggaggaggacgagttgtaccgg-
A0A2K5CFH3_MCL1-03      gcctccagc------------ggaggaggaggaggacgagttgtaccgg-
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gcctccagc------------ggaggaggaggaggacgagttgtaccgg-
F7GTF7_MCL1-01          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
F7GTF7_MCL1-02          gccgccagc------------agaggaggaggaggacgagttgtaccgg-
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          ggagtatca---------tttggacggtgaatccgac-------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          ggagtcgca---------ctcgggcgacgtgctggacgtgtccgggcgtc
G3PJT0_MCL1-01          ggag---------------tcggacagcgaaaccgacgtctccgactccc
A0A2U9CJ81_MCL1-01      ggag---------------tcggacggcgagcacgacgtctccggttgtc
                                                                          

B6V6J0_MCL1-01          ccgtgtgccctaaggatggattatatatggacacccagcagctcattctc
F7ETY1_MCL1-01          ctgtgtgcccgaaggatggattatatatggacacccagcagctcatcctg
J7H260_MCL1-01          --------------------ctgcacacggaaacccgcgccctgctgcac
D2ITA0_MCL1-03          aa------------gaagtgttggataacgacaccaagcgaatcattcgc
D2ITA0_MCL1-04          aa------------gaagtgttggataacgacaccaagcgaatcattcgc
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------accgcccttgacatggacacgcgggagattattgac
F8W4Q8_MCL1-01          --------------accgcccttgacatggacacgcgggagattattgac
Q568W5_MCL1-01          --------------accgcccttgacatggacacgcgggagattattgac
Q568V1_MCL1-01          --------------------ctggaacgcgatactcggcagctcttattg
Q1L8X3_MCL1-01          --------------------ctggaacgcgatactcggcagctcttattg
Q9I9N3_MCL1-01          --------------------ctggaacgcgatactcggcagctcttattg
H2MLZ3_MCL1-01          actcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaat
H2MLZ3_MCL1-02          actcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaat
Q0KFR9_MCL1-01          catcgggcgat---gaagtattggaacatgataccagacaactcattgag
A0A087X830_MCL1-01      gtgcgagcaac---caagtgctggataacgacacaatggagctcattagc
H3AR18_MCL1-01          ---------------agacgctgaagctgttgcggagttacttgtgcgag
H3AR18_MCL1-02          ---------------agacgctgaagctgttgcggagttacttgtgcgag
W5MMB7_MCL1-01          --------------cgtcccc--gagttcctctccgaggccca-------
U3IRH3_MCL1-01          -------------------------------------------cgggggg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------gaatccctggagctcatcctccggtacctccgggag
A0A1L1RNM6_MCL1-02      --------------gaatccctggagctcatcctccggtacctccgggag
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ------------------cgctggaagtggtaggccgctacctgcgcgag
R4GAJ0_MCL1-01          ------------------cgctggaagtggtaggccgctacctgcgcgag
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------cagtccttggagctcatcagccggtaccttcgcgag
G3WBC5_MCL1-01          --------------cagtccttggagttgataacccgatacctccgcgag
H0XHA5_MCL1-01          --------------cagtcgatggagatcatctctcggtacctatgggag
G1QAV8_MCL1-01          -----------------ctgctggagatgatccctcagcaccttagggaa
G1PZ39_MCL1-01          --------------cagtcgctggagatcatctctcggtacc---gggag
Q9Z1P3_MCL1-01          --------------cagtcgctggagatcatctcccgctacctgcgggag
P97287_MCL1-02          --------------cagtcgctggagatcatctcgcgctacttgcgggag
P97287_MCL1-01          --------------cagtcgctggagatcatctcgcgctacttgcgggag
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------cagtcgctggagatcatctcgcggtacctgcgggag
G1T2Q0_MCL1-02          --------------cagtcgctggagattatcgcccggtaccttcgggag
G1T2Q0_MCL1-01          --------------cagtcgctggagattatcgcccggtaccttcgggag
A0A287DCH9_MCL1-01      --------------cagtcgctggagatcatttcgcggtacctccgcgag
A0A287DCH9_MCL1-02      --------------cagtcgctggagatcatttcgcggtacctccgcgag
G3T756_MCL1-01          --------------cagtcgctagagattatctctcggtaccttcaggag
W5QI41_MCL1-01          --------------cagtccctggagattatctctcagtacctcctggag
A5PJR2_MCL1-01          --------------cagtccctggagataatctctcagtacctccgggag
F1MQX4_MCL1-01          --------------cagtccctggagattatctctcggtacctccgggag
A0A1S3F3I1_MCL1-01      --------------cagtcgctggagattatctgtcgctaccttagggag
J9PBC4_MCL1-01          --------------cagtccctggagattatctctcggtaccttcgggaa
J9PBC4_MCL1-02          --------------cagtccctggagattatctctcggtaccttcgggaa
Q8HYS5_MCL1-01          --------------cagtccctggagattatctctcggtaccttcgggaa
M3XAP4_MCL1-02          --------------cagtcgctggagattatctctcggtaccttcgggag
Q7YRZ9_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
M3XAP4_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------caatcgctggagattatctctcgttaccttcgggaa
G1L3M8_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
G1L3M8_MCL1-02          --------------cagtcgctggagattatctctcggtaccttcgggag
M3XZZ5_MCL1-01          --------------cagtctctggagattatttctcggtacctgcgggag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------cagtccctggagattatctctcggtaccttcgggag
K9IWB2_MCL1-01          --------------cagtccctggagattatctctcggtaccttcgggag
K9IWB2_MCL1-03          --------------cagtccctggagattatctctcggtaccttcgggag
A0A2K5C7L5_MCL1-01      -----------------tcactggagattatctctcggtaccttcgggaa
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------cagtcgctggagatcatctctcggtaccttcgggag
A0A2K6GI15_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K6GI15_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5I9Q7_MCL1-02      --------------cagtcgctggaaattatctctcggtaccttcgggag
A0A2K5I9Q7_MCL1-01      --------------cagtcgctggaaattatctctcggtaccttcgggag
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------cagtcactggaaattatctctcggtaccttcgggag
A0A2K6PPL1_MCL1-02      --------------cagtcactggaaattatctctcggtaccttcgggag
A0A2K6KRW9_MCL1-01      --------------cagtcactggaaattatctctcggtaccttcgggag
A0A2K6PPL1_MCL1-01      --------------cagtcactggaaattatctctcggtaccttcgggag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------cagtcgctggagatcatctctcggtaccttcgggag
A0A2I3GB35_MCL1-02      --------------cagtcgctggagatcatctctcggtaccttcgggag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5XSC7_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5W0W9_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K6ECR0_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2I3M3D6_MCL1-01      --------------cagtcgctggagattatctcttggtaccttcgggag
A0A2K5LXU8_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
I7G687_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5W0W9_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------cagtcgctggagattatctcttggtaccttcgggag
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2R9BYH6_MCL1-02      --------------cagtcgctggagattatctctcggtaccttcgggag
K7DE58_MCL1-02          --------------cagtccctggagattatctctcggtaccttcgggag
Q07820_MCL1-03          --------------cagtcgctggagattatctctcggtaccttcgggag
K7DE58_MCL1-01          --------------cagtccctggagattatctctcggtaccttcgggag
A0A2R9BYH6_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
B4DG83_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K6V5Y3_MCL1-02      --------------cagtcgctggagattatctctcggtacctccgggag
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------cagtcgctggagattatctctcggtacctccgggag
A0A2K5CFH3_MCL1-03      --------------cagtcgctggagattatctctcggtaccttcgggag
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------cagtcgctggagattatctctcggtaccttcgggag
F7GTF7_MCL1-01          --------------cagtcgctggagattatctctcggtaccttcgggag
F7GTF7_MCL1-02          --------------cagtcgctggagattatctctcggtaccttcgggag
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------gaggagctggagagagaaacgaaactccttattcac
I3KXG5_MCL1-01          --------------------ctggagagagaaactaaactcattattcac
Q4SW32_MCL1-01          cggcgggggacgaggcggctctcgacagcgacacgaggcagctggtgagc
G3PJT0_MCL1-01          cggcgggggcc---gcggctctggagagcgacacgaggcaactcctcggc
A0A2U9CJ81_MCL1-01      cggcggcggac---gaggcgctggacagcttcaccagggaactcattagc
                                                                          

B6V6J0_MCL1-01          gctttctaccgcgtgtacagcggcgaggagagcggcgaattagaggctt-
F7ETY1_MCL1-01          gctttcttccggggatactgcggggaggaaaccagcggcttaaaggcct-
J7H260_MCL1-01          accttctt---------cagggaatgg---gccggagacgcgaagcagg-
D2ITA0_MCL1-03          attttt-----------ctcagagact-atgcaggggcatcaaaagcta-
D2ITA0_MCL1-04          attttt-----------ctcagagact-atgcaggggcatcaaaagcta-
F8W4Q8_MCL1-02          ---------------------------------ggactctttc-------
Q8UWD6_MCL1-01          actttc-----------ttaaaaatct-ttacaggactccctcattcta-
F8W4Q8_MCL1-01          actttc-----------ttaaaaatct-ttacaggactccctcattcta-
Q568W5_MCL1-01          actttc-----------ttaataatct-ttacaggactccctcattcta-
Q568V1_MCL1-01          gatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactcc-
Q1L8X3_MCL1-01          gatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactcc-
Q9I9N3_MCL1-01          gatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactcc-
H2MLZ3_MCL1-01          --ttct-----------ttaggaactt--tgttggaatttctcagtatc-
H2MLZ3_MCL1-02          --ttct-----------ttaggaactt--tgttggaatttctcagtatc-
Q0KFR9_MCL1-01          aatttt-----------ttgggggact-acacaggactgtctcagcctc-
A0A087X830_MCL1-01      agtttt-----------ctaagaaatt-ttacaggactttcaaagtgtc-
H3AR18_MCL1-01          --------------------gtggcgg-gctgcgagagcacggagacgg-
H3AR18_MCL1-02          --------------------gtggcgg-gctgcgagagcacggagacgg-
W5MMB7_MCL1-01          -----------------cgggcagctgaacgcggagacccgggagttaat
U3IRH3_MCL1-01          ggagca-----------ggggggggtc-accgagtctctgagccaacctc
A0A1D5PQZ2_MCL1-01      ---------------------------------------gaaaag-----
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gcggcg-----------ggagaggccg-agcccggcgttaaaaagctgtt
A0A1L1RNM6_MCL1-02      gcggcg-----------ggagaggccg-agcccggcgttaaaaagctgtt
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gccgcc-----------gacgaggccg-ggtccaaaggcaccgggcccaa
R4GAJ0_MCL1-01          gccgcc-----------gacgaggccg-ggtccaaaggcaccgggcccaa
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          -----------------caggcggttg-gcacgaaggaggccaagcccc-
G3WBC5_MCL1-01          -----------------caggcggtcg-gcaccaaggacaccaagcccc-
H0XHA5_MCL1-01          -----------------caggaaactg-g---------------------
G1QAV8_MCL1-01          -----------------cggg---ctg-gcgccagggac-caaagcca--
G1PZ39_MCL1-01          -----------------caggcgaccg-gcgccaaggacgccaagcccc-
Q9Z1P3_MCL1-01          -----------------caggcgacgg-gctccaaggacgcgaagcctc-
P97287_MCL1-02          -----------------caggcgaccg-gctccaaggactcgaagcctc-
P97287_MCL1-01          -----------------caggcgaccg-gctccaaggactcgaagcctc-
A0A2K6F6N9_MCL1-01      -----------------------------------------------gg-
A0A2K5DMS4_MCL1-01      -------------------ggcgactg-gcgccaaggacacaaagccaa-
A0A286Y1M5_MCL1-01      -----------------caggccgcgg-gcgccaaggactcgaagccgc-
G1T2Q0_MCL1-02          -----------------caggcgaccg-gcgccaaggacgcgaagccga-
G1T2Q0_MCL1-01          -----------------caggcgaccg-gcgccaaggacgcgaagccga-
A0A287DCH9_MCL1-01      -----------------caggcgaccg-gctccaaggacgcgaagccgc-
A0A287DCH9_MCL1-02      -----------------caggcgaccg-gctccaaggacgcgaagccgc-
G3T756_MCL1-01          -----------------caggcaaccg-gcgccaaggacaccaagccaa-
W5QI41_MCL1-01          -----------------caagcaaccg-gcaccaaggacgcgaagcccc-
A5PJR2_MCL1-01          -----------------caggcaaccg-gcgccaaggacgcgaagcccc-
F1MQX4_MCL1-01          -----------------caggcaaccg-gcgccaaggatgtgaagcccc-
A0A1S3F3I1_MCL1-01      -----------------caagccacgg-gcgccaaggacgccaagccgc-
J9PBC4_MCL1-01          -----------------caggccacag-gcgccaaggacgcgaaaccac-
J9PBC4_MCL1-02          -----------------caggccacag-gcgccaaggacgcgaaaccac-
Q8HYS5_MCL1-01          -----------------caggccacag-gcgccaaggacgcgaaaccac-
M3XAP4_MCL1-02          -----------------caggcgaccg-gcgccaaggacgcgaaaccac-
Q7YRZ9_MCL1-01          -----------------caggcgaccg-gcgccaaggacgcgaaaccac-
M3XAP4_MCL1-01          -----------------caggcgaccg-gcgccaaggacgcgaaaccac-
M3XAP4_MCL1-03          -------------------ggcgaccg-gcgccaaggacgcgaaaccac-
F7AVA6_MCL1-01          -----------------caggctaccg-gcaccaaggacacgaagccaa-
G1L3M8_MCL1-01          -----------------caggcaacag-gcgccaaggacgcgaaaccgc-
G1L3M8_MCL1-02          -----------------caggcaacag-gcgccaaggacgcgaaaccgc-
M3XZZ5_MCL1-01          -----------------caggcaacgg-gcgccaaggacgcgaaaccac-
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          -----------------caggcaaccg-gcgccaaggacgcgaagccaa-
K9IWB2_MCL1-01          -----------------caggcaaccg-gcgccaaggacgcgaagccaa-
K9IWB2_MCL1-03          -----------------caggcaaccg-gcgccaaggacgcgaagccaa-
A0A2K5C7L5_MCL1-01      -----------------caggcgactg-gcgccaaggacacaaagccaa-
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          -----------------caggcgaccg-gtgccaaggacgcgaaaccaa-
A0A2K6GI15_MCL1-01      -----------------caggcaaccg-gcgccaaggacgcaaagccaa-
A0A2K6GI15_MCL1-02      -----------------caggcaaccg-gcgccaaggacgcaaagccaa-
A0A2K6GI15_MCL1-03      -------------------ggcaaccg-gcgccaaggacgcaaagccaa-
H2N5Y9_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccat-
A0A2K5I9Q7_MCL1-02      -----------------caggccactg-gcgccaaggacacacagccaa-
A0A2K5I9Q7_MCL1-01      -----------------caggccactg-gcgccaaggacacacagccaa-
A0A2K5I9Q7_MCL1-03      -------------------ggccactg-gcgccaaggacacacagccaa-
A0A2K6KRW9_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6PPL1_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6KRW9_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6PPL1_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6KRW9_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A2K6PPL1_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A2I3GB35_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2I3GB35_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5XSC7_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5W0W9_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6ECR0_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2I3M3D6_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5LXU8_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5LXU8_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A0D9RZP5_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
I7G687_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5W0W9_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5W0W9_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A2K6ECR0_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
F7HUE9_MCL1-02          -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A2K6ECR0_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
F7HUE9_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K5XSC7_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
A0A2K5XSC7_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2I3M3D6_MCL1-03      --------------------gccaccg-gcgccaaggacacaaagccaa-
A0A2I3M3D6_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
G2HFR3_MCL1-01          ----------------------------------------------cat-
C8YZ26_MCL1-01          -------------------ggccaccg-gcgccaaggacacaaagccaa-
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2I2YQH7_MCL1-03      --------------------gccaccg-gcgccaaggacacaaagccaa-
A0A2I2YQH7_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2R9BYH6_MCL1-02      -----------------caggccaccg-gcgccaaggacacaaagccaa-
K7DE58_MCL1-02          -----------------caggccaccg-gcgccaaggacacaaagccaa-
Q07820_MCL1-03          -----------------caggccaccg-gcgccaaggacacaaagccaa-
K7DE58_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2R9BYH6_MCL1-01      -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2R9BYH6_MCL1-03      -------------------ggccaccg-gcgccaaggacacaaagccaa-
K7DE58_MCL1-03          -------------------ggccaccg-gcgccaaggacacaaagccaa-
B4DU51_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
Q07820_MCL1-04          -------------------ggccaccg-gcgccaaggacacaaagccaa-
B4E3L8_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
B4DLY8_MCL1-01          -------------------------------ccaaggacacaaagccaa-
Q07820_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
B4DG83_MCL1-01          -----------------caggccaccg-gcgccaaggacacaaagccaa-
A0A2K6V5Y3_MCL1-02      -----------------caggcgaccg-gcgccaaggacacaaagccaa-
A0A2K6V5Y3_MCL1-03      -------------------ggcgaccg-gcgccaaggacacaaagccaa-
A0A2K6V5Y3_MCL1-01      -----------------caggcgaccg-gcgccaaggacacaaagccaa-
A0A2K5CFH3_MCL1-03      -----------------caggcgaccg-gcgccaaggacacaaagccaa-
A0A2K5CFH3_MCL1-02      -------------------ggcgaccg-gcgccaaggacacaaagccaa-
A0A2K5CFH3_MCL1-01      -----------------caggcgaccg-gcgccaaggacacaaagccaa-
F7GTF7_MCL1-01          -----------------caggcgaccg-gcgccaaggacacaaagccaa-
F7GTF7_MCL1-02          -----------------caggcgaccg-gcgccaaggacacaaagccaa-
F7GTF7_MCL1-03          -------------------ggcgaccg-gcgccaaggacacaaagccaa-
I3JHR5_MCL1-01          agtttt-----------ttgggtgatt-ttactggactttctcagcctc-
I3KXG5_MCL1-01          agtttt-----------ttgggagact-ttactggactttctcagcctc-
Q4SW32_MCL1-01          cgttta-----------atggcggacg-ttaccggcatcagcagagccc-
G3PJT0_MCL1-01          cgcttc-----------ctgagagaat-ttacgggactgtcgaaaaccc-
A0A2U9CJ81_MCL1-01      cagttc-----------ctgagagact-atgtcgcgcgcacggacccgc-
                                                                          

B6V6J0_MCL1-01          --------------------------------cctgtctcctccaacatg
F7ETY1_MCL1-01          --------------------------------ccttcctcctccatcatg
J7H260_MCL1-01          ---------------------aggacggcgac---------------agc
D2ITA0_MCL1-03          --------------------------------------------aaagga
D2ITA0_MCL1-04          --------------------------------------------aaagga
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -----------------------------------------------aaa
F8W4Q8_MCL1-01          -----------------------------------------------aaa
Q568W5_MCL1-01          -----------------------------------------------aaa
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          -----------------------------------------------ggc
H2MLZ3_MCL1-02          -----------------------------------------------ggc
Q0KFR9_MCL1-01          -----------------------------------------------gat
A0A087X830_MCL1-01      -----------------------------------------------ggt
H3AR18_MCL1-01          -----------ccttcaggttcggtctagatcagtggagcggt----ggc
H3AR18_MCL1-02          -----------ccttcaggttcggtctagatcagtggagcggt----ggc
W5MMB7_MCL1-01          cgggacctttttgcagatgtacacggggttgccgcaccgccggagc-cga
U3IRH3_MCL1-01          t-------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      tccggggctcctgggagggccagggcggcccggcagggcgagcagcgccg
A0A1L1RNM6_MCL1-02      tccggggctcctgggagggccagggcggcccggcagggcgagcagcgccg
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gttctccttccaaggcttgctggggcgcttcgggagcagccccaacgagg
R4GAJ0_MCL1-01          gttctccttccaaggcttgctggggcgcttcgggagcagccccaacgagg
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          ---------------------tacgc---------------------agc
G3WBC5_MCL1-01          ---------------------tacgc---------------------agt
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------gggcccgcg------ggt
G1PZ39_MCL1-01          ---------------------tgggcgggcccgcggcctcc------agc
Q9Z1P3_MCL1-01          ---------------------tgggcgaggccggcgcagcg------ggc
P97287_MCL1-02          ---------------------tgggcgaggcgggcgcggcg------ggc
P97287_MCL1-01          ---------------------tgggcgaggcgggcgcggcg------ggc
A0A2K6F6N9_MCL1-01      ---------------------cgggcagatctagg---------------
A0A2K5DMS4_MCL1-01      ---------------------tgggcaggtctgaggccgcc------aac
A0A286Y1M5_MCL1-01      ---------------------tgggcggggtggggcccacc------agc
G1T2Q0_MCL1-02          ---------------------tgggccgggccggcagcgcg------agc
G1T2Q0_MCL1-01          ---------------------tgggccgggccggcagcgcg------agc
A0A287DCH9_MCL1-01      ---------------------tgcgtgggtcgggggccgcc------agc
A0A287DCH9_MCL1-02      ---------------------tgcgtgggtcgggggccgcc------agc
G3T756_MCL1-01          ---------------------tgggcgggtctggggcggcc------agc
W5QI41_MCL1-01          ---------------------tgggcgggtctggggccacc------agc
A5PJR2_MCL1-01          ---------------------tgggcgggtctgggaccaca------agc
F1MQX4_MCL1-01          ---------------------tgggcgggtctggggccacc------agc
A0A1S3F3I1_MCL1-01      ---------------------tgggtggggccggcgcggcc------agc
J9PBC4_MCL1-01          ---------------------tgggcgggtctcgggcggcc------agc
J9PBC4_MCL1-02          ---------------------tgggcgggtctcgggcggcc------agc
Q8HYS5_MCL1-01          ---------------------tgggcgggtctcgggcggcc------agc
M3XAP4_MCL1-02          ---------------------tgggcgggtctggggcggcc------agc
Q7YRZ9_MCL1-01          ---------------------tgggcgggtctggggcggcc------agc
M3XAP4_MCL1-01          ---------------------tgggcgggtctggggcggcc------agc
M3XAP4_MCL1-03          ---------------------tgggcgggtctggggcggcc------agc
F7AVA6_MCL1-01          ---------------------tgggcgggtctggggccgcc------agc
G1L3M8_MCL1-01          ---------------------tgggcgggtctggggcggcc------agc
G1L3M8_MCL1-02          ---------------------tgggcgggtctggggcggcc------agc
M3XZZ5_MCL1-01          ---------------------tgggcgggcctggggctgcc------agc
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ---------------------tgggcgggtctggggccgcc------agc
K9IWB2_MCL1-01          ---------------------tgggcgggtctggggccgcc------agc
K9IWB2_MCL1-03          ---------------------tgggcgggtctggggccgcc------agc
A0A2K5C7L5_MCL1-01      ---------------------tggacaggtccggggccgcc------agc
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ---------------------tgggcagggcaggagccgcc------agc
A0A2K6GI15_MCL1-01      ---------------------tgggcaggtctggggccgcc------agc
A0A2K6GI15_MCL1-02      ---------------------tgggcaggtctggggccgcc------agc
A0A2K6GI15_MCL1-03      ---------------------tgggcaggtctggggccgcc------agc
H2N5Y9_MCL1-01          ---------------------tgggcaggtctggggccacc------tgc
A0A2K5I9Q7_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K5I9Q7_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K5I9Q7_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2K6KRW9_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K6PPL1_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K6KRW9_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K6PPL1_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K6KRW9_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2K6PPL1_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2I3GB35_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2I3GB35_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K5XSC7_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K5W0W9_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K6ECR0_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2I3M3D6_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K5LXU8_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2K5LXU8_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A0D9RZP5_MCL1-01      ---------------------tgagcaggtctggggccacc------agc
I7G687_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
A0A2K5W0W9_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
A0A2K5W0W9_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2K6ECR0_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
F7HUE9_MCL1-02          ---------------------tgggcaggtctggggccacc------agc
A0A2K6ECR0_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
F7HUE9_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
A0A2K5XSC7_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2K5XSC7_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2I3M3D6_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
A0A2I3M3D6_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
G2HFR3_MCL1-01          ---------------------tgtgcat----------------------
C8YZ26_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ---------------------tgggcaggtctggggcaacc------agc
A0A2I2YQH7_MCL1-03      ---------------------tgggcaggtctggggcaacc------agc
A0A2I2YQH7_MCL1-01      ---------------------tgggcaggtctggggcaacc------agc
A0A2R9BYH6_MCL1-02      ---------------------tgggcaggtctggggccacc------agc
K7DE58_MCL1-02          ---------------------tgggcaggtctggggccacc------agc
Q07820_MCL1-03          ---------------------tgggcaggtctggggccacc------agc
K7DE58_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
A0A2R9BYH6_MCL1-01      ---------------------tgggcaggtctggggccacc------agc
A0A2R9BYH6_MCL1-03      ---------------------tgggcaggtctggggccacc------agc
K7DE58_MCL1-03          ---------------------tgggcaggtctggggccacc------agc
B4DU51_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
Q07820_MCL1-04          ---------------------tgggcaggtctggggccacc------agc
B4E3L8_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
B4DLY8_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
Q07820_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
B4DG83_MCL1-01          ---------------------tgggcaggtctggggccacc------agc
A0A2K6V5Y3_MCL1-02      ---------------------tgggcaggtccggggccgcc------agc
A0A2K6V5Y3_MCL1-03      ---------------------tgggcaggtccggggccgcc------agc
A0A2K6V5Y3_MCL1-01      ---------------------tgggcaggtccggggccgcc------agc
A0A2K5CFH3_MCL1-03      ---------------------tgggcaggtccggggccgcc------agc
A0A2K5CFH3_MCL1-02      ---------------------tgggcaggtccggggccgcc------agc
A0A2K5CFH3_MCL1-01      ---------------------tgggcaggtccggggccgcc------agc
F7GTF7_MCL1-01          ---------------------tgggcaggtccggggccgcc------agc
F7GTF7_MCL1-02          ---------------------tgggcaggtccggggccgcc------agc
F7GTF7_MCL1-03          ---------------------tgggcaggtccggggccgcc------agc
I3JHR5_MCL1-01          -----------------------------------------------aac
I3KXG5_MCL1-01          -----------------------------------------------aac
Q4SW32_MCL1-01          -----------------------------------------------agt
G3PJT0_MCL1-01          -----------------------------------------------agt
A0A2U9CJ81_MCL1-01      -----------------------------------------------ggt
                                                                          

B6V6J0_MCL1-01          gcgtccaccacaaagccctggaaaccctgctgagggtcgggggagagatt
F7ETY1_MCL1-01          gcgcccaccccaaggccctggagaccctgcagcgggtcgggggagacatt
J7H260_MCL1-01          ccgaag--------gcgctgcccaccatgcgcaggctggggggcgacatc
D2ITA0_MCL1-03          caagacaagacgaggttcaagtgactatgagaagagttgtagacggcgtg
D2ITA0_MCL1-04          caagacaagacgaggttcaagtgactatgagaagagttgtagacggcgtg
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          gtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctc
F8W4Q8_MCL1-01          gtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctc
Q568W5_MCL1-01          gtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctc
Q568V1_MCL1-01          ---------atcacgccataccgacgatgaagcgggtggtcgacaatatt
Q1L8X3_MCL1-01          ---------atcacgccataccgacgatgaagcgagtggtcgacaatatt
Q9I9N3_MCL1-01          ---------atcacgccataccgacgatgaagcgagtggtcgacaatatt
H2MLZ3_MCL1-01          accgggataataaatacatgtcgaccgcgaaaagagtggtgaacgacgtg
H2MLZ3_MCL1-02          accgggataataaatacatgtcgaccgcgaaaagagtggtgaacgacgtg
Q0KFR9_MCL1-01          ggacgcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgta
A0A087X830_MCL1-01      ggagtcaaaataaagctctatctacgatgaaaagggtggtggaggacgtt
H3AR18_MCL1-01          gagaag--------ccgctggacaccctccggcgggtcggggatagcatc
H3AR18_MCL1-02          gagaag--------ccgctggacaccctccggcgggtcggggatagcatc
W5MMB7_MCL1-01          ggcaag--------gccctggagaccctgaagcgcgtcgtggacagtgtg
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      tcatgg---agaaagcgctggaaacgttgcggagggtcggggacggcgtg
A0A1L1RNM6_MCL1-02      tcatgg---agaaagcgctggaaacgttgcggagggtcggggacggcgtg
U3KKY6_MCL1-01          ---aaa--------------------------------------------
R4GAJ0_MCL1-02          cggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctc
R4GAJ0_MCL1-01          cggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctc
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          ggcaag--------gccttagagaccctgcgacgcgtgggagacggtgtc
G3WBC5_MCL1-01          gggaag--------gcactggagaccctgcggcgcgtgggagacggtgtc
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          cggcgg--------ggtgcagcggc-gtgcagcagggtgcag-cggggtg
G1PZ39_MCL1-01          cggaag--------gcgctggagaccctgcggcgggtcggggacggcgtg
Q9Z1P3_MCL1-01          cggagg--------gcgctggagaccctgcggcgcgtgggcgacggcgtg
P97287_MCL1-02          cggaga--------gcgctggagaccctgcggcgcgtgggcgacggcgtg
P97287_MCL1-01          cggaga--------gcgctggagaccctgcggcgcgtgggcgacggcgtg
A0A2K6F6N9_MCL1-01      --------------------------ctgggcctggctgggtttg-----
A0A2K5DMS4_MCL1-01      agtaag--------gcgctggagaccttacgaggggttggggaaggcgtg
A0A286Y1M5_MCL1-01      aggaag--------gcactggagaccctgcggcgggtcggggacggcgtg
G1T2Q0_MCL1-02          cggaag--------gcgctcgagaccctgcggcgggtcggggacggtgtg
G1T2Q0_MCL1-01          cggaag--------gcgctcgagaccctgcggcgggtcggggacggtgtg
A0A287DCH9_MCL1-01      aggaag--------gcgctggagaccctgcggcgggtcggcgacggagtg
A0A287DCH9_MCL1-02      aggaag--------gcgctggagaccctgcggcgggtcggcgacggagtg
G3T756_MCL1-01          aggaag--------gcgttagagaccctccggcgagtcgcggacggggtg
W5QI41_MCL1-01          cggaag--------gcgttggagaccctgcgcagagtcggggatggggtg
A5PJR2_MCL1-01          cggaag--------gcgttggagaccctgcgccgagtcggggatggggtg
F1MQX4_MCL1-01          cggaag--------gcgttggagaccctgcaccgagtcggggatggggtg
A0A1S3F3I1_MCL1-01      aggaag--------gcgctggagaccctgcggcgggtcggggacggggtg
J9PBC4_MCL1-01          cggaag--------gcgttagagaccctccggcgagtcggggacggggta
J9PBC4_MCL1-02          cggaag--------gcgttagagaccctccggcgagtcggggacggggta
Q8HYS5_MCL1-01          cggaag--------gcgttagagaccctccagcgagtcggggacggggta
M3XAP4_MCL1-02          cgaaag--------gcgttagagaccctccgacgggtcggggacggcgtg
Q7YRZ9_MCL1-01          cgaaag--------gcgttagagaccctccgacgggtcggggacggcgtg
M3XAP4_MCL1-01          cgaaag--------gcgttagagaccctccgacgggtcggggacggcgtg
M3XAP4_MCL1-03          cgaaag--------gcgttagagaccctccgacgggtcggggacggcgtg
F7AVA6_MCL1-01          cggaag--------gcgttagagaccctgcggcgggtcggggacggagtg
G1L3M8_MCL1-01          cggaag--------gcgttagagaccctccgacgggtcggggacggggta
G1L3M8_MCL1-02          cggaag--------gcgttagagaccctccgacgggtcggggacggggta
M3XZZ5_MCL1-01          cggaag--------gcgttagagaccctccgacgggtcggggacggggta
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cggaag--------gcgttagagaccctgcgacgggtcggggacggggtg
K9IWB2_MCL1-01          cggaag--------gcgttagagaccctgcgacgggtcggggacggggtg
K9IWB2_MCL1-03          cggaag--------gcgttagagaccctgcgacgggtcggggacggggtg
A0A2K5C7L5_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggacggcgtg
A0A2K5EPY9_MCL1-01      -----------------ctgcatgcttttc------tt--------c---
A0A2K5EPY9_MCL1-02      -----------------ttata---ataac------ttaaagataac---
H0XFB7_MCL1-01          aggaag--------gcgctggagaccttgcgccgcgttggggacggggtg
A0A2K6GI15_MCL1-01      aggaag--------gcgctagagaccttacgacgtgtcggggacggtgtg
A0A2K6GI15_MCL1-02      aggaag--------gcgctagagaccttacgacgtgtcggggacggtgtg
A0A2K6GI15_MCL1-03      aggaag--------gcgctagagaccttacgacgtgtcggggacggtgtg
H2N5Y9_MCL1-01          aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5I9Q7_MCL1-02      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K5I9Q7_MCL1-01      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K5I9Q7_MCL1-03      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6KRW9_MCL1-02      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6PPL1_MCL1-02      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6KRW9_MCL1-01      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6PPL1_MCL1-01      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6KRW9_MCL1-03      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2K6PPL1_MCL1-03      aggaag--------gctctggagaccttacgacgggtgggggatggcgtg
A0A2I3GB35_MCL1-01      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2I3GB35_MCL1-02      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5XSC7_MCL1-02      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5W0W9_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K6ECR0_MCL1-02      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2I3M3D6_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5LXU8_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5LXU8_MCL1-03      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A0D9RZP5_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
I7G687_MCL1-01          aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5W0W9_MCL1-02      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5W0W9_MCL1-03      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K6ECR0_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
F7HUE9_MCL1-02          aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K6ECR0_MCL1-03      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
F7HUE9_MCL1-01          aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5XSC7_MCL1-03      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2K5XSC7_MCL1-01      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2I3M3D6_MCL1-03      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
A0A2I3M3D6_MCL1-02      aggaag--------gctctggagaccttacgacgggttggggatggcgtg
G2HFR3_MCL1-01          -----------------ctggatatatacccaccacctgagtgtaccatt
C8YZ26_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
K7DE58_MCL1-04          -----a--------gtgttgaa-----------------------acgtg
A0A2I2YQH7_MCL1-02      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2I2YQH7_MCL1-03      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2I2YQH7_MCL1-01      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2R9BYH6_MCL1-02      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
K7DE58_MCL1-02          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-03          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
K7DE58_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2R9BYH6_MCL1-01      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2R9BYH6_MCL1-03      aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
K7DE58_MCL1-03          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
B4DU51_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-04          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
B4E3L8_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
B4DLY8_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
B4DG83_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggatggcgtg
A0A2K6V5Y3_MCL1-02      aggaag--------gcgctggagaccctgcggcgggtcggggacggcgtg
A0A2K6V5Y3_MCL1-03      aggaag--------gcgctggagaccctgcggcgggtcggggacggcgtg
A0A2K6V5Y3_MCL1-01      aggaag--------gcgctggagaccctgcggcgggtcggggacggcgtg
A0A2K5CFH3_MCL1-03      aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
A0A2K5CFH3_MCL1-02      aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
A0A2K5CFH3_MCL1-01      aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-01          aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-02          aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-03          aggaag--------gcgctggagaccttacgacgggttggggacggcgtg
I3JHR5_MCL1-01          gaaaggaaaccaaagcactaaaaacgatgaaaagagttgttgcggacgta
I3KXG5_MCL1-01          gaaaggaaaccaaagcactaaaaatgatgaaaagagttgttgcggacgta
Q4SW32_MCL1-01          ggagggagagcagagcgctggcgacgacgaagcgagtggtgggagacctg
G3PJT0_MCL1-01          ggaacccgagcagggagctcaccaccatgaagagggtggtgggcgacgtt
A0A2U9CJ81_MCL1-01      ggaccgacagcaaagcgctgtccacgatgaagagagtggtggaccgactg
                                                                          

B6V6J0_MCL1-01          atagagaagcaccacatggccttcacgggcatgctacaaaggttgtctat
F7ETY1_MCL1-01          atagagaagcaccatatggcctttactggcatgctgcaaaggttgtctat
J7H260_MCL1-01          aatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctat
D2ITA0_MCL1-03          cttgaaaaacaccaatacgcatacaagggtatgatccagaaattggaatt
D2ITA0_MCL1-04          cttgaaaaacaccaatacgcatacaagggtatgatccagaaattggaatt
F8W4Q8_MCL1-02          --------------------------aggtatgattgcacggctgaatct
Q8UWD6_MCL1-01          gcggtgaagcacgagctcgcttacaaaggtatgattgcacggctgaatct
F8W4Q8_MCL1-01          gcggtgaagcacgagctcgcttacaaaggtatgattgcacggctgaatct
Q568W5_MCL1-01          gcggtgaagcacgagctcgcttacaaaggtatgattgcacggctgaatct
Q568V1_MCL1-01          ctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagct
Q1L8X3_MCL1-01          ctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagct
Q9I9N3_MCL1-01          ctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagct
H2MLZ3_MCL1-01          ttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgtt
H2MLZ3_MCL1-02          ttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgtt
Q0KFR9_MCL1-01          atagcaaagcaccgatacgcatacaatggtatggtcgccaaacttgactt
A0A087X830_MCL1-01      ttgtcgaagcacagatatgcatacaatggtatgctcaacaggcttgctct
H3AR18_MCL1-01          atagacaaacaccgcatcgcctttaatggaatgcaacaaaagctaaacat
H3AR18_MCL1-02          atagacaaacaccgcatcgcctttaatggaatgcaacaaaagctaaacat
W5MMB7_MCL1-01          gtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagct
U3IRH3_MCL1-01          ---------------------cttgcaggaatgcttcggaagctggaaat
A0A1D5PQZ2_MCL1-01      ---------------------tctaggggaatgcttcggaagctggaaat
G1MPY7_MCL1-01          ---------------------ttttcaggaatgcttcggaagctggaaat
A0A1L1RNM6_MCL1-01      atgcagaaacacgaattggccttccagggaatgcttcggaagctggaaat
A0A1L1RNM6_MCL1-02      atgcagaaacacgaattggccttccagggaatgcttcggaagctggaaat
U3KKY6_MCL1-01          ------aaaaataaaaaaaatctcccaggaatgctccgaaaactggaaat
R4GAJ0_MCL1-02          cgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaat
R4GAJ0_MCL1-01          cgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaat
K7FPN7_MCL1-01          ---------------------------gggatgcttcggaaactagacat
F6ZMX1_MCL1-01          cagaggaaccacgagagggctttccaaggcatgcttcggaaattggatat
G3WBC5_MCL1-01          cagaggaaccacgagacggctttccaaggtatgcttcgcaaactggatat
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          cgg------caggagactgccttcctaggtatgctt---gaactggacac
G1PZ39_MCL1-01          cagcggaaccacgagatggccttccaaggtgagc---gggggccgcgcgc
Q9Z1P3_MCL1-01          cagcgcaaccacgagacggccttccagggcatgcttcggaaactggacat
P97287_MCL1-02          cagcgcaaccacgagacggccttccagggcatgctccggaaactggacat
P97287_MCL1-01          cagcgcaaccacgagacggccttccagggcatgctccggaaactggacat
A0A2K6F6N9_MCL1-01      ---------------aaggccttccaaggcatgcttcagaaactggacat
A0A2K5DMS4_MCL1-01      ccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaa
A0A286Y1M5_MCL1-01      cagcgcaaccaccagaccgccttccaaggaatgcttcggaaactggacat
G1T2Q0_MCL1-02          cagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacat
G1T2Q0_MCL1-01          cagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacat
A0A287DCH9_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaagctggacat
A0A287DCH9_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaagctggacat
G3T756_MCL1-01          cagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacat
W5QI41_MCL1-01          cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
A5PJR2_MCL1-01          cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
F1MQX4_MCL1-01          cagcacaaccacgagacggctttccaaggcgtgcttcagaaactggacat
A0A1S3F3I1_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
J9PBC4_MCL1-01          cagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacat
J9PBC4_MCL1-02          cagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacat
Q8HYS5_MCL1-01          cagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacat
M3XAP4_MCL1-02          cagcgcaaccacgagaccgccttccaa-----------------------
Q7YRZ9_MCL1-01          cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacat
M3XAP4_MCL1-01          cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacat
M3XAP4_MCL1-03          cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacat
F7AVA6_MCL1-01          cagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacat
G1L3M8_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
G1L3M8_MCL1-02          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
M3XZZ5_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
Q95KR3_MCL1-01          ------------------gccttccaaggcatgcttcggaaactggacat
K9IWB2_MCL1-02          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
K9IWB2_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
K9IWB2_MCL1-03          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5C7L5_MCL1-01      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5EPY9_MCL1-01      -----------------------cccaggcatgcttcgaaaactggacat
A0A2K5EPY9_MCL1-02      -----------------------cacatgcatgcttcgaaaactggacat
H0XFB7_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6GI15_MCL1-01      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K6GI15_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6GI15_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
H2N5Y9_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5I9Q7_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5I9Q7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5I9Q7_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6KRW9_MCL1-02      cagcgcaaccacgagacggctttccaa-----------------------
A0A2K6PPL1_MCL1-02      cagcgcaaccacgagacggctttccaa-----------------------
A0A2K6KRW9_MCL1-01      cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
A0A2K6PPL1_MCL1-01      cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
A0A2K6KRW9_MCL1-03      cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
A0A2K6PPL1_MCL1-03      cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacat
A0A2I3GB35_MCL1-01      cagcgcaaccatgagacggccttccaa-----------------------
A0A2I3GB35_MCL1-02      cagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacat
A0A2I3GB35_MCL1-03      ---------------------------ggcatgcttcggaaactggacat
A0A2K5LXU8_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5XSC7_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5W0W9_MCL1-01      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K6ECR0_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2I3M3D6_MCL1-01      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5LXU8_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5LXU8_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A0D9RZP5_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
I7G687_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5W0W9_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5W0W9_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6ECR0_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
F7HUE9_MCL1-02          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6ECR0_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
F7HUE9_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5XSC7_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5XSC7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2I3M3D6_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2I3M3D6_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
G2HFR3_MCL1-01          ca---------------------------catgtt------actggacat
C8YZ26_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggagactggacat
K7DE58_MCL1-04          ca-----------------------------tgcttcggaaactggacat
A0A2I2YQH7_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2I2YQH7_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2I2YQH7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2R9BYH6_MCL1-02      cagcgcaaccatgagacggccttccaa-----------------------
K7DE58_MCL1-02          cagcgcaaccatgagacggccttccaa-----------------------
Q07820_MCL1-03          cagcgcaaccacgagacggccttccaa-----------------------
K7DE58_MCL1-01          cagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacat
A0A2R9BYH6_MCL1-01      cagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacat
A0A2R9BYH6_MCL1-03      cagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacat
K7DE58_MCL1-03          cagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacat
B4DU51_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
Q07820_MCL1-04          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
B4E3L8_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
B4DLY8_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
Q07820_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
B4DG83_MCL1-01          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6V5Y3_MCL1-02      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K6V5Y3_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6V5Y3_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5CFH3_MCL1-03      cagcgcaaccacgagacggccttccaa-----------------------
A0A2K5CFH3_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K5CFH3_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
F7GTF7_MCL1-01          cagcgcaaccacgagacggccttccaa-----------------------
F7GTF7_MCL1-02          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
F7GTF7_MCL1-03          cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
I3JHR5_MCL1-01          ttagaaaagcacagatacgcttacaacggaatgattaataaactgtcatt
I3KXG5_MCL1-01          ttagaaaagcacagatatgcttacaacggaatgattaataaattgtcatt
Q4SW32_MCL1-01          atggagaagcaccgatacacgtacagaggtatgatcaacaaattgttcat
G3PJT0_MCL1-01          ttggagaagcacagatacgtattcaatggtatggtgaacaaattgtcact
A0A2U9CJ81_MCL1-01      gtggagaagcacagatacgcatacaacggtatgatgaatagactgtcctt
                                                                          

B6V6J0_MCL1-01          acatagcaga---gaagacttgcagaaactttctgaggttcccgctttgg
F7ETY1_MCL1-01          acatagtaga---gaggacttgcagaaactttccgaagttcccgctttgg
J7H260_MCL1-01          acaacgtcca---gaagatatccagaagctctccgaggtcccctctatgg
D2ITA0_MCL1-03          ggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtc
D2ITA0_MCL1-04          ggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtc
F8W4Q8_MCL1-02          ggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagc
Q8UWD6_MCL1-01          ggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagc
F8W4Q8_MCL1-01          ggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagc
Q568W5_MCL1-01          ggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagc
Q568V1_MCL1-01          ggactctcagccggcctctctggacttcatcagatgtatagcaagcacca
Q1L8X3_MCL1-01          ggactctcagccggcctctctggacttcatcagatgtatagcaagcacca
Q9I9N3_MCL1-01          ggactctcagccggcctctctggacttcatcagatgtatagcaagcacca
H2MLZ3_MCL1-01          ggacgaccagggggatgatatgtcatttgtcagcagcgtagcgaagagcc
H2MLZ3_MCL1-02          ggacgaccagggggatgatatgtcatttgtcagcagcgtagcgaagagcc
Q0KFR9_MCL1-01          ggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagacca
A0A087X830_MCL1-01      ggataaccagccggacaatatggggtttgttacggaagtagcagagaatc
H3AR18_MCL1-01          ccataaggag---gacgacctccacattatacccgaaattggtaaccaga
H3AR18_MCL1-02          ccataaggag---gacgacctccacattatacccgaaattggtaaccaga
W5MMB7_MCL1-01          ggagaacaagggtgaggacgtgagcttcgtgacgggcgtggccaaaagct
U3IRH3_MCL1-01          caagaaggag---gaggacctgcaggccgtgggtgaggtggcggcccacc
A0A1D5PQZ2_MCL1-01      caaaaaggaa---gatgacctgcaggctgtgtgtgaggtggctgctcacg
G1MPY7_MCL1-01          caaaaaagaa---gaagatctgcaggcggtgtgtgaggtggctgctcacg
A0A1L1RNM6_MCL1-01      caaaaaggaa---gatgacctgcaggctgtgtgtgaggtggctgctcacg
A0A1L1RNM6_MCL1-02      caaaaaggaa---gatgacctgcaggctgtgtgtgaggtggctgctcacg
U3KKY6_MCL1-01          ccagcaagaa---gaggacctgcagtcggtggtggaggtggctgcccacg
R4GAJ0_MCL1-02          aaagaaagaa---gaggacttggcgtctgtggcagaagtgacaacagagg
R4GAJ0_MCL1-01          aaagaaagaa---gaggacttggcgtctgtggcagaagtgacaacagagg
K7FPN7_MCL1-01          caagaatgag---gaggatctcaagtcagtgtcatcagttgcaacccatg
F6ZMX1_MCL1-01          caaaaacgaa---gaggatattaaagctgtgtctcgagtggcgacccatg
G3WBC5_MCL1-01          caagaacgaa---gaggacattaaggccgtgtctcgcgtggtaactcatg
H0XHA5_MCL1-01          ---------a---gaggatatcaactctttgtctcgagtgatggcccatg
G1QAV8_MCL1-01          cgaaaacgaa---gacaacgtcaaatcttcgtctcaagcgatggttcatg
G1PZ39_MCL1-01          c-------------------ctctgtcttgtccgcgatcgctgg-----g
Q9Z1P3_MCL1-01          taaaaacgag---gacgatgttaaatctttttctcgagtgatgacccatg
P97287_MCL1-02          taaaaacgaa---ggcgatgttaaatctttttctcgagtaatggtccatg
P97287_MCL1-01          taaaaacgaa---ggcgatgttaaatctttttctcgagtaatggtccatg
A0A2K6F6N9_MCL1-01      caaaaacgaa---gacgatgtcaaatctttatcacgagtgatggtccatg
A0A2K5DMS4_MCL1-01      caaaaacgaa---gacaatgtcaaatctttct------------------
A0A286Y1M5_MCL1-01      caaaaacgaa---gacgatgtcaaatccttgtcgcgagtggttgcccttg
G1T2Q0_MCL1-02          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
G1T2Q0_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A287DCH9_MCL1-01      caaaaacgag---gatgatgtcaagtctctgtctcgcgtgatggtccatg
A0A287DCH9_MCL1-02      caaaaacgag---gatgatgtcaagtctctgtctcgcgtgatggtccatg
G3T756_MCL1-01          caaaaacgaa---gatgatgtcaaatctttatctcgagtaatggcccatg
W5QI41_MCL1-01          caaaaacgaa---gacgatgtcaagtctttgtctcgagtgatggttcatg
A5PJR2_MCL1-01          caaaaatgaa---gacgatgtcaaatctttgtctcgagtgatggttcatg
F1MQX4_MCL1-01          caaaaacgaa---gacgatgttaaatctttgtctcgagtgatggttcatg
A0A1S3F3I1_MCL1-01      caaaaacgaa---gacgacgtcaaatctttatctcgagtgatgatccatg
J9PBC4_MCL1-01          caaaaacgaa---gacgatgtcaaatcgttgtctcgagtgattgtccatg
J9PBC4_MCL1-02          caaaaacgaa---gacgatgtcaaatcgttgtctcgagtgattgtccatg
Q8HYS5_MCL1-01          caaaaacgaa---gacgatgtcaaatcgttgtctcgagtgattgtccatg
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          caaaaacgaa---aacgatgtcaaatctttgtctcgagtgatggtccatg
M3XAP4_MCL1-01          caaaaacgaa---aacgatgtcaaatctttgtctcgagtgatggtccatg
M3XAP4_MCL1-03          caaaaacgaa---aacgatgtcaaatctttgtctcgagtgatggtccatg
F7AVA6_MCL1-01          caaaaatgaa---gacgatgtcaaatctttgtctcgagtgatggcccacg
G1L3M8_MCL1-01          caaaaatgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
G1L3M8_MCL1-02          caaaaatgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
M3XZZ5_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtgcatg
Q95KR3_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccacg
K9IWB2_MCL1-02          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccacg
K9IWB2_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccacg
K9IWB2_MCL1-03          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccacg
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      caaaaacaaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5EPY9_MCL1-02      caaaaacaaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
H0XFB7_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K6GI15_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
H2N5Y9_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatggtccatg
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatgatccatg
A0A2K5I9Q7_MCL1-03      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatgatccatg
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatggtccatg
A0A2K6PPL1_MCL1-01      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatggtccatg
A0A2K6KRW9_MCL1-03      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatggtccatg
A0A2K6PPL1_MCL1-03      caaaaacgaa---gacgatgtcaaatctttatctcgagtgatggtccatg
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      caaaaacgaa---gacgatgtcaaatcgttgtctcgagtgatggtccatg
A0A2I3GB35_MCL1-03      caaaaacgaa---gacgatgtcaaatcgttgtctcgagtgatggtccatg
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      caaaaacgaa---gacgatgtcaaatccttgtctcgagtgatggtccatg
A0A2K5LXU8_MCL1-03      caaaaacgaa---gacgatgtcaaatccttgtctcgagtgatggtccatg
A0A0D9RZP5_MCL1-01      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
I7G687_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5W0W9_MCL1-02      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5W0W9_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K6ECR0_MCL1-01      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
F7HUE9_MCL1-02          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K6ECR0_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
F7HUE9_MCL1-01          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5XSC7_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5XSC7_MCL1-01      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2I3M3D6_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2I3M3D6_MCL1-02      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
G2HFR3_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
C8YZ26_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
K7DE58_MCL1-04          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2I2YQH7_MCL1-01      caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2R9BYH6_MCL1-01      caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2R9BYH6_MCL1-03      caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
K7DE58_MCL1-03          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
B4DU51_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
Q07820_MCL1-04          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
B4E3L8_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
B4DLY8_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
Q07820_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
B4DG83_MCL1-01          caaaaacgaa---gacgatgtgaaatcgttgtctcgagtgatgatccatg
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K6V5Y3_MCL1-01      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
A0A2K5CFH3_MCL1-01      caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
F7GTF7_MCL1-03          caaaaacgaa---gacgatgtcaaatctttgtctcgagtgatggtccatg
I3JHR5_MCL1-01          ggatgaaagacacgaggatatgtcatttgtcggtgctgtagcgaagagcc
I3KXG5_MCL1-01          ggatgaaagagaagaagatatgtcatt---------tgtagcgaagagcc
Q4SW32_MCL1-01          ggaggaccgagtaggcgacgtgagctttgtcggcgccgtggctaagagca
G3PJT0_MCL1-01          ggacgaccgaggcgacgacgccagtttcgtgcgggaggtcgccacgagcc
A0A2U9CJ81_MCL1-01      ggacaacagaagggacgatgtgacgtttgtcggcgccgtagccaggagcc
                                                                          

B6V6J0_MCL1-01          tctttaatgacgg----agttacaaattggggccgcattgttacggtcat
F7ETY1_MCL1-01          tctttaatgatgg----agttacaaactggggccggattgttaccgtcat
J7H260_MCL1-01          tcttcagcgatgg----ggttaccaattggggccgtatcgtcaccgtgat
D2ITA0_MCL1-03          tcttcgcagacag----cacaacaaactgggggcgtatcgccagcctggt
D2ITA0_MCL1-04          tcttcgcagacag----cacaacaaactgggggcgtatcgccagcctggt
F8W4Q8_MCL1-02          tctttagcgatgg----caccacaaactggggtcgtattgccagcctgct
Q8UWD6_MCL1-01          tctttagcgatgg----caccacaaactggggtcgtattgccagcctgct
F8W4Q8_MCL1-01          tctttagcgatgg----caccacaaactggggtcgtattgccagcctgct
Q568W5_MCL1-01          tctttagcgatgg----caccacaaactggggtcgtattgccagcctgct
Q568V1_MCL1-01          tgtttaaagatgg----cgtcactaactggggccgaatcgcgagtctggt
Q1L8X3_MCL1-01          tgtttaaagatgg----cgtcactaactggggccgaattgcgagtctggt
Q9I9N3_MCL1-01          tgtttaaagatgg----cgtcactaactggggccgaatcgcgagtctggt
H2MLZ3_MCL1-01          tttttgcggatgg----gaccaccaactggggccgcatcgtcagcctgct
H2MLZ3_MCL1-02          tttttgcggatgg----gaccaccaactggggccgcatcgtcagcctgct
Q0KFR9_MCL1-01          tgttcagtgacgg----gatcacaaactggggtcgcatcgccagcctggt
A0A087X830_MCL1-01      tcttttcagacgg----gaccaccaactggggtcggatcgtcagcctggt
H3AR18_MCL1-01          tctttaaggacgg----tgcaacaaactggggtcgcattgttagtcttat
H3AR18_MCL1-02          tctttaaggacgg----tgcaacaaactggggtcgcattgttagtcttat
W5MMB7_MCL1-01          tgttcagcgacgg----gaagaccaactggggccgcatcgccagcctggt
U3IRH3_MCL1-01          tcttcagcgacgg----ggtgaccaactgggggcgcgtcgtcaccctcat
A0A1D5PQZ2_MCL1-01      ttttcaatgatgg----agtaacaaactggggccgagttgtcacgctcat
G1MPY7_MCL1-01          ttttcagtgatgg----agtaacaaactggggccgagttgtcacactcat
A0A1L1RNM6_MCL1-01      ttttcaatgatgg----agtaacaaactggggccgagttgtcacgctcat
A0A1L1RNM6_MCL1-02      ttttcaatgatgg----agtaacaaactggggccgagttgtcacgctcat
U3KKY6_MCL1-01          tgttcagcgatgg----ggtgaccaactggggacgtgtggtgaccctcat
R4GAJ0_MCL1-02          tcttcagagatgg----cataataaactggggccgcattgtgactctcat
R4GAJ0_MCL1-01          tcttcagagatgg----cataataaactggggccgcattgtgactctcat
K7FPN7_MCL1-01          ttttcagtgatgg----aataacaaactggggtagaattgtaacactcat
F6ZMX1_MCL1-01          ttttcagtgacgg----tataacaaactggggcaggattgtgactctcat
G3WBC5_MCL1-01          tgttcagtgacgg----ggtgacgaattggggcagaattgtgactctcat
H0XHA5_MCL1-01          ttttcagttacgg----cgtaacaaattggggcaggattatgaccctaat
G1QAV8_MCL1-01          cttttagggacgg----agtgacaaac---ggcaggattgtgactc--at
G1PZ39_MCL1-01          ctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcc
Q9Z1P3_MCL1-01          ttttcaaagatgg----cgtaacaaactggggcaggattgtgactcttat
P97287_MCL1-02          ttttcaaagatgg----cgtaacaaactggggcaggattgtgactcttat
P97287_MCL1-01          ttttcaaagatgg----cgtaacaaactggggcaggattgtgactcttat
A0A2K6F6N9_MCL1-01      ttttcagtgacag----cgtaacaaactggggcaggattgtgactttaat
A0A2K5DMS4_MCL1-01      ---------acgg----cgtaacaaactggggtaggattgtgactctcag
A0A286Y1M5_MCL1-01      ttttcagtgacgg----cgtaacaaactggggcaggattgtgactctcat
G1T2Q0_MCL1-02          ttttcagtgatgg----cgtaacaaactggggcaggattgtgactctgat
G1T2Q0_MCL1-01          ttttcagtgatgg----cgtaacaaactggggcaggattgtgactctgat
A0A287DCH9_MCL1-01      ttttcagtgacgg----agtaacaaactggggcaggattgtgactctcat
A0A287DCH9_MCL1-02      ttttcagtgacgg----agtaacaaactggggcaggattgtgactctcat
G3T756_MCL1-01          ttttcagtgacgg----gataacaaactggggcagaattgtgactctcat
W5QI41_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
A5PJR2_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
F1MQX4_MCL1-01          ttttcagtgacag----agtaacaaactggggcaggattgtgactcttat
A0A1S3F3I1_MCL1-01      ttttcagtgacgg----cgtaacaaactggggtaggattgtgactctaat
J9PBC4_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
J9PBC4_MCL1-02          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
Q8HYS5_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
M3XAP4_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
M3XAP4_MCL1-03          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
F7AVA6_MCL1-01          ttttcagtgacgg----agtgacaaactggggcaggattgtgactcttat
G1L3M8_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
G1L3M8_MCL1-02          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
M3XZZ5_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
Q95KR3_MCL1-01          ttttaagtgacgg----agtaacaaactggggcaggattgtgactcttat
K9IWB2_MCL1-02          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
K9IWB2_MCL1-01          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
K9IWB2_MCL1-03          ttttcagtgacgg----agtaacaaactggggcaggattgtgactcttat
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      ttttcagcgacgg----cgtaacaaactggggtaggatcgtgactctcat
A0A2K5EPY9_MCL1-02      ttttcagcgacgg----cgtaacaaactggggtaggatcgtgactctcat
H0XFB7_MCL1-01          ttttcagtgacgg----cgtaacaaactggggcaggattgtgactctaat
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      ttttcagtgacgg----cgtaacaaactggggcaggattgtgactctaat
A0A2K6GI15_MCL1-03      ttttcagtgacgg----cgtaacaaactggggcaggattgtgactctaat
H2N5Y9_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5I9Q7_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6PPL1_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6KRW9_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6PPL1_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I3GB35_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5LXU8_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A0D9RZP5_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
I7G687_MCL1-01          tttttagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5W0W9_MCL1-02      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5W0W9_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6ECR0_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
F7HUE9_MCL1-02          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6ECR0_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
F7HUE9_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5XSC7_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K5XSC7_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I3M3D6_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I3M3D6_MCL1-02      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
G2HFR3_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
C8YZ26_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
K7DE58_MCL1-04          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2I2YQH7_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2R9BYH6_MCL1-01      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2R9BYH6_MCL1-03      ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
K7DE58_MCL1-03          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
B4DU51_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
Q07820_MCL1-04          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
B4E3L8_MCL1-01          ttttcagcgacag----cgtaacaaactggggcaggattgtgactctcat
B4DLY8_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
Q07820_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
B4DG83_MCL1-01          ttttcagcgacgg----cgtaacaaactggggcaggattgtgactctcat
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
A0A2K6V5Y3_MCL1-01      ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
A0A2K5CFH3_MCL1-01      ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
F7GTF7_MCL1-03          ttttcagcgacgg----cgtaacaaactggggtaggattgtgactctcat
I3JHR5_MCL1-01          tctttgcagacca----cacgaccaactggggtcgtattgtcagctttgt
I3KXG5_MCL1-01          tctttggagacca----cacgaccaactggggtcgtattgtcagctttgt
Q4SW32_MCL1-01          cgttcgaggacgg----gaacaccaactggggtcgcgtggccagcctgct
G3PJT0_MCL1-01          tcttcgcggacgg----caccacgaactggggccgcatcgccagcctggt
A0A2U9CJ81_MCL1-01      tcttcggggacgg----caacacaaactggggccgcgtctccagcctggt
                                                                          

B6V6J0_MCL1-01          aagctttggcgcgtttgttgcaaagcatctaaagagcttaaaccttgaag
F7ETY1_MCL1-01          aagctttggtgcgtttgttgcaaagcatctaaagagcatagaccttgaag
J7H260_MCL1-01          aagctttggtgcgtttgtggctaaacatttgaaaagcatccacatggaga
D2ITA0_MCL1-03          ggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaag
D2ITA0_MCL1-04          ggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaag
F8W4Q8_MCL1-02          gacatttggggcaatgctgtgcaaataccagaatgacagaggacatagca
Q8UWD6_MCL1-01          gacatttggggcaatgctgtgcaaataccagaatgacagaggacatagca
F8W4Q8_MCL1-01          gacatttggggcaatgctgtgcaaataccagaatgacagaggacatagca
Q568W5_MCL1-01          gacatttggggcaatgctgtgcaaataccagaatgacagaggacatagca
Q568V1_MCL1-01          ggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatc
Q1L8X3_MCL1-01          ggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatc
Q9I9N3_MCL1-01          ggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatc
H2MLZ3_MCL1-01          ggccttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtc
H2MLZ3_MCL1-02          ggccttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtc
Q0KFR9_MCL1-01          ggcatttggagcagtggtgagccagcacctgaaggagaggggcaggggac
A0A087X830_MCL1-01      ggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagc
H3AR18_MCL1-01          tgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaag
H3AR18_MCL1-02          tgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaag
W5MMB7_MCL1-01          gtcgttcggcgcggtggtggccaagcagatgaaggactcgggccgggaga
U3IRH3_MCL1-01          ctccttcggcgccttcgtcgcccggcacctgaaaagcgtaaagcaggaga
A0A1D5PQZ2_MCL1-01      ctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagaga
G1MPY7_MCL1-01          ctcatttggtgccttcgttgcaaaacacctgaaaagcatcaaccaagaga
A0A1L1RNM6_MCL1-01      ctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagaga
A0A1L1RNM6_MCL1-02      ctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagaga
U3KKY6_MCL1-01          tgcctttggagccttcgtggccaagcacctgaagagcatcaagcaggagc
R4GAJ0_MCL1-02          ctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagaga
R4GAJ0_MCL1-01          ctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagaga
K7FPN7_MCL1-01          ctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggaga
F6ZMX1_MCL1-01          ttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaa
G3WBC5_MCL1-01          ttctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaa
H0XHA5_MCL1-01          ---ttttggtggctttgtggccaagcacctgaagaccataaaccaagaag
G1QAV8_MCL1-01          ttcttttggtgcctttgtagc----cacttgaagagcataaaccaagaaa
G1PZ39_MCL1-01          cgtttccgaaacc----------agcatattctggccatgagtcattgtt
Q9Z1P3_MCL1-01          ttcttttggtgcctttgtggccaaacacttaaagagcataaaccaagaaa
P97287_MCL1-02          ttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaa
P97287_MCL1-01          ttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaa
A0A2K6F6N9_MCL1-01      ttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaagaga
A0A2K5DMS4_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
A0A286Y1M5_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
G1T2Q0_MCL1-02          ttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
G1T2Q0_MCL1-01          ttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
A0A287DCH9_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
A0A287DCH9_MCL1-02      ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
G3T756_MCL1-01          atcttttggtgcctttgtggccaaacacttgaagagcgtaaaccaagaaa
W5QI41_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
A5PJR2_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
F1MQX4_MCL1-01          ttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaa
A0A1S3F3I1_MCL1-01      ttctttcggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
J9PBC4_MCL1-01          ttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
J9PBC4_MCL1-02          ttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
Q8HYS5_MCL1-01          ttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
M3XAP4_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
M3XAP4_MCL1-03          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
F7AVA6_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
G1L3M8_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaag
G1L3M8_MCL1-02          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaag
M3XZZ5_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaa
Q95KR3_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
K9IWB2_MCL1-02          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
K9IWB2_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
K9IWB2_MCL1-03          ttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaa
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
A0A2K5EPY9_MCL1-02      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
H0XFB7_MCL1-01          ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
A0A2K6GI15_MCL1-03      ttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaa
H2N5Y9_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5I9Q7_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K6PPL1_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K6KRW9_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K6PPL1_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I3GB35_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5LXU8_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A0D9RZP5_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
I7G687_MCL1-01          ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
A0A2K5W0W9_MCL1-02      ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
A0A2K5W0W9_MCL1-03      ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
A0A2K6ECR0_MCL1-01      ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
F7HUE9_MCL1-02          ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
A0A2K6ECR0_MCL1-03      ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
F7HUE9_MCL1-01          ttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaa
A0A2K5XSC7_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5XSC7_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I3M3D6_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I3M3D6_MCL1-02      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
G2HFR3_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
C8YZ26_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
K7DE58_MCL1-04          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2I2YQH7_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2R9BYH6_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2R9BYH6_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
K7DE58_MCL1-03          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DU51_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
Q07820_MCL1-04          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4E3L8_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DLY8_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
Q07820_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DG83_MCL1-01          ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
A0A2K6V5Y3_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
A0A2K5CFH3_MCL1-01      ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
F7GTF7_MCL1-03          ttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaa
I3JHR5_MCL1-01          ggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagaca
I3KXG5_MCL1-01          ggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagggaca
Q4SW32_MCL1-01          ggccttcgcagccgtggtggcccagtacttgaacgaccacggtcagaggg
G3PJT0_MCL1-01          ggccttcggggcggtggtgtgccaacacctggcggagcgaggccggggga
A0A2U9CJ81_MCL1-01      ggcgttcggggccgtggtgagtcagcacctgaaggagacgggcaggggga
                                                                          

B6V6J0_MCL1-01          actgc---atcggagttttggcagagcacttcacgcagttcctaatgatg
F7ETY1_MCL1-01          actgt---atcatggctttggcggagcacttcacactattcctaatgaca
J7H260_MCL1-01          actgc---gttggaatcctagcggacagcttcacagactatcttatgacc
D2ITA0_MCL1-03          gctgc---gtgtcgctggtggccgaggagatttcctcatacctcctttca
D2ITA0_MCL1-04          gctgc---gtgtcgctggtggccgaggagatttcctcatacctcctttca
F8W4Q8_MCL1-02          agtat---gtgaggttggtaggggaggagatctcgtcttatctacttaca
Q8UWD6_MCL1-01          agtat---gtgaggttggtaggggaggagatctcgtcttatctacttaca
F8W4Q8_MCL1-01          agtat---gtgaggttggtaggggaggagatctcgtcttatctacttaca
Q568W5_MCL1-01          agtat---gtgaggttggtaggggaggagatctcgtcttatctacttaca
Q568V1_MCL1-01          agtgt---gtggagagagtggctgagcagatctcctcatatctgacctca
Q1L8X3_MCL1-01          agtgt---gtggagagggtggctgagcagatctcctcatatctgacctca
Q9I9N3_MCL1-01          agtgt---gtggagagggtggctgagcagatctcctcatatctgacctca
H2MLZ3_MCL1-01          actgc---gtggacctggtcagtcaggagatctgcacgtacctgctgagt
H2MLZ3_MCL1-02          actgc---gtggacctggtcagtcaggagatctgcacgtacctgctgagt
Q0KFR9_MCL1-01          actgc---gttgagttggtgggccaagagattgccaaatacctcctctct
A0A087X830_MCL1-01      attgc---gtggagctggtgagcaaggaaatatccacgtatctcctggaa
H3AR18_MCL1-01          acagc---attgaacagttggcagtgtcgatcacagactttctggtgcag
H3AR18_MCL1-02          acagc---attgaacagttggcagtgtcgatcacagactttctggtgcag
W5MMB7_MCL1-01          gctgc---gtggaggcggtgggccaggcgatctccaactacctactgcag
U3IRH3_MCL1-01          aaagc---atcggctccctggccaggatcatcaccgac---ctcgtctcg
A0A1D5PQZ2_MCL1-01      aatgc---atcacctcgctggcggggatcatcacggacgcattggtctca
G1MPY7_MCL1-01          aatgc---atcagctcgctggcggggatcatcacagacgctttggtctca
A0A1L1RNM6_MCL1-01      aatgc---atcacctcgctggcggggatcatcacggacgcattggtctca
A0A1L1RNM6_MCL1-02      aatgc---atcacctcgctggcggggatcatcacggacgcattggtctca
U3KKY6_MCL1-01          agagc---atcacttccctggctgggatcatcacagatgcactggtg---
R4GAJ0_MCL1-02          atgct---atcaacactttaatagaaattatcactgatgtgctggtgacg
R4GAJ0_MCL1-01          atgct---atcaacactttaatagaaattatcactgatgtgctggtgacg
K7FPN7_MCL1-01          attgc---atcaacacgctagcagggatcatcacagatgtgcttgtctca
F6ZMX1_MCL1-01          gttgc---atagacccgctagcagaaagcataacagatgttctggtcaag
G3WBC5_MCL1-01          gttgc---atagacccgctagcagaaagcataacagatgtcctggttaaa
H0XHA5_MCL1-01          gctac---atcaaaccgctagaagaaaatatcgcagatgtccttgtgagg
G1QAV8_MCL1-01          gctgc---attgaaccgttagcagaagacatcacagatgttctcgtaggg
G1PZ39_MCL1-01          tccgcccacccgattccttggga---------accgctctccgctcaaag
Q9Z1P3_MCL1-01          gctgc---atcgaacctttagcagaaagtatcacagacgttcttgtaagg
P97287_MCL1-02          gcttc---atcgaaccattagcagaaactatcacagatgttcttgtaagg
P97287_MCL1-01          gcttc---atcgaaccattagcagaaactatcacagatgttcttgtaagg
A0A2K6F6N9_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacattcttgtaagg
A0A2K5DMS4_MCL1-01      gttgc---atcgaaccattagcagaaagtat--cagatattctc------
A0A286Y1M5_MCL1-01      gctgc---atcgaaccattagcggaaagtatcacagatgctctggtgcac
G1T2Q0_MCL1-02          gctgc---atagaacctttagcggaaagtatcacagatgttctcgtcagg
G1T2Q0_MCL1-01          gctgc---atagaacctttagcggaaagtatcacagatgttctcgtcagg
A0A287DCH9_MCL1-01      gctgc---attgaacccttagcagaaagtatcacagacgtgctcgtaagg
A0A287DCH9_MCL1-02      gctgc---attgaacccttagcagaaagtatcacagacgtgctcgtaagg
G3T756_MCL1-01          gccgc---atcgaaccattagcagaaagtatcacagatgttctcgtaagg
W5QI41_MCL1-01          gctgc---atcgaaccactagcagaaagcatcacagatgttctcgtaagg
A5PJR2_MCL1-01          gctgc---atcgaaccactagcagaaagcatcacagatgttctcgtaagg
F1MQX4_MCL1-01          gctgc---atcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A1S3F3I1_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagatgttctcgtaagg
J9PBC4_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
J9PBC4_MCL1-02          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
Q8HYS5_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttcttgtaagg
M3XAP4_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttcttgtaagg
M3XAP4_MCL1-03          gctgc---atcgaaccattagcagaaagcatcacagatgttcttgtaagg
F7AVA6_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgtcctcgtaagg
G1L3M8_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
G1L3M8_MCL1-02          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
M3XZZ5_MCL1-01          gctgc---atcgaaccattagcagaaagcatcacagatgttctcgtaagg
Q95KR3_MCL1-01          gctgc---atcgaaccgttagcagaaagcatcacagatgttctcgtaagg
K9IWB2_MCL1-02          gctgc---atcgaaccgttagcagaaagcatcacagatgttctcgtaagg
K9IWB2_MCL1-01          gctgc---atcgaaccgttagcagaaagcatcacagatgttctcgtaagg
K9IWB2_MCL1-03          gctgc---atcgaaccgttagcagaaagcatcacagatgttctcgtaagg
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      gctgc---attgaaccattagcagaaagtattacagacgttctcgtaagg
A0A2K5EPY9_MCL1-02      gctgc---attgaaccattagcagaaagtattacagacgttctcgtaagg
H0XFB7_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      gctgc---atcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A2K6GI15_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttcttgtaagg
H2N5Y9_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5I9Q7_MCL1-03      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6PPL1_MCL1-01      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6KRW9_MCL1-03      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6PPL1_MCL1-03      gttgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3GB35_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5LXU8_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A0D9RZP5_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
I7G687_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5W0W9_MCL1-02      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5W0W9_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6ECR0_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
F7HUE9_MCL1-02          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6ECR0_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
F7HUE9_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5XSC7_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5XSC7_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3M3D6_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3M3D6_MCL1-02      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
G2HFR3_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
C8YZ26_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
K7DE58_MCL1-04          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I2YQH7_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2R9BYH6_MCL1-01      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2R9BYH6_MCL1-03      gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
K7DE58_MCL1-03          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DU51_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-04          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4E3L8_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DLY8_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DG83_MCL1-01          gctgc---atcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6V5Y3_MCL1-01      gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5CFH3_MCL1-01      gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
F7GTF7_MCL1-03          gctgc---attgaaccattagcagaaagtatcacagacgttctcgtaagg
I3JHR5_MCL1-01          actgc---gtggcgctagtgagccaagaggtttctgcatacctgctgtct
I3KXG5_MCL1-01          actgc---gtggtgctagtgagtcaagagatttctgcatacttgctgtct
Q4SW32_MCL1-01          actgc---gtggagcaggtggcccaggaaatctccacctacctgttgacg
G3PJT0_MCL1-01          actgc---gtggagctggtggggcaggagatctcggcctacctgctgtcg
A0A2U9CJ81_MCL1-01      actgc---gtggagctcgtcgggcaggagatctccacatacctgctgacg
                                                                          

B6V6J0_MCL1-01          agcaaaaaagactggataata---------caggaaaagggatgggat--
F7ETY1_MCL1-01          agcaaaaaagactggataatc---------caggaaaagggatgggag--
J7H260_MCL1-01          cagaagaaagaatggatcgta---------gaacacaatggctgggat--
D2ITA0_MCL1-03          gaccaacgggaatggttggtc---------aaaaacaactcatgggag--
D2ITA0_MCL1-04          gaccaacgggaatggttggtc---------aaaaacaactcatgggag--
F8W4Q8_MCL1-02          gagcagcgggactggatactc---------agaaacaaagcatgggat--
Q8UWD6_MCL1-01          gagcagcgggactggatactc---------agaaacaaagcatgggat--
F8W4Q8_MCL1-01          gagcagcgggactggatactc---------agaaacaaagcatgggat--
Q568W5_MCL1-01          gagcagcgggactggatactc---------agaaacaaagcatgggat--
Q568V1_MCL1-01          gaacagcaggactggatcctc---------aaaaacaagagctgtcat--
Q1L8X3_MCL1-01          gaacagcaggactggatcctc---------aaaaacaagagctggcat--
Q9I9N3_MCL1-01          gaacagcaggactggatcctc---------aaaaacaagagctggcat--
H2MLZ3_MCL1-01          gagcagcggaactggctggtc---------aacaacaactcctgggat--
H2MLZ3_MCL1-02          gagcagcggaactggctggtc---------aacaacaactcctgggat--
Q0KFR9_MCL1-01          gaccaaagtgactggctgatc---------aaaaacaatgcttggaat--
A0A087X830_MCL1-01      aaccagcgggactggctagca---------aaaaacaactcatgggag--
H3AR18_MCL1-01          aataagggagactggatcctc---------aagaaccaaggctggaaa--
H3AR18_MCL1-02          aataagggagactggatcctc---------aagaaccaaggctggaaa--
W5MMB7_MCL1-01          gaccagcgcgagtggcttctg---------aacaaccgaggctgggac--
U3IRH3_MCL1-01          tccaaacgcgagtggctcgtg---------agccagggaggctgggag--
A0A1D5PQZ2_MCL1-01      tccaaacgcgagtggctgatg---------agccagggaggctgggtgag
G1MPY7_MCL1-01          tccaagcgcgagtggctgatg---------agccagggaggctgggag--
A0A1L1RNM6_MCL1-01      tccaaacgcgagtggctgatg---------agccagggaggctgggag--
A0A1L1RNM6_MCL1-02      tccaaacgcgagtggctgatg---------agccagggaggctgggag--
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gacaagagagaatggctattg---------aaacataatgcctgggag--
R4GAJ0_MCL1-01          gacaagagagaatggctattg---------aaacataatgcctggca---
K7FPN7_MCL1-01          gacaaacgagattggctagtt---------aaccaaagaggctgggag--
F6ZMX1_MCL1-01          acaaaacgggactggctgatt---------aagcaaaagggctgggag--
G3WBC5_MCL1-01          tcgaaaagggactggctgatg---------aagcagaagggctgggag--
H0XHA5_MCL1-01          acaaaaccggactggctagtc---------aaacaacgaggctgggat--
G1QAV8_MCL1-01          acagaacgaggctggctagtc---------aaacagagaggctgggat--
G1PZ39_MCL1-01          gccggaaaggtgtgggagacctccaacacttgccatggcttcaaggat--
Q9Z1P3_MCL1-01          acgaagcgggactggcttgtg---------aaacaaagaggctgggat--
P97287_MCL1-02          acgaaacgggactggcttgtc---------aaacaaagaggctgggat--
P97287_MCL1-01          acgaaacgggactggcttgtc---------aaacaaagaggctgggat--
A0A2K6F6N9_MCL1-01      acgaaacgagactggcta--------------------------------
A0A2K5DMS4_MCL1-01      ----------------------------------------gctgggat--
A0A286Y1M5_MCL1-01      tcaaaaagggactggctagtc---------aaacaaagaggctgggat--
G1T2Q0_MCL1-02          acgaaacgggactggctagtc---------aaacaaagaggctgggat--
G1T2Q0_MCL1-01          acgaaacgggactggctagtc---------aaacaaagaggctgggat--
A0A287DCH9_MCL1-01      acaaaacgggactggctggtc---------aaacaaagaggctgggat--
A0A287DCH9_MCL1-02      acaaaacgggactggctggtc---------aaacaaagaggctgggat--
G3T756_MCL1-01          acgaaaagggactggttagtc---------aaacaaagaggctgggat--
W5QI41_MCL1-01          tcaaaacgagactggatagtc---------aaacaaagaggctgggat--
A5PJR2_MCL1-01          tcaaaacgagactggatagtc---------aaacaaagaggctgggat--
F1MQX4_MCL1-01          tcaaaacgagactggatagtc---------aaagaaagaggctgggat--
A0A1S3F3I1_MCL1-01      acaaaacgggactggctagtc---------aaacaaagaggctgggat--
J9PBC4_MCL1-01          acgaaacgagactggctagtc---------aaacaaagaggctgggat--
J9PBC4_MCL1-02          acgaaacgagactggctagtc---------aaacaaagaggctgggat--
Q8HYS5_MCL1-01          acgaaacgagactggctagtc---------aaacaaagaggctgggat--
M3XAP4_MCL1-02          --------------------------------------------ggat--
Q7YRZ9_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
M3XAP4_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
M3XAP4_MCL1-03          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
F7AVA6_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
G1L3M8_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
G1L3M8_MCL1-02          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
M3XZZ5_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
Q95KR3_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
K9IWB2_MCL1-02          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
K9IWB2_MCL1-01          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
K9IWB2_MCL1-03          acaaaacgagactggctagtc---------aaacaaagaggctgggat--
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5EPY9_MCL1-02      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
H0XFB7_MCL1-01          acaaaacgggactggctagtc---------aaacaaagaggctgggat--
A0A2K6GI15_MCL1-01      --------------------------------------------ggat--
A0A2K6GI15_MCL1-02      acaaaacgagactggctagtc---------aaacaaagaggctgggat--
A0A2K6GI15_MCL1-03      acaaaacgagactggctagtc---------aaacaaagaggctgggat--
H2N5Y9_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5I9Q7_MCL1-02      --------------------------------------------ggat--
A0A2K5I9Q7_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5I9Q7_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6KRW9_MCL1-02      --------------------------------------------ggat--
A0A2K6PPL1_MCL1-02      --------------------------------------------ggat--
A0A2K6KRW9_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6PPL1_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6KRW9_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6PPL1_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I3GB35_MCL1-01      --------------------------------------------ggat--
A0A2I3GB35_MCL1-02      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I3GB35_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5LXU8_MCL1-02      --------------------------------------------ggat--
A0A2K5XSC7_MCL1-02      --------------------------------------------ggat--
A0A2K5W0W9_MCL1-01      --------------------------------------------ggat--
A0A2K6ECR0_MCL1-02      --------------------------------------------ggat--
A0A2I3M3D6_MCL1-01      --------------------------------------------ggat--
A0A2K5LXU8_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5LXU8_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A0D9RZP5_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
I7G687_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5W0W9_MCL1-02      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5W0W9_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6ECR0_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
F7HUE9_MCL1-02          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6ECR0_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
F7HUE9_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5XSC7_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5XSC7_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I3M3D6_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I3M3D6_MCL1-02      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
G2HFR3_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
C8YZ26_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
K7DE58_MCL1-04          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I2YQH7_MCL1-02      --------------------------------------------ggat--
A0A2I2YQH7_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2I2YQH7_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2R9BYH6_MCL1-02      --------------------------------------------ggat--
K7DE58_MCL1-02          --------------------------------------------ggat--
Q07820_MCL1-03          --------------------------------------------ggat--
K7DE58_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2R9BYH6_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2R9BYH6_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
K7DE58_MCL1-03          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
B4DU51_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
Q07820_MCL1-04          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
B4E3L8_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
B4DLY8_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
Q07820_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
B4DG83_MCL1-01          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6V5Y3_MCL1-02      --------------------------------------------ggat--
A0A2K6V5Y3_MCL1-03      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K6V5Y3_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5CFH3_MCL1-03      --------------------------------------------ggat--
A0A2K5CFH3_MCL1-02      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
A0A2K5CFH3_MCL1-01      acaaaacgggactggctagtt---------aaacaaagaggctgggat--
F7GTF7_MCL1-01          --------------------------------------------ggat--
F7GTF7_MCL1-02          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
F7GTF7_MCL1-03          acaaaacgggactggctagtt---------aaacaaagaggctgggat--
I3JHR5_MCL1-01          gaacagcgagactggattgtc---------aaaaacaatgcatgggat--
I3KXG5_MCL1-01          gaacagcgagactggattatc---------aaaaacaatgcatgggat--
Q4SW32_MCL1-01          gaccagcgcgactggctgatc---------aaaaacaacgcctgggac--
G3PJT0_MCL1-01          gaccagcgggactggctgatc---------aaaaacaacgcctgggtt--
A0A2U9CJ81_MCL1-01      gaccagcgagactggctggtg---------aaaaacaactcctgggag--
                                                                          

B6V6J0_MCL1-01          ----------------gg------cttt-------gtggacttttttcac
F7ETY1_MCL1-01          ----------------gg------cttt-------gtggacttttttcac
J7H260_MCL1-01          ----------------gg------ctgt-------gtcgaattctttcac
D2ITA0_MCL1-03          ----------------gg------cttc-------gtagagttttttcga
D2ITA0_MCL1-04          ----------------gg------cttc-------gtagagttttttcga
F8W4Q8_MCL1-02          ----------------gg------cttt-------gtggagttttttcat
Q8UWD6_MCL1-01          ----------------gg------cttt-------gtggagttttttcat
F8W4Q8_MCL1-01          ----------------gg------cttt-------gtggagttttttcat
Q568W5_MCL1-01          ----------------gg------cttt-------gtggagttttttcat
Q568V1_MCL1-01          ----------------gg------gttc-------gtggagtttttccac
Q1L8X3_MCL1-01          ----------------gg------gttc-------gtggagtttttccac
Q9I9N3_MCL1-01          ----------------gg------gttt-------gtggagtttttccac
H2MLZ3_MCL1-01          ----------------gg------tttc-------gtagagttctttcgc
H2MLZ3_MCL1-02          ----------------gg------tttc-------gtagagttctttcgc
Q0KFR9_MCL1-01          ----------------gg------attt-------gtagagttctttcat
A0A087X830_MCL1-01      ----------------gg------cttt-------gtggagttctttaga
H3AR18_MCL1-01          ----------------gg------attt-------gttgactttttccat
H3AR18_MCL1-02          ----------------gg------attt-------gttgactttttccat
W5MMB7_MCL1-01          ----------------gg------cttc-------gtggagttcttccgc
U3IRH3_MCL1-01          ----------------gg------tttc-------gtcgactttttccga
A0A1D5PQZ2_MCL1-01      tcactgcccaccacgagg------ctttcagaacgattcagtgtttccta
G1MPY7_MCL1-01          ----------------gg------cttt-------gtcgacttcttccga
A0A1L1RNM6_MCL1-01      ----------------gg------cttt-------gttgacttcttccga
A0A1L1RNM6_MCL1-02      ----------------gg------cttt-------gttgacttcttccga
U3KKY6_MCL1-01          ------------------------------------------tcctcca-
R4GAJ0_MCL1-02          ----------------gg------attt-------gttcagttcttccat
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          ----------------gg------attt-------gttgaattcttccgt
F6ZMX1_MCL1-01          ----------------gg------attt-------gtggaattctttcat
G3WBC5_MCL1-01          ----------------gg------gttt-------gtggaattctttcat
H0XHA5_MCL1-01          ----------------gg------cttt-------gtggagttcttctac
G1QAV8_MCL1-01          ----------------gg------gttt-------gtggaattcttccag
G1PZ39_MCL1-01          ----------------gg------gttt-------gtggaattcttccat
Q9Z1P3_MCL1-01          ----------------gg------gttt-------gtggagttcttccac
P97287_MCL1-02          ----------------gg------gttt-------gtggagttcttccac
P97287_MCL1-01          ----------------gg------gttt-------gtggagttcttccac
A0A2K6F6N9_MCL1-01      -----------------------------------------ttcttccat
A0A2K5DMS4_MCL1-01      ----------------gg------gttt-------gtggagttcttccgt
A0A286Y1M5_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
G1T2Q0_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
G1T2Q0_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A287DCH9_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A287DCH9_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
G3T756_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
W5QI41_MCL1-01          ----------------gg------gttt-------gtggagttcttccgt
A5PJR2_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
F1MQX4_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A1S3F3I1_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
J9PBC4_MCL1-01          ----------------ggaggggtgtgg-------ggggagtggtccacc
J9PBC4_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
Q8HYS5_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
M3XAP4_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
Q7YRZ9_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
M3XAP4_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
M3XAP4_MCL1-03          ----------------gg------gttt-------gtggagttcttccat
F7AVA6_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
G1L3M8_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
G1L3M8_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
M3XZZ5_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
Q95KR3_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
K9IWB2_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
K9IWB2_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
K9IWB2_MCL1-03          ----------------gg------gttt-------gtggagttcttccat
A0A2K5C7L5_MCL1-01      ----------------------------------------gttcttccat
A0A2K5EPY9_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K5EPY9_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
H0XFB7_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2K6GI15_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K6GI15_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K6GI15_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
H2N5Y9_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2K5I9Q7_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K5I9Q7_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K5I9Q7_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K6KRW9_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K6PPL1_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K6KRW9_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K6PPL1_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K6KRW9_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K6PPL1_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2I3GB35_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2I3GB35_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2I3GB35_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K5LXU8_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K5XSC7_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K5W0W9_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K6ECR0_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2I3M3D6_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K5LXU8_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K5LXU8_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A0D9RZP5_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
I7G687_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2K5W0W9_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K5W0W9_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K6ECR0_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
F7HUE9_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
A0A2K6ECR0_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
F7HUE9_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2K5XSC7_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K5XSC7_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2I3M3D6_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2I3M3D6_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
G2HFR3_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
C8YZ26_MCL1-01          ----------------gg------gttt-------gtggagttcttccaa
K7DE58_MCL1-04          ----------------gg------gttt-------gtggagttcttccat
A0A2I2YQH7_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2I2YQH7_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2I2YQH7_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2R9BYH6_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
K7DE58_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
Q07820_MCL1-03          ----------------gg------gttt-------gtggagttcttccat
K7DE58_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2R9BYH6_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2R9BYH6_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
K7DE58_MCL1-03          ----------------gg------gttt-------gtggagttcttccat
B4DU51_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
Q07820_MCL1-04          ----------------gg------gttt-------gtggagttcttccat
B4E3L8_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
B4DLY8_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
Q07820_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
B4DG83_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
A0A2K6V5Y3_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K6V5Y3_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K6V5Y3_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
A0A2K5CFH3_MCL1-03      ----------------gg------gttt-------gtggagttcttccat
A0A2K5CFH3_MCL1-02      ----------------gg------gttt-------gtggagttcttccat
A0A2K5CFH3_MCL1-01      ----------------gg------gttt-------gtggagttcttccat
F7GTF7_MCL1-01          ----------------gg------gttt-------gtggagttcttccat
F7GTF7_MCL1-02          ----------------gg------gttt-------gtggagttcttccat
F7GTF7_MCL1-03          ----------------gg------gttt-------gtggagttcttccat
I3JHR5_MCL1-01          ----------------gg------cttt-------gtggagttctttcga
I3KXG5_MCL1-01          ----------------gg------cttt-------gtggcgttcgttcga
Q4SW32_MCL1-01          ----------------gg------attt-------gtggagtttttccaa
G3PJT0_MCL1-01          ----------------gg------cttc-------gttgagttctttcga
A0A2U9CJ81_MCL1-01      ----------------gg------cttt-------gtggaatttttccga
                                                                          

B6V6J0_MCL1-01          atagaaga----ttatgaaagtgga-------ctgaaaactg--ttttga
F7ETY1_MCL1-01          atagaaga----ctatgaaagtgga-------ctcagaactg--ttttga
J7H260_MCL1-01          gtcgagga----ctatgagagtgga-------ctaaaaacag--tcttga
D2ITA0_MCL1-03          gtgtcaga----ccctgagacgaca-------gtgagaaata--cactca
D2ITA0_MCL1-04          gtgtcaga----ccctgagacgaca-------gtgagaaata--cactca
F8W4Q8_MCL1-02          gtcccgga----tacagaggcagct-------gtgagaaaca--cacttc
Q8UWD6_MCL1-01          gtcccgga----tacagaggcagct-------gtgagaaaca--cacttc
F8W4Q8_MCL1-01          gtcccgga----tacagaggcagct-------gtgagaaaca--cacttc
Q568W5_MCL1-01          gtcccgga----tacagaggcagct-------gtgagaaaca--cacttc
Q568V1_MCL1-01          caggagga----cgtagagtctgtt-------gtccgtcatg--gtctgt
Q1L8X3_MCL1-01          caggagga----cgtagagtctgtt-------gtccgtcatg--gtctgt
Q9I9N3_MCL1-01          caggagga----tgtagagtctgtt-------gtccgtcatg--gtcttt
H2MLZ3_MCL1-01          gtttcaga----cccagaaacgaca-------gtcaggaaca--ctttgg
H2MLZ3_MCL1-02          gtttcaga----cccagaaacgaca-------gtcaggaaca--ctttgg
Q0KFR9_MCL1-01          gtacaaga----tcctgagtcctca-------gtaaggaaca--ccctcc
A0A087X830_MCL1-01      gtatcaga----tcctgagtctaca-------gtgaggaaca--cgctga
H3AR18_MCL1-01          gtagaaga----tgcagagggtaca-------atcaaaaatg--tattga
H3AR18_MCL1-02          gtagaaga----tgcagagggtaca-------atcaaaaatg--tattga
W5MMB7_MCL1-01          gtggagga----ccccga-gtcgac------gatcaggaacg--ccctga
U3IRH3_MCL1-01          gtggaaga----cctggaaggcagc-------atcaggaacg--tgctga
A0A1D5PQZ2_MCL1-01      tttccgtaacccactgggtgtcagctgcctgtgtcagcgaag--tgcaga
G1MPY7_MCL1-01          gttgagga----cctggaaagcagc-------atcaggaatg--tgctga
A0A1L1RNM6_MCL1-01      gttgagga----cctggaaagcagc-------atcaggaatg--tgctga
A0A1L1RNM6_MCL1-02      gttgagga----cctggaaagcagc-------atcaggaatg--tgctga
U3KKY6_MCL1-01          --------------------------------------aacg--------
R4GAJ0_MCL1-02          gtagagga----catagaaggtggc-------atcaggaatg--ttctgg
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          gtagagga----tctagaaggtagc-------atcaggaatg--ttctgg
F6ZMX1_MCL1-01          gtacagga----cctagaaggtggc-------atcagaaatg--tgctgc
G3WBC5_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
H0XHA5_MCL1-01          ctggaaga----cctggaaagcagc-------gtcagaaacg--tgctgc
G1QAV8_MCL1-01          gtggagga----cctagaaggcggc-------gtcagaaatg--tgctgc
G1PZ39_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
Q9Z1P3_MCL1-01          gtacagga----cctagaaggcggc-------atcagaaatg--tgctgc
P97287_MCL1-02          gtacagga----cctagaaggcggc-------atcagaaatg--tgctgc
P97287_MCL1-01          gtacagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A2K6F6N9_MCL1-01      gtagaaga----cctggaaggcagc-------atcagaaatg--tgctgc
A0A2K5DMS4_MCL1-01      gtagagga----cttagaaggtggc-------atcagaaatg--ggctgc
A0A286Y1M5_MCL1-01      atagagga----tctagaaggcggc-------atcagaaatg--tgctgc
G1T2Q0_MCL1-02          gtagagga----cctagaaagcggc-------atcagaaatg--tgctgc
G1T2Q0_MCL1-01          gtagagga----cctagaaagcggc-------atcagaaatg--tgctgc
A0A287DCH9_MCL1-01      gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A287DCH9_MCL1-02      gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
G3T756_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
W5QI41_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A5PJR2_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
F1MQX4_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A1S3F3I1_MCL1-01      gtagagga----cctagaaggcagc-------atcagaaatg--tgctgc
J9PBC4_MCL1-01          ccctctga----ccttaagggtgag-------agcaggaaggaatgctgc
J9PBC4_MCL1-02          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
Q8HYS5_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
M3XAP4_MCL1-02          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
Q7YRZ9_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
M3XAP4_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
M3XAP4_MCL1-03          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7AVA6_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
G1L3M8_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
G1L3M8_MCL1-02          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
M3XZZ5_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
Q95KR3_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
K9IWB2_MCL1-02          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
K9IWB2_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
K9IWB2_MCL1-03          gtagagga----cctagaaggc----------------------------
A0A2K5C7L5_MCL1-01      gtagaaga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5EPY9_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5EPY9_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
H0XFB7_MCL1-01          gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A2K6GI15_MCL1-01      gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A2K6GI15_MCL1-02      gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
A0A2K6GI15_MCL1-03      gtagagga----cctagaaggcggc-------atcagaaatg--tgctgc
H2N5Y9_MCL1-01          gtagagga----cctagaaggaggc-------atcagaaatg--tgctgc
A0A2K5I9Q7_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5I9Q7_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5I9Q7_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6KRW9_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6PPL1_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6KRW9_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6PPL1_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6KRW9_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6PPL1_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3GB35_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3GB35_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3GB35_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5LXU8_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5XSC7_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5W0W9_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6ECR0_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3M3D6_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5LXU8_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5LXU8_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A0D9RZP5_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
I7G687_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5W0W9_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5W0W9_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6ECR0_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7HUE9_MCL1-02          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6ECR0_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7HUE9_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5XSC7_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5XSC7_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3M3D6_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2I3M3D6_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
G2HFR3_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
C8YZ26_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
K7DE58_MCL1-04          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2I2YQH7_MCL1-02      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2I2YQH7_MCL1-03      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2I2YQH7_MCL1-01      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2R9BYH6_MCL1-02      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
K7DE58_MCL1-02          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
Q07820_MCL1-03          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
K7DE58_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2R9BYH6_MCL1-01      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2R9BYH6_MCL1-03      gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
K7DE58_MCL1-03          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
B4DU51_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
Q07820_MCL1-04          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
B4E3L8_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
B4DLY8_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
Q07820_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
B4DG83_MCL1-01          gtagagga----cctagaaggtggc-------atcaggaatg--tgctgc
A0A2K6V5Y3_MCL1-02      gtagagga----tctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6V5Y3_MCL1-03      gtagagga----tctagaaggtggc-------atcagaaatg--tgctgc
A0A2K6V5Y3_MCL1-01      gtagagga----tctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5CFH3_MCL1-03      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5CFH3_MCL1-02      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
A0A2K5CFH3_MCL1-01      gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7GTF7_MCL1-01          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7GTF7_MCL1-02          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
F7GTF7_MCL1-03          gtagagga----cctagaaggtggc-------atcagaaatg--tgctgc
I3JHR5_MCL1-01          gtagcaga----ccctga-gtccac------ggtcaggaaca--cactca
I3KXG5_MCL1-01          gtagcaga----ccctga-gtcgat------agtcaggaaca--cactca
Q4SW32_MCL1-01          gtgccgga----cccgga-gtcgac------ggtccggaccg--tgctga
G3PJT0_MCL1-01          gtagcaga----cccaga-gtctgc------ggtgaggaaca--ctctca
A0A2U9CJ81_MCL1-01      gtagcaga----cccaga-gacgac------aatgaggaaca--cactga
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          ccttcctgggccgctgaggctggaaggtggggggctgacctcagcctcca
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          -------------tggct--------------------------------
F7ETY1_MCL1-01          -------------tggct--------------------------------
J7H260_MCL1-01          -------------tggcc--------------------------------
D2ITA0_MCL1-03          -------------tggcc--------------------------------
D2ITA0_MCL1-04          -------------tggcc--------------------------------
F8W4Q8_MCL1-02          -------------taaca--------------------------------
Q8UWD6_MCL1-01          -------------taaca--------------------------------
F8W4Q8_MCL1-01          -------------taaca--------------------------------
Q568W5_MCL1-01          -------------taaca--------------------------------
Q568V1_MCL1-01          -------------tggcg--------------------------------
Q1L8X3_MCL1-01          -------------tggcg--------------------------------
Q9I9N3_MCL1-01          -------------tggcg--------------------------------
H2MLZ3_MCL1-01          -------------tggcc--------------------------------
H2MLZ3_MCL1-02          -------------tggcc--------------------------------
Q0KFR9_MCL1-01          -------------tagcc--------------------------------
A0A087X830_MCL1-01      -------------tggcg--------------------------------
H3AR18_MCL1-01          -------------tgaca--------------------------------
H3AR18_MCL1-02          -------------tgaca--------------------------------
W5MMB7_MCL1-01          -------------tggcg--------------------------------
U3IRH3_MCL1-01          -------------tggcg--------------------------------
A0A1D5PQZ2_MCL1-01      -------------t------------------------------------
G1MPY7_MCL1-01          -------------tggcc--------------------------------
A0A1L1RNM6_MCL1-01      -------------tggcc--------------------------------
A0A1L1RNM6_MCL1-02      -------------tggcc--------------------------------
U3KKY6_MCL1-01          ----------------cc--------------------------------
R4GAJ0_MCL1-02          -------------tggct--------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          -------------tggct--------------------------------
F6ZMX1_MCL1-01          -------------tcgcc--------------------------------
G3WBC5_MCL1-01          -------------tcgcc--------------------------------
H0XHA5_MCL1-01          -------------tggct--------------------------------
G1QAV8_MCL1-01          -------------tggct--------------------------------
G1PZ39_MCL1-01          -------------tggct--------------------------------
Q9Z1P3_MCL1-01          -------------tggct--------------------------------
P97287_MCL1-02          -------------tggct--------------------------------
P97287_MCL1-01          -------------tggct--------------------------------
A0A2K6F6N9_MCL1-01      -------------tggct--------------------------------
A0A2K5DMS4_MCL1-01      -------------tggct--------------------------------
A0A286Y1M5_MCL1-01      -------------tggct--------------------------------
G1T2Q0_MCL1-02          -------------tggct--------------------------------
G1T2Q0_MCL1-01          -------------tggct--------------------------------
A0A287DCH9_MCL1-01      -------------tggct--------------------------------
A0A287DCH9_MCL1-02      -------------tggct--------------------------------
G3T756_MCL1-01          -------------tggct--------------------------------
W5QI41_MCL1-01          -------------tggct--------------------------------
A5PJR2_MCL1-01          -------------tggct--------------------------------
F1MQX4_MCL1-01          -------------tggct--------------------------------
A0A1S3F3I1_MCL1-01      -------------tggct--------------------------------
J9PBC4_MCL1-01          gaccgtggctcagtggctcagtcccctcctgtcagcctgcaggaactcct
J9PBC4_MCL1-02          -------------tggct--------------------------------
Q8HYS5_MCL1-01          -------------tggct--------------------------------
M3XAP4_MCL1-02          -------------tggct--------------------------------
Q7YRZ9_MCL1-01          -------------tggct--------------------------------
M3XAP4_MCL1-01          -------------tggct--------------------------------
M3XAP4_MCL1-03          -------------tggct--------------------------------
F7AVA6_MCL1-01          -------------tggct--------------------------------
G1L3M8_MCL1-01          -------------tggct--------------------------------
G1L3M8_MCL1-02          -------------tggct--------------------------------
M3XZZ5_MCL1-01          -------------tggct--------------------------------
Q95KR3_MCL1-01          -------------tggct--------------------------------
K9IWB2_MCL1-02          -------------tggct--------------------------------
K9IWB2_MCL1-01          -------------tggct--------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      -------------tggct--------------------------------
A0A2K5EPY9_MCL1-01      -------------tggct--------------------------------
A0A2K5EPY9_MCL1-02      -------------tggct--------------------------------
H0XFB7_MCL1-01          -------------tggct--------------------------------
A0A2K6GI15_MCL1-01      -------------tggct--------------------------------
A0A2K6GI15_MCL1-02      -------------tggct--------------------------------
A0A2K6GI15_MCL1-03      -------------tggct--------------------------------
H2N5Y9_MCL1-01          -------------tggct--------------------------------
A0A2K5I9Q7_MCL1-02      -------------tggct--------------------------------
A0A2K5I9Q7_MCL1-01      -------------tggct--------------------------------
A0A2K5I9Q7_MCL1-03      -------------tggct--------------------------------
A0A2K6KRW9_MCL1-02      -------------tggct--------------------------------
A0A2K6PPL1_MCL1-02      -------------tggct--------------------------------
A0A2K6KRW9_MCL1-01      -------------tggct--------------------------------
A0A2K6PPL1_MCL1-01      -------------tggct--------------------------------
A0A2K6KRW9_MCL1-03      -------------tggct--------------------------------
A0A2K6PPL1_MCL1-03      -------------tggct--------------------------------
A0A2I3GB35_MCL1-01      -------------tggct--------------------------------
A0A2I3GB35_MCL1-02      -------------tggct--------------------------------
A0A2I3GB35_MCL1-03      -------------tggct--------------------------------
A0A2K5LXU8_MCL1-02      -------------tggct--------------------------------
A0A2K5XSC7_MCL1-02      -------------tggct--------------------------------
A0A2K5W0W9_MCL1-01      -------------tggct--------------------------------
A0A2K6ECR0_MCL1-02      -------------tggct--------------------------------
A0A2I3M3D6_MCL1-01      -------------tggct--------------------------------
A0A2K5LXU8_MCL1-01      -------------tggct--------------------------------
A0A2K5LXU8_MCL1-03      -------------tggct--------------------------------
A0A0D9RZP5_MCL1-01      -------------tggct--------------------------------
I7G687_MCL1-01          -------------tggct--------------------------------
A0A2K5W0W9_MCL1-02      -------------tggct--------------------------------
A0A2K5W0W9_MCL1-03      -------------tggct--------------------------------
A0A2K6ECR0_MCL1-01      -------------tggct--------------------------------
F7HUE9_MCL1-02          -------------tggct--------------------------------
A0A2K6ECR0_MCL1-03      -------------tggct--------------------------------
F7HUE9_MCL1-01          -------------tggct--------------------------------
A0A2K5XSC7_MCL1-03      -------------tggct--------------------------------
A0A2K5XSC7_MCL1-01      -------------tggct--------------------------------
A0A2I3M3D6_MCL1-03      -------------tggct--------------------------------
A0A2I3M3D6_MCL1-02      -------------tggct--------------------------------
G2HFR3_MCL1-01          -------------tggct--------------------------------
C8YZ26_MCL1-01          -------------tggct--------------------------------
K7DE58_MCL1-04          -------------tggct--------------------------------
A0A2I2YQH7_MCL1-02      -------------tggct--------------------------------
A0A2I2YQH7_MCL1-03      -------------tggct--------------------------------
A0A2I2YQH7_MCL1-01      -------------tggct--------------------------------
A0A2R9BYH6_MCL1-02      -------------tggct--------------------------------
K7DE58_MCL1-02          -------------tggct--------------------------------
Q07820_MCL1-03          -------------tggct--------------------------------
K7DE58_MCL1-01          -------------tggct--------------------------------
A0A2R9BYH6_MCL1-01      -------------tggct--------------------------------
A0A2R9BYH6_MCL1-03      -------------tggct--------------------------------
K7DE58_MCL1-03          -------------tggct--------------------------------
B4DU51_MCL1-01          -------------tggct--------------------------------
Q07820_MCL1-04          -------------tggct--------------------------------
B4E3L8_MCL1-01          -------------tggct--------------------------------
B4DLY8_MCL1-01          -------------tggct--------------------------------
Q07820_MCL1-01          -------------tggct--------------------------------
B4DG83_MCL1-01          -------------tggct--------------------------------
A0A2K6V5Y3_MCL1-02      -------------tggct--------------------------------
A0A2K6V5Y3_MCL1-03      -------------tggct--------------------------------
A0A2K6V5Y3_MCL1-01      -------------tggct--------------------------------
A0A2K5CFH3_MCL1-03      -------------tggct--------------------------------
A0A2K5CFH3_MCL1-02      -------------tggct--------------------------------
A0A2K5CFH3_MCL1-01      -------------tggct--------------------------------
F7GTF7_MCL1-01          -------------tggct--------------------------------
F7GTF7_MCL1-02          -------------tggct--------------------------------
F7GTF7_MCL1-03          -------------tggct--------------------------------
I3JHR5_MCL1-01          -------------tggcc--------------------------------
I3KXG5_MCL1-01          -------------tggcc--------------------------------
Q4SW32_MCL1-01          -------------tggcc--------------------------------
G3PJT0_MCL1-01          -------------tggct--------------------------------
A0A2U9CJ81_MCL1-01      -------------ttggc--------------------------------
                                                                          

B6V6J0_MCL1-01          ------------------------------ttctcaag------------
F7ETY1_MCL1-01          ------------------------------ttctcaag------------
J7H260_MCL1-01          ------------------------------ttcgctgg------------
D2ITA0_MCL1-03          ------------------------------tttgctgg------------
D2ITA0_MCL1-04          ------------------------------tttgctgg------------
F8W4Q8_MCL1-02          ------------------------------attggtgg------------
Q8UWD6_MCL1-01          ------------------------------attggtag------------
F8W4Q8_MCL1-01          ------------------------------attggtgg------------
Q568W5_MCL1-01          ------------------------------attggtgg------------
Q568V1_MCL1-01          ------------------------------ctggtcgg------------
Q1L8X3_MCL1-01          ------------------------------ctggtcgg------------
Q9I9N3_MCL1-01          ------------------------------ctggtcgg------------
H2MLZ3_MCL1-01          ------------------------------ttccttgg------------
H2MLZ3_MCL1-02          ------------------------------ttccttgg------------
Q0KFR9_MCL1-01          ------------------------------tttgctgg------------
A0A087X830_MCL1-01      ------------------------------tttgttgg------------
H3AR18_MCL1-01          ------------------------------tttgcggg------------
H3AR18_MCL1-02          ------------------------------tttgcggg------------
W5MMB7_MCL1-01          ------------------------------tttgccgg------------
U3IRH3_MCL1-01          ------------------------------ttcgcagg------------
A0A1D5PQZ2_MCL1-01      -------------------------------------g------------
G1MPY7_MCL1-01          ------------------------------tttgcagg------------
A0A1L1RNM6_MCL1-01      ------------------------------tttgcagg------------
A0A1L1RNM6_MCL1-02      ------------------------------tttgcagg------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ------------------------------tttgccag------------
R4GAJ0_MCL1-01          ----------------------------------caac------------
K7FPN7_MCL1-01          ------------------------------tttgcagg------------
F6ZMX1_MCL1-01          ------------------------------tttgccgg------------
G3WBC5_MCL1-01          ------------------------------tttgccgg------------
H0XHA5_MCL1-01          ------------------------------ttcgcagg------------
G1QAV8_MCL1-01          ------------------------------tttgcagg------------
G1PZ39_MCL1-01          ------------------------------tttgcagg------------
Q9Z1P3_MCL1-01          ------------------------------tttgcggg------------
P97287_MCL1-02          ------------------------------tttgcggg------------
P97287_MCL1-01          ------------------------------tttgcggg------------
A0A2K6F6N9_MCL1-01      ------------------------------tttgctgg------------
A0A2K5DMS4_MCL1-01      ------------------------------ttcgcagg------------
A0A286Y1M5_MCL1-01      ------------------------------tttgcagg------------
G1T2Q0_MCL1-02          ------------------------------tttgcggg------------
G1T2Q0_MCL1-01          ------------------------------tttgcggg------------
A0A287DCH9_MCL1-01      ------------------------------ttcgcagg------------
A0A287DCH9_MCL1-02      ------------------------------ttcgcagg------------
G3T756_MCL1-01          ------------------------------tttgcagg------------
W5QI41_MCL1-01          ------------------------------tttgcagg------------
A5PJR2_MCL1-01          ------------------------------tttgcagg------------
F1MQX4_MCL1-01          ------------------------------tttgcagg------------
A0A1S3F3I1_MCL1-01      ------------------------------tttgcagg------------
J9PBC4_MCL1-01          cagctcctccctcctccccactagggattgtttacaggacagcttgggcc
J9PBC4_MCL1-02          ------------------------------tttgcagg------------
Q8HYS5_MCL1-01          ------------------------------tttgcagg------------
M3XAP4_MCL1-02          ------------------------------tttgcagg------------
Q7YRZ9_MCL1-01          ------------------------------tttgcagg------------
M3XAP4_MCL1-01          ------------------------------tttgcagg------------
M3XAP4_MCL1-03          ------------------------------tttgcagg------------
F7AVA6_MCL1-01          ------------------------------tttgcagg------------
G1L3M8_MCL1-01          ------------------------------tttgcagg------------
G1L3M8_MCL1-02          ------------------------------tttgcagg------------
M3XZZ5_MCL1-01          ------------------------------tttgcagg------------
Q95KR3_MCL1-01          ------------------------------tttgcagg------------
K9IWB2_MCL1-02          ------------------------------tttgcagg------------
K9IWB2_MCL1-01          ------------------------------tttgcagg------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      ------------------------------tttgcagg------------
A0A2K5EPY9_MCL1-01      ------------------------------tttgcatg------------
A0A2K5EPY9_MCL1-02      ------------------------------tttgcatg------------
H0XFB7_MCL1-01          ------------------------------tttgcggg------------
A0A2K6GI15_MCL1-01      ------------------------------tttgcagg------------
A0A2K6GI15_MCL1-02      ------------------------------tttgcagg------------
A0A2K6GI15_MCL1-03      ------------------------------tttgcagg------------
H2N5Y9_MCL1-01          ------------------------------tttgcagg------------
A0A2K5I9Q7_MCL1-02      ------------------------------tttgcagg------------
A0A2K5I9Q7_MCL1-01      ------------------------------tttgcagg------------
A0A2K5I9Q7_MCL1-03      ------------------------------tttgcagg------------
A0A2K6KRW9_MCL1-02      ------------------------------tttgcagg------------
A0A2K6PPL1_MCL1-02      ------------------------------tttgcagg------------
A0A2K6KRW9_MCL1-01      ------------------------------tttgcagg------------
A0A2K6PPL1_MCL1-01      ------------------------------tttgcagg------------
A0A2K6KRW9_MCL1-03      ------------------------------tttgcagg------------
A0A2K6PPL1_MCL1-03      ------------------------------tttgcagg------------
A0A2I3GB35_MCL1-01      ------------------------------tttgcagg------------
A0A2I3GB35_MCL1-02      ------------------------------tttgcagg------------
A0A2I3GB35_MCL1-03      ------------------------------tttgcagg------------
A0A2K5LXU8_MCL1-02      ------------------------------gttgcagg------------
A0A2K5XSC7_MCL1-02      ------------------------------tttgcagg------------
A0A2K5W0W9_MCL1-01      ------------------------------tttgcagg------------
A0A2K6ECR0_MCL1-02      ------------------------------tttgcagg------------
A0A2I3M3D6_MCL1-01      ------------------------------tttgcagg------------
A0A2K5LXU8_MCL1-01      ------------------------------gttgcagg------------
A0A2K5LXU8_MCL1-03      ------------------------------gttgcagg------------
A0A0D9RZP5_MCL1-01      ------------------------------tttgcagg------------
I7G687_MCL1-01          ------------------------------tttgcagg------------
A0A2K5W0W9_MCL1-02      ------------------------------tttgcagg------------
A0A2K5W0W9_MCL1-03      ------------------------------tttgcagg------------
A0A2K6ECR0_MCL1-01      ------------------------------tttgcagg------------
F7HUE9_MCL1-02          ------------------------------tttgcagg------------
A0A2K6ECR0_MCL1-03      ------------------------------tttgcagg------------
F7HUE9_MCL1-01          ------------------------------tttgcagg------------
A0A2K5XSC7_MCL1-03      ------------------------------tttgcagg------------
A0A2K5XSC7_MCL1-01      ------------------------------tttgcagg------------
A0A2I3M3D6_MCL1-03      ------------------------------tttgcagg------------
A0A2I3M3D6_MCL1-02      ------------------------------tttgcagg------------
G2HFR3_MCL1-01          ------------------------------tttgcagg------------
C8YZ26_MCL1-01          ------------------------------tttgcagg------------
K7DE58_MCL1-04          ------------------------------tttgcagg------------
A0A2I2YQH7_MCL1-02      ------------------------------tttgcagg------------
A0A2I2YQH7_MCL1-03      ------------------------------tttgcagg------------
A0A2I2YQH7_MCL1-01      ------------------------------tttgcagg------------
A0A2R9BYH6_MCL1-02      ------------------------------tttgcagg------------
K7DE58_MCL1-02          ------------------------------tttgcagg------------
Q07820_MCL1-03          ------------------------------tttgcagg------------
K7DE58_MCL1-01          ------------------------------tttgcagg------------
A0A2R9BYH6_MCL1-01      ------------------------------tttgcagg------------
A0A2R9BYH6_MCL1-03      ------------------------------tttgcagg------------
K7DE58_MCL1-03          ------------------------------tttgcagg------------
B4DU51_MCL1-01          ------------------------------tttgcagg------------
Q07820_MCL1-04          ------------------------------tttgcagg------------
B4E3L8_MCL1-01          ------------------------------tttgcagg------------
B4DLY8_MCL1-01          ------------------------------tttgcagg------------
Q07820_MCL1-01          ------------------------------tttgcagg------------
B4DG83_MCL1-01          ------------------------------tttgcagg------------
A0A2K6V5Y3_MCL1-02      ------------------------------tttgcagg------------
A0A2K6V5Y3_MCL1-03      ------------------------------tttgcagg------------
A0A2K6V5Y3_MCL1-01      ------------------------------tttgcagg------------
A0A2K5CFH3_MCL1-03      ------------------------------tttgcagg------------
A0A2K5CFH3_MCL1-02      ------------------------------tttgcagg------------
A0A2K5CFH3_MCL1-01      ------------------------------tttgcagg------------
F7GTF7_MCL1-01          ------------------------------tttgcggg------------
F7GTF7_MCL1-02          ------------------------------tttgcggg------------
F7GTF7_MCL1-03          ------------------------------tttgcggg------------
I3JHR5_MCL1-01          ------------------------------tttgctgg------------
I3KXG5_MCL1-01          ------------------------------tttgctgg------------
Q4SW32_MCL1-01          ------------------------------gtggcagg------------
G3PJT0_MCL1-01          ------------------------------gtggctgg------------
A0A2U9CJ81_MCL1-01      ------------------------------cttgctgg------------
                                                                          

B6V6J0_MCL1-01          -------------tgttgctgttc-----ttggggccggttt--------
F7ETY1_MCL1-01          -------------tgttgcggttc-----ttggggctggctt--------
J7H260_MCL1-01          -------------tgtggctggtc-----ttggagcaagcct--------
D2ITA0_MCL1-03          -------------atttgctggta-----ttggtgcaacaat--------
D2ITA0_MCL1-04          -------------atttgctggta-----ttggtgcaacaat--------
F8W4Q8_MCL1-02          -------------tgtggctacat-----taagtgcagcact--------
Q8UWD6_MCL1-01          -------------tgtggctacat-----taagtgcagcact--------
F8W4Q8_MCL1-01          -------------tgtggctacat-----taagtgcagcact--------
Q568W5_MCL1-01          -------------tgtggctacat-----taagtgcagcact--------
Q568V1_MCL1-01          -------------atgtgccggta-----tcggcgccggtct--------
Q1L8X3_MCL1-01          -------------atgtgccggta-----tcggtgccggtct--------
Q9I9N3_MCL1-01          -------------atgtgccggta-----tcggtgccggtct--------
H2MLZ3_MCL1-01          -------------aattgctggcg-----ttggggctttact--------
H2MLZ3_MCL1-02          -------------aattgctggcg-----ttggggctttact--------
Q0KFR9_MCL1-01          -------------agttgctggaa-----ttggggcaacact--------
A0A087X830_MCL1-01      -------------ggtcgctggta-----ttggggcaacatt--------
H3AR18_MCL1-01          -------------cgttgctggac-----tgggtgcaagtct--------
H3AR18_MCL1-02          -------------cgttgctggac-----tgggtgcaagtct--------
W5MMB7_MCL1-01          -------------ggtggcggggc-----tgggcgcggggct--------
U3IRH3_MCL1-01          -------------agtggctggac-----tgggagcgagctt--------
A0A1D5PQZ2_MCL1-01      -------------agtcac-------------------------------
G1MPY7_MCL1-01          -------------agtggccggcc-----tgggggcgagctt--------
A0A1L1RNM6_MCL1-01      -------------agtggccggcc-----tgggggcgagctt--------
A0A1L1RNM6_MCL1-02      -------------agtggccggcc-----tgggggcgagctt--------
U3KKY6_MCL1-01          -------------agtggctggagagccaggggggctgg-----------
R4GAJ0_MCL1-02          -------------tgtggctggaa-----taggggcaggctt--------
R4GAJ0_MCL1-01          -------------tgtgtctga----------------------------
K7FPN7_MCL1-01          -------------ctttgctggac-----tgggtgcaagctt--------
F6ZMX1_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
G3WBC5_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
H0XHA5_MCL1-01          -------------tgttgctggag-----taggagctggctt--------
G1QAV8_MCL1-01          ----------------tgctggag-----taggagctggttt--------
G1PZ39_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
Q9Z1P3_MCL1-01          -------------tgttgctggag-----taggggctggtct--------
P97287_MCL1-02          -------------tgttgctggag-----taggggctggtct--------
P97287_MCL1-01          -------------tgttgctggag-----taggggctggtct--------
A0A2K6F6N9_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5DMS4_MCL1-01      -------------tgttgctggag-----taggaactgattt--------
A0A286Y1M5_MCL1-01      -------------tgttgctggag-----taggggctggttt--------
G1T2Q0_MCL1-02          -------------tgttgccggag-----taggagcggggct--------
G1T2Q0_MCL1-01          -------------tgttgccggag-----taggagcggggct--------
A0A287DCH9_MCL1-01      -------------tgttgctggcg-----taggagctggttt--------
A0A287DCH9_MCL1-02      -------------tgttgctggcg-----taggagctggttt--------
G3T756_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
W5QI41_MCL1-01          -------------tgttgccggag-----taggagctggttt--------
A5PJR2_MCL1-01          -------------tgttgccggag-----taggagctggttt--------
F1MQX4_MCL1-01          -------------tgttgccggag-----taggagctggttt--------
A0A1S3F3I1_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
J9PBC4_MCL1-01          acacagcacacgctcttcctgaagatgattctgatctggtttgccctcct
J9PBC4_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
Q8HYS5_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
M3XAP4_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
Q7YRZ9_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
M3XAP4_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
M3XAP4_MCL1-03          -------------tgttgctggag-----taggagctggttt--------
F7AVA6_MCL1-01          -------------tgttgctggag-----taggcgctggttt--------
G1L3M8_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
G1L3M8_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
M3XZZ5_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
Q95KR3_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
K9IWB2_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
K9IWB2_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5EPY9_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5EPY9_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
H0XFB7_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2K6GI15_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K6GI15_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K6GI15_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
H2N5Y9_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2K5I9Q7_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K5I9Q7_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5I9Q7_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K6KRW9_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K6PPL1_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K6KRW9_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K6PPL1_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K6KRW9_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K6PPL1_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2I3GB35_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2I3GB35_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2I3GB35_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K5LXU8_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K5XSC7_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K5W0W9_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K6ECR0_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2I3M3D6_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5LXU8_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5LXU8_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A0D9RZP5_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
I7G687_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2K5W0W9_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K5W0W9_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K6ECR0_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
F7HUE9_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
A0A2K6ECR0_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
F7HUE9_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2K5XSC7_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K5XSC7_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2I3M3D6_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2I3M3D6_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
G2HFR3_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
C8YZ26_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
K7DE58_MCL1-04          -------------tgttgctggag-----taggagctggttt--------
A0A2I2YQH7_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2I2YQH7_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2I2YQH7_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2R9BYH6_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
K7DE58_MCL1-02          -------------tgttgctggag-----taggagctggttt--------
Q07820_MCL1-03          -------------tgttgctggag-----taggagctggttt--------
K7DE58_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2R9BYH6_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2R9BYH6_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
K7DE58_MCL1-03          -------------tgttgctggag-----taggagctggttt--------
B4DU51_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
Q07820_MCL1-04          -------------tgttgctggag-----taggagctggttt--------
B4E3L8_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
B4DLY8_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
Q07820_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
B4DG83_MCL1-01          -------------tgttgctggag-----taggagctggttt--------
A0A2K6V5Y3_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K6V5Y3_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K6V5Y3_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
A0A2K5CFH3_MCL1-03      -------------tgttgctggag-----taggagctggttt--------
A0A2K5CFH3_MCL1-02      -------------tgttgctggag-----taggagctggttt--------
A0A2K5CFH3_MCL1-01      -------------tgttgctggag-----taggagctggttt--------
F7GTF7_MCL1-01          -------------tgttgctggag-----taggagctgggtt--------
F7GTF7_MCL1-02          -------------tgttgctggag-----taggagctgggtt--------
F7GTF7_MCL1-03          -------------tgttgctggag-----taggagctgggtt--------
I3JHR5_MCL1-01          -------------atttgctggta-----ttggggcaacact--------
I3KXG5_MCL1-01          -------------atttgcttgta-----ttggggcaacact--------
Q4SW32_MCL1-01          -------------agtggctggga-----tcggcgccaagct--------
G3PJT0_MCL1-01          -------------attcgctagta-----ttggggcgacact--------
A0A2U9CJ81_MCL1-01      -------------atttgctggtg-----ttggggcgacact--------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          ccctcccagaggaccccgatggccgagggaggcatgggtgacaacatgtg
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          ggacacccactccaaggagtggaccagaagccccatgggagttcctttcc
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          ctacctgccacccagctctttctcccatttttaacgaagctccttctgga
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          -------ggcgtacatg-----------------------atc-------
F7ETY1_MCL1-01          -------ggcgttcatg-----------------------atc-------
J7H260_MCL1-01          -------ggcgtacatg-----------------------atc-------
D2ITA0_MCL1-03          -------tgccctacta-----------------------atc-------
D2ITA0_MCL1-04          -------tgccctacta-----------------------atc-------
F8W4Q8_MCL1-02          -------tgcctattgg-----------------------ata-------
Q8UWD6_MCL1-01          -------tgcctattgg-----------------------ata-------
F8W4Q8_MCL1-01          -------tgcctattgg-----------------------ata-------
Q568W5_MCL1-01          -------tgcctattgg-----------------------ata-------
Q568V1_MCL1-01          -------ggccttcctc-----------------------atc-------
Q1L8X3_MCL1-01          -------ggccttcctc-----------------------atc-------
Q9I9N3_MCL1-01          -------ggccttcctc-----------------------atc-------
H2MLZ3_MCL1-01          -------ggcccagctt-----------------------agt-------
H2MLZ3_MCL1-02          -------ggcccagctt-----------------------aatatgatgg
Q0KFR9_MCL1-01          -------cgccatgttc-----------------------atc-------
A0A087X830_MCL1-01      -------agcctttctc-----------------------atc-------
H3AR18_MCL1-01          -------ggtctacttg-----------------------atg-------
H3AR18_MCL1-02          -------ggtctacttg-----------------------atg-------
W5MMB7_MCL1-01          -------ggccctgctg-----------------------atc-------
U3IRH3_MCL1-01          -------ggcctacatg-----------------------atc-------
A0A1D5PQZ2_MCL1-01      ---------------tg-----------------------ttc-------
G1MPY7_MCL1-01          -------ggcctacatg-----------------------atc-------
A0A1L1RNM6_MCL1-01      -------ggcctacatg-----------------------atc-------
A0A1L1RNM6_MCL1-02      -------ggcctacatg-----------------------atc-------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          -------ggcctacatg-----------------------atc-------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          -------ggcgtacatg-----------------------atg-------
F6ZMX1_MCL1-01          -------ggcatatcta-----------------------ata-------
G3WBC5_MCL1-01          -------ggcatatcta-----------------------ata-------
H0XHA5_MCL1-01          -------gacctatcta-----------------------ata-------
G1QAV8_MCL1-01          -------gccatatcta-----------------------ata-------
G1PZ39_MCL1-01          -------ggcatatcta-----------------------ata-------
Q9Z1P3_MCL1-01          -------ggcatatcta-----------------------ata-------
P97287_MCL1-02          -------ggcatatcta-----------------------ata-------
P97287_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K6F6N9_MCL1-01      -------gacttatcta-----------------------ata-------
A0A2K5DMS4_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A286Y1M5_MCL1-01      -------ggcatatcta-----------------------ata-------
G1T2Q0_MCL1-02          -------ggcttatctg-----------------------ata-------
G1T2Q0_MCL1-01          -------ggcttatctg-----------------------ata-------
A0A287DCH9_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A287DCH9_MCL1-02      -------ggcatatcta-----------------------ata-------
G3T756_MCL1-01          -------ggcatatcta-----------------------ata-------
W5QI41_MCL1-01          -------ggcatatcta-----------------------ata-------
A5PJR2_MCL1-01          -------ggcatatcta-----------------------ata-------
F1MQX4_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A1S3F3I1_MCL1-01      -------ggcatatctc-----------------------ata-------
J9PBC4_MCL1-01          acactcaggcatctctgccggactcaaacactttgtagccaag-------
J9PBC4_MCL1-02          -------ggcatatcta-----------------------ata-------
Q8HYS5_MCL1-01          -------ggcatatcta-----------------------ata-------
M3XAP4_MCL1-02          -------ggcatatcta-----------------------ata-------
Q7YRZ9_MCL1-01          -------ggcatatcta-----------------------ata-------
M3XAP4_MCL1-01          -------ggcatatcta-----------------------ata-------
M3XAP4_MCL1-03          -------ggcatatcta-----------------------ata-------
F7AVA6_MCL1-01          -------ggcatatcta-----------------------ata-------
G1L3M8_MCL1-01          -------ggcatatcta-----------------------ata-------
G1L3M8_MCL1-02          -------ggcatatcta-----------------------ata-------
M3XZZ5_MCL1-01          -------ggcatatcta-----------------------ata-------
Q95KR3_MCL1-01          -------ggcatatcta-----------------------ata-------
K9IWB2_MCL1-02          -------ggcatatcta-----------------------ata-------
K9IWB2_MCL1-01          -------ggcatatcta-----------------------ata-------
K9IWB2_MCL1-03          -------ggcatatcta-----------------------ata-------
A0A2K5C7L5_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K5EPY9_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K5EPY9_MCL1-02      -------ggcatatcta-----------------------ata-------
H0XFB7_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K6GI15_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K6GI15_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K6GI15_MCL1-03      -------ggcatatcta-----------------------ata-------
H2N5Y9_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K5I9Q7_MCL1-02      -------ggcatatcta-----------------------atc-------
A0A2K5I9Q7_MCL1-01      -------ggcatatcta-----------------------atc-------
A0A2K5I9Q7_MCL1-03      -------ggcatatcta-----------------------atc-------
A0A2K6KRW9_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K6PPL1_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K6KRW9_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K6PPL1_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K6KRW9_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2K6PPL1_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2I3GB35_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2I3GB35_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2I3GB35_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2K5LXU8_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K5XSC7_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K5W0W9_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K6ECR0_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2I3M3D6_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K5LXU8_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K5LXU8_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A0D9RZP5_MCL1-01      -------ggcatatcta-----------------------ata-------
I7G687_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K5W0W9_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K5W0W9_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2K6ECR0_MCL1-01      -------ggcatatcta-----------------------ata-------
F7HUE9_MCL1-02          -------ggcatatcta-----------------------ata-------
A0A2K6ECR0_MCL1-03      -------ggcatatcta-----------------------ata-------
F7HUE9_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K5XSC7_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2K5XSC7_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2I3M3D6_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2I3M3D6_MCL1-02      -------ggcatatcta-----------------------ata-------
G2HFR3_MCL1-01          -------ggcatatcta-----------------------ata-------
C8YZ26_MCL1-01          -------ggcatatcta-----------------------aaa-------
K7DE58_MCL1-04          -------ggcatatcta-----------------------ata-------
A0A2I2YQH7_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2I2YQH7_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2I2YQH7_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2R9BYH6_MCL1-02      -------ggcatatcta-----------------------ata-------
K7DE58_MCL1-02          -------ggcatatcta-----------------------ata-------
Q07820_MCL1-03          -------ggcatatcta-----------------------ata-------
K7DE58_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2R9BYH6_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2R9BYH6_MCL1-03      -------ggcatatcta-----------------------ata-------
K7DE58_MCL1-03          -------ggcatatcta-----------------------ata-------
B4DU51_MCL1-01          -------ggcatatcta-----------------------ata-------
Q07820_MCL1-04          -------ggcatatcta-----------------------ata-------
B4E3L8_MCL1-01          -------ggcatatcta-----------------------ata-------
B4DLY8_MCL1-01          -------ggcatatcta-----------------------ata-------
Q07820_MCL1-01          -------ggcatatcta-----------------------ata-------
B4DG83_MCL1-01          -------ggcatatcta-----------------------ata-------
A0A2K6V5Y3_MCL1-02      -------ggcatatcta-----------------------ata-------
A0A2K6V5Y3_MCL1-03      -------ggcatatcta-----------------------ata-------
A0A2K6V5Y3_MCL1-01      -------ggcatatcta-----------------------ata-------
A0A2K5CFH3_MCL1-03      -------ggc----------------------------------------
A0A2K5CFH3_MCL1-02      -------ggcactgtct-----------------------ctt-------
A0A2K5CFH3_MCL1-01      -------ggcactgtct-----------------------ctt-------
F7GTF7_MCL1-01          -------ggcatatcta-----------------------ata-------
F7GTF7_MCL1-02          -------ggcatatcta-----------------------ata-------
F7GTF7_MCL1-03          -------ggcatatcta-----------------------ata-------
I3JHR5_MCL1-01          -------ggccctgttg-----------------------atc-------
I3KXG5_MCL1-01          -------ggcactgttg-----------------------atc-------
Q4SW32_MCL1-01          -------ggcgctgctg-----------------------atc-------
G3PJT0_MCL1-01          -------ggccctgttg-----------------------atc-------
A0A2U9CJ81_MCL1-01      -------ggccctgttg-----------------------atc-------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------cg----
F7ETY1_MCL1-01          --------------------------------------------cg----
J7H260_MCL1-01          --------------------------------------------cg----
D2ITA0_MCL1-03          --------------------------------------------ag----
D2ITA0_MCL1-04          --------------------------------------------ag----
F8W4Q8_MCL1-02          --------------------------------------------cg----
Q8UWD6_MCL1-01          --------------------------------------------cg----
F8W4Q8_MCL1-01          --------------------------------------------cg----
Q568W5_MCL1-01          --------------------------------------------cg----
Q568V1_MCL1-01          --------------------------------------------cg----
Q1L8X3_MCL1-01          --------------------------------------------cg----
Q9I9N3_MCL1-01          --------------------------------------------cg----
H2MLZ3_MCL1-01          --------------------------------------------ag----
H2MLZ3_MCL1-02          ccatttttaaaggacttcctgcttctaccagacttcacaactcgag----
Q0KFR9_MCL1-01          --------------------------------------------ag----
A0A087X830_MCL1-01      --------------------------------------------ag----
H3AR18_MCL1-01          --------------------------------------------ag----
H3AR18_MCL1-02          --------------------------------------------ag----
W5MMB7_MCL1-01          --------------------------------------------ag----
U3IRH3_MCL1-01          --------------------------------------------cg----
A0A1D5PQZ2_MCL1-01      --------------------------------------------ca----
G1MPY7_MCL1-01          --------------------------------------------cg----
A0A1L1RNM6_MCL1-01      --------------------------------------------cg----
A0A1L1RNM6_MCL1-02      --------------------------------------------cg----
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------cg----
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------cg----
F6ZMX1_MCL1-01          --------------------------------------------ag----
G3WBC5_MCL1-01          --------------------------------------------ag----
H0XHA5_MCL1-01          --------------------------------------------ag----
G1QAV8_MCL1-01          --------------------------------------------ag----
G1PZ39_MCL1-01          --------------------------------------------ag----
Q9Z1P3_MCL1-01          --------------------------------------------ag----
P97287_MCL1-02          --------------------------------------------ag----
P97287_MCL1-01          --------------------------------------------ag----
A0A2K6F6N9_MCL1-01      --------------------------------------------ag----
A0A2K5DMS4_MCL1-01      --------------------------------------------ag----
A0A286Y1M5_MCL1-01      --------------------------------------------ag----
G1T2Q0_MCL1-02          --------------------------------------------ag----
G1T2Q0_MCL1-01          --------------------------------------------ag----
A0A287DCH9_MCL1-01      --------------------------------------------ag----
A0A287DCH9_MCL1-02      --------------------------------------------ag----
G3T756_MCL1-01          --------------------------------------------ag----
W5QI41_MCL1-01          --------------------------------------------ag----
A5PJR2_MCL1-01          --------------------------------------------ag----
F1MQX4_MCL1-01          --------------------------------------------ag----
A0A1S3F3I1_MCL1-01      --------------------------------------------ag----
J9PBC4_MCL1-01          --------------------------------------------ag----
J9PBC4_MCL1-02          --------------------------------------------ag----
Q8HYS5_MCL1-01          --------------------------------------------ag----
M3XAP4_MCL1-02          --------------------------------------------ag----
Q7YRZ9_MCL1-01          --------------------------------------------ag----
M3XAP4_MCL1-01          --------------------------------------------ag----
M3XAP4_MCL1-03          --------------------------------------------ag----
F7AVA6_MCL1-01          --------------------------------------------ag----
G1L3M8_MCL1-01          --------------------------------------------ag----
G1L3M8_MCL1-02          --------------------------------------------ag----
M3XZZ5_MCL1-01          --------------------------------------------ag----
Q95KR3_MCL1-01          --------------------------------------------ag----
K9IWB2_MCL1-02          --------------------------------------------ag----
K9IWB2_MCL1-01          --------------------------------------------ag----
K9IWB2_MCL1-03          --------------------------------------------ag----
A0A2K5C7L5_MCL1-01      --------------------------------------------ag----
A0A2K5EPY9_MCL1-01      --------------------------------------------ag----
A0A2K5EPY9_MCL1-02      --------------------------------------------ag----
H0XFB7_MCL1-01          --------------------------------------------ag----
A0A2K6GI15_MCL1-01      --------------------------------------------ag----
A0A2K6GI15_MCL1-02      --------------------------------------------ag----
A0A2K6GI15_MCL1-03      --------------------------------------------ag----
H2N5Y9_MCL1-01          --------------------------------------------ag----
A0A2K5I9Q7_MCL1-02      --------------------------------------------ag----
A0A2K5I9Q7_MCL1-01      --------------------------------------------ag----
A0A2K5I9Q7_MCL1-03      --------------------------------------------ag----
A0A2K6KRW9_MCL1-02      --------------------------------------------ag----
A0A2K6PPL1_MCL1-02      --------------------------------------------ag----
A0A2K6KRW9_MCL1-01      --------------------------------------------ag----
A0A2K6PPL1_MCL1-01      --------------------------------------------ag----
A0A2K6KRW9_MCL1-03      --------------------------------------------ag----
A0A2K6PPL1_MCL1-03      --------------------------------------------ag----
A0A2I3GB35_MCL1-01      --------------------------------------------ag----
A0A2I3GB35_MCL1-02      --------------------------------------------ag----
A0A2I3GB35_MCL1-03      --------------------------------------------ag----
A0A2K5LXU8_MCL1-02      --------------------------------------------ag----
A0A2K5XSC7_MCL1-02      --------------------------------------------ag----
A0A2K5W0W9_MCL1-01      --------------------------------------------ag----
A0A2K6ECR0_MCL1-02      --------------------------------------------ag----
A0A2I3M3D6_MCL1-01      --------------------------------------------ag----
A0A2K5LXU8_MCL1-01      --------------------------------------------ag----
A0A2K5LXU8_MCL1-03      --------------------------------------------ag----
A0A0D9RZP5_MCL1-01      --------------------------------------------ag----
I7G687_MCL1-01          --------------------------------------------ag----
A0A2K5W0W9_MCL1-02      --------------------------------------------ag----
A0A2K5W0W9_MCL1-03      --------------------------------------------ag----
A0A2K6ECR0_MCL1-01      --------------------------------------------ag----
F7HUE9_MCL1-02          --------------------------------------------ag----
A0A2K6ECR0_MCL1-03      --------------------------------------------ag----
F7HUE9_MCL1-01          --------------------------------------------ag----
A0A2K5XSC7_MCL1-03      --------------------------------------------ag----
A0A2K5XSC7_MCL1-01      --------------------------------------------ag----
A0A2I3M3D6_MCL1-03      --------------------------------------------ag----
A0A2I3M3D6_MCL1-02      --------------------------------------------ag----
G2HFR3_MCL1-01          --------------------------------------------ag----
C8YZ26_MCL1-01          --------------------------------------------ag----
K7DE58_MCL1-04          --------------------------------------------ag----
A0A2I2YQH7_MCL1-02      --------------------------------------------ag----
A0A2I2YQH7_MCL1-03      --------------------------------------------ag----
A0A2I2YQH7_MCL1-01      --------------------------------------------ag----
A0A2R9BYH6_MCL1-02      --------------------------------------------ag----
K7DE58_MCL1-02          --------------------------------------------ag----
Q07820_MCL1-03          --------------------------------------------ag----
K7DE58_MCL1-01          --------------------------------------------ag----
A0A2R9BYH6_MCL1-01      --------------------------------------------ag----
A0A2R9BYH6_MCL1-03      --------------------------------------------ag----
K7DE58_MCL1-03          --------------------------------------------ag----
B4DU51_MCL1-01          --------------------------------------------ag----
Q07820_MCL1-04          --------------------------------------------ag----
B4E3L8_MCL1-01          --------------------------------------------ag----
B4DLY8_MCL1-01          --------------------------------------------ag----
Q07820_MCL1-01          --------------------------------------------ag----
B4DG83_MCL1-01          --------------------------------------------ag----
A0A2K6V5Y3_MCL1-02      --------------------------------------------ag----
A0A2K6V5Y3_MCL1-03      --------------------------------------------ag----
A0A2K6V5Y3_MCL1-01      --------------------------------------------ag----
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------at----
A0A2K5CFH3_MCL1-01      --------------------------------------------at----
F7GTF7_MCL1-01          --------------------------------------------ag----
F7GTF7_MCL1-02          --------------------------------------------ag----
F7GTF7_MCL1-03          --------------------------------------------ag----
I3JHR5_MCL1-01          --------------------------------------------ag----
I3KXG5_MCL1-01          --------------------------------------------ag----
Q4SW32_MCL1-01          --------------------------------------------ag----
G3PJT0_MCL1-01          --------------------------------------------agtgga
A0A2U9CJ81_MCL1-01      --------------------------------------------ag----
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          --------------------------------------------------
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
G3PJT0_MCL1-01          ccttcaaaagtgcaaaggcagcttctcaccattgaattgttgcagatcgt
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          -------------------------------------a------------
F7ETY1_MCL1-01          -------------------------------------g------------
J7H260_MCL1-01          -------------------------------------g------------
D2ITA0_MCL1-03          -------------------------------------g------------
D2ITA0_MCL1-04          -------------------------------------g------------
F8W4Q8_MCL1-02          -------------------------------------g------------
Q8UWD6_MCL1-01          -------------------------------------g------------
F8W4Q8_MCL1-01          -------------------------------------g------------
Q568W5_MCL1-01          -------------------------------------g------------
Q568V1_MCL1-01          -------------------------------------g------------
Q1L8X3_MCL1-01          -------------------------------------g------------
Q9I9N3_MCL1-01          -------------------------------------g------------
H2MLZ3_MCL1-01          -------------------------------------g------------
H2MLZ3_MCL1-02          -------------------------------------a------------
Q0KFR9_MCL1-01          -------------------------------------g------------
A0A087X830_MCL1-01      -------------------------------------g------------
H3AR18_MCL1-01          -------------------------------------a------------
H3AR18_MCL1-02          -------------------------------------a------------
W5MMB7_MCL1-01          -------------------------------------a------------
U3IRH3_MCL1-01          -------------------------------------g------------
A0A1D5PQZ2_MCL1-01      -------------------------------------g-----------t
G1MPY7_MCL1-01          -------------------------------------g------------
A0A1L1RNM6_MCL1-01      -------------------------------------aaagtggaggagt
A0A1L1RNM6_MCL1-02      -------------------------------------g------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          -------------------------------------g------------
R4GAJ0_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          -------------------------------------a------------
F6ZMX1_MCL1-01          -------------------------------------a------------
G3WBC5_MCL1-01          -------------------------------------a------------
H0XHA5_MCL1-01          -------------------------------------a------------
G1QAV8_MCL1-01          -------------------------------------g------------
G1PZ39_MCL1-01          -------------------------------------a------------
Q9Z1P3_MCL1-01          -------------------------------------g------------
P97287_MCL1-02          -------------------------------------a------------
P97287_MCL1-01          -------------------------------------a------------
A0A2K6F6N9_MCL1-01      -------------------------------------a------------
A0A2K5DMS4_MCL1-01      -------------------------------------a------------
A0A286Y1M5_MCL1-01      -------------------------------------a------------
G1T2Q0_MCL1-02          -------------------------------------a------------
G1T2Q0_MCL1-01          -------------------------------------a------------
A0A287DCH9_MCL1-01      -------------------------------------a------------
A0A287DCH9_MCL1-02      -------------------------------------a------------
G3T756_MCL1-01          -------------------------------------a------------
W5QI41_MCL1-01          -------------------------------------a------------
A5PJR2_MCL1-01          -------------------------------------a------------
F1MQX4_MCL1-01          -------------------------------------a------------
A0A1S3F3I1_MCL1-01      -------------------------------------a------------
J9PBC4_MCL1-01          -------------------------------------a------------
J9PBC4_MCL1-02          -------------------------------------a------------
Q8HYS5_MCL1-01          -------------------------------------a------------
M3XAP4_MCL1-02          -------------------------------------a------------
Q7YRZ9_MCL1-01          -------------------------------------a------------
M3XAP4_MCL1-01          -------------------------------------a------------
M3XAP4_MCL1-03          -------------------------------------a------------
F7AVA6_MCL1-01          -------------------------------------a------------
G1L3M8_MCL1-01          -------------------------------------a------------
G1L3M8_MCL1-02          -------------------------------------a------------
M3XZZ5_MCL1-01          -------------------------------------a------------
Q95KR3_MCL1-01          -------------------------------------a------------
K9IWB2_MCL1-02          -------------------------------------a------------
K9IWB2_MCL1-01          -------------------------------------a------------
K9IWB2_MCL1-03          -------------------------------------a------------
A0A2K5C7L5_MCL1-01      -------------------------------------a------------
A0A2K5EPY9_MCL1-01      -------------------------------------a------------
A0A2K5EPY9_MCL1-02      -------------------------------------a------------
H0XFB7_MCL1-01          -------------------------------------a------------
A0A2K6GI15_MCL1-01      -------------------------------------a------------
A0A2K6GI15_MCL1-02      -------------------------------------a------------
A0A2K6GI15_MCL1-03      -------------------------------------a------------
H2N5Y9_MCL1-01          -------------------------------------a------------
A0A2K5I9Q7_MCL1-02      -------------------------------------a------------
A0A2K5I9Q7_MCL1-01      -------------------------------------a------------
A0A2K5I9Q7_MCL1-03      -------------------------------------a------------
A0A2K6KRW9_MCL1-02      -------------------------------------a------------
A0A2K6PPL1_MCL1-02      -------------------------------------a------------
A0A2K6KRW9_MCL1-01      -------------------------------------a------------
A0A2K6PPL1_MCL1-01      -------------------------------------a------------
A0A2K6KRW9_MCL1-03      -------------------------------------a------------
A0A2K6PPL1_MCL1-03      -------------------------------------a------------
A0A2I3GB35_MCL1-01      -------------------------------------a------------
A0A2I3GB35_MCL1-02      -------------------------------------a------------
A0A2I3GB35_MCL1-03      -------------------------------------a------------
A0A2K5LXU8_MCL1-02      -------------------------------------a------------
A0A2K5XSC7_MCL1-02      -------------------------------------a------------
A0A2K5W0W9_MCL1-01      -------------------------------------a------------
A0A2K6ECR0_MCL1-02      -------------------------------------a------------
A0A2I3M3D6_MCL1-01      -------------------------------------a------------
A0A2K5LXU8_MCL1-01      -------------------------------------a------------
A0A2K5LXU8_MCL1-03      -------------------------------------a------------
A0A0D9RZP5_MCL1-01      -------------------------------------a------------
I7G687_MCL1-01          -------------------------------------a------------
A0A2K5W0W9_MCL1-02      -------------------------------------a------------
A0A2K5W0W9_MCL1-03      -------------------------------------a------------
A0A2K6ECR0_MCL1-01      -------------------------------------a------------
F7HUE9_MCL1-02          -------------------------------------a------------
A0A2K6ECR0_MCL1-03      -------------------------------------a------------
F7HUE9_MCL1-01          -------------------------------------a------------
A0A2K5XSC7_MCL1-03      -------------------------------------a------------
A0A2K5XSC7_MCL1-01      -------------------------------------a------------
A0A2I3M3D6_MCL1-03      -------------------------------------a------------
A0A2I3M3D6_MCL1-02      -------------------------------------a------------
G2HFR3_MCL1-01          -------------------------------------a------------
C8YZ26_MCL1-01          -------------------------------------a------------
K7DE58_MCL1-04          -------------------------------------a------------
A0A2I2YQH7_MCL1-02      -------------------------------------a------------
A0A2I2YQH7_MCL1-03      -------------------------------------a------------
A0A2I2YQH7_MCL1-01      -------------------------------------a------------
A0A2R9BYH6_MCL1-02      -------------------------------------a------------
K7DE58_MCL1-02          -------------------------------------a------------
Q07820_MCL1-03          -------------------------------------a------------
K7DE58_MCL1-01          -------------------------------------a------------
A0A2R9BYH6_MCL1-01      -------------------------------------a------------
A0A2R9BYH6_MCL1-03      -------------------------------------a------------
K7DE58_MCL1-03          -------------------------------------a------------
B4DU51_MCL1-01          -------------------------------------a------------
Q07820_MCL1-04          -------------------------------------a------------
B4E3L8_MCL1-01          -------------------------------------a------------
B4DLY8_MCL1-01          -------------------------------------a------------
Q07820_MCL1-01          -------------------------------------a------------
B4DG83_MCL1-01          -------------------------------------a------------
A0A2K6V5Y3_MCL1-02      -------------------------------------a------------
A0A2K6V5Y3_MCL1-03      -------------------------------------a------------
A0A2K6V5Y3_MCL1-01      -------------------------------------a------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      -------------------------------------a------------
A0A2K5CFH3_MCL1-01      -------------------------------------a------------
F7GTF7_MCL1-01          -------------------------------------a------------
F7GTF7_MCL1-02          -------------------------------------a------------
F7GTF7_MCL1-03          -------------------------------------a------------
I3JHR5_MCL1-01          -------------------gttctgggatgcattattg------------
I3KXG5_MCL1-01          -------------------------------------g------------
Q4SW32_MCL1-01          -------------------------------------g------------
G3PJT0_MCL1-01          gcgctctcagaggggaggacaccggctgcagcgtgatg------------
A0A2U9CJ81_MCL1-01      -------------------------------------g------------
                                                                          

B6V6J0_MCL1-01          tga-----------------------------------
F7ETY1_MCL1-01          tga-----------------------------------
J7H260_MCL1-01          tga-----------------------------------
D2ITA0_MCL1-03          tga-----------------------------------
D2ITA0_MCL1-04          tga-----------------------------------
F8W4Q8_MCL1-02          tga-----------------------------------
Q8UWD6_MCL1-01          tga-----------------------------------
F8W4Q8_MCL1-01          tga-----------------------------------
Q568W5_MCL1-01          tga-----------------------------------
Q568V1_MCL1-01          tga-----------------------------------
Q1L8X3_MCL1-01          tga-----------------------------------
Q9I9N3_MCL1-01          tga-----------------------------------
H2MLZ3_MCL1-01          tga-----------------------------------
H2MLZ3_MCL1-02          tag-----------------------------------
Q0KFR9_MCL1-01          tga-----------------------------------
A0A087X830_MCL1-01      tga-----------------------------------
H3AR18_MCL1-01          tga-----------------------------------
H3AR18_MCL1-02          tga-----------------------------------
W5MMB7_MCL1-01          tga-----------------------------------
U3IRH3_MCL1-01          tga-----------------------------------
A0A1D5PQZ2_MCL1-01      taa-----------------------------------
G1MPY7_MCL1-01          --------------------------------------
A0A1L1RNM6_MCL1-01      tga-----------------------------------
A0A1L1RNM6_MCL1-02      tga-----------------------------------
U3KKY6_MCL1-01          --------------------------------------
R4GAJ0_MCL1-02          tga-----------------------------------
R4GAJ0_MCL1-01          --------------------------------------
K7FPN7_MCL1-01          tga-----------------------------------
F6ZMX1_MCL1-01          tag-----------------------------------
G3WBC5_MCL1-01          tag-----------------------------------
H0XHA5_MCL1-01          tag-----------------------------------
G1QAV8_MCL1-01          tag-----------------------------------
G1PZ39_MCL1-01          tag-----------------------------------
Q9Z1P3_MCL1-01          tag-----------------------------------
P97287_MCL1-02          tag-----------------------------------
P97287_MCL1-01          tag-----------------------------------
A0A2K6F6N9_MCL1-01      tag-----------------------------------
A0A2K5DMS4_MCL1-01      tag-----------------------------------
A0A286Y1M5_MCL1-01      tag-----------------------------------
G1T2Q0_MCL1-02          --------------------------------------
G1T2Q0_MCL1-01          tag-----------------------------------
A0A287DCH9_MCL1-01      tag-----------------------------------
A0A287DCH9_MCL1-02      tag-----------------------------------
G3T756_MCL1-01          tag-----------------------------------
W5QI41_MCL1-01          tag-----------------------------------
A5PJR2_MCL1-01          tag-----------------------------------
F1MQX4_MCL1-01          tag-----------------------------------
A0A1S3F3I1_MCL1-01      tag-----------------------------------
J9PBC4_MCL1-01          taa-----------------------------------
J9PBC4_MCL1-02          tag-----------------------------------
Q8HYS5_MCL1-01          tag-----------------------------------
M3XAP4_MCL1-02          tagccttttaa---------------------------
Q7YRZ9_MCL1-01          tag-----------------------------------
M3XAP4_MCL1-01          tag-----------------------------------
M3XAP4_MCL1-03          tag-----------------------------------
F7AVA6_MCL1-01          tag-----------------------------------
G1L3M8_MCL1-01          tag-----------------------------------
G1L3M8_MCL1-02          --------------------------------------
M3XZZ5_MCL1-01          tag-----------------------------------
Q95KR3_MCL1-01          tag-----------------------------------
K9IWB2_MCL1-02          tag-----------------------------------
K9IWB2_MCL1-01          tag-----------------------------------
K9IWB2_MCL1-03          tagccttttaa---------------------------
A0A2K5C7L5_MCL1-01      tagccttgtaa---------------------------
A0A2K5EPY9_MCL1-01      tag-----------------------------------
A0A2K5EPY9_MCL1-02      tag-----------------------------------
H0XFB7_MCL1-01          tag-----------------------------------
A0A2K6GI15_MCL1-01      tagccttgtaa---------------------------
A0A2K6GI15_MCL1-02      tag-----------------------------------
A0A2K6GI15_MCL1-03      tag-----------------------------------
H2N5Y9_MCL1-01          tag-----------------------------------
A0A2K5I9Q7_MCL1-02      tagccttactgtaa------------------------
A0A2K5I9Q7_MCL1-01      tag-----------------------------------
A0A2K5I9Q7_MCL1-03      tag-----------------------------------
A0A2K6KRW9_MCL1-02      tagccttactgtaa------------------------
A0A2K6PPL1_MCL1-02      tagccttactgtaa------------------------
A0A2K6KRW9_MCL1-01      tag-----------------------------------
A0A2K6PPL1_MCL1-01      tag-----------------------------------
A0A2K6KRW9_MCL1-03      tag-----------------------------------
A0A2K6PPL1_MCL1-03      tag-----------------------------------
A0A2I3GB35_MCL1-01      tagccttactgtaa------------------------
A0A2I3GB35_MCL1-02      tag-----------------------------------
A0A2I3GB35_MCL1-03      tag-----------------------------------
A0A2K5LXU8_MCL1-02      tagccttactgtaa------------------------
A0A2K5XSC7_MCL1-02      tagccttactgtaa------------------------
A0A2K5W0W9_MCL1-01      tagccttactgtaa------------------------
A0A2K6ECR0_MCL1-02      tagccttactgtaa------------------------
A0A2I3M3D6_MCL1-01      tagccttactgtaa------------------------
A0A2K5LXU8_MCL1-01      tag-----------------------------------
A0A2K5LXU8_MCL1-03      tag-----------------------------------
A0A0D9RZP5_MCL1-01      tag-----------------------------------
I7G687_MCL1-01          tag-----------------------------------
A0A2K5W0W9_MCL1-02      tag-----------------------------------
A0A2K5W0W9_MCL1-03      tag-----------------------------------
A0A2K6ECR0_MCL1-01      tag-----------------------------------
F7HUE9_MCL1-02          tag-----------------------------------
A0A2K6ECR0_MCL1-03      tag-----------------------------------
F7HUE9_MCL1-01          tag-----------------------------------
A0A2K5XSC7_MCL1-03      tag-----------------------------------
A0A2K5XSC7_MCL1-01      tag-----------------------------------
A0A2I3M3D6_MCL1-03      tag-----------------------------------
A0A2I3M3D6_MCL1-02      tag-----------------------------------
G2HFR3_MCL1-01          tag-----------------------------------
C8YZ26_MCL1-01          tag-----------------------------------
K7DE58_MCL1-04          tag-----------------------------------
A0A2I2YQH7_MCL1-02      tagccttactgtaa------------------------
A0A2I2YQH7_MCL1-03      tag-----------------------------------
A0A2I2YQH7_MCL1-01      tag-----------------------------------
A0A2R9BYH6_MCL1-02      tagccttactgtaa------------------------
K7DE58_MCL1-02          tagccttactgtaa------------------------
Q07820_MCL1-03          tagccttactgtaa------------------------
K7DE58_MCL1-01          tag-----------------------------------
A0A2R9BYH6_MCL1-01      tag-----------------------------------
A0A2R9BYH6_MCL1-03      tag-----------------------------------
K7DE58_MCL1-03          tag-----------------------------------
B4DU51_MCL1-01          tag-----------------------------------
Q07820_MCL1-04          tag-----------------------------------
B4E3L8_MCL1-01          tag-----------------------------------
B4DLY8_MCL1-01          tag-----------------------------------
Q07820_MCL1-01          tag-----------------------------------
B4DG83_MCL1-01          tag-----------------------------------
A0A2K6V5Y3_MCL1-02      tagccttgtaa---------------------------
A0A2K6V5Y3_MCL1-03      tag-----------------------------------
A0A2K6V5Y3_MCL1-01      tag-----------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------
A0A2K5CFH3_MCL1-02      cacatctag-----------------------------
A0A2K5CFH3_MCL1-01      cacatctag-----------------------------
F7GTF7_MCL1-01          tagccttggaa---------------------------
F7GTF7_MCL1-02          tag-----------------------------------
F7GTF7_MCL1-03          tag-----------------------------------
I3JHR5_MCL1-01          tga-----------------------------------
I3KXG5_MCL1-01          tga-----------------------------------
Q4SW32_MCL1-01          tga-----------------------------------
G3PJT0_MCL1-01          tgagcaccagaccttctccgacatccggctctggacta
A0A2U9CJ81_MCL1-01      tga-----------------------------------
                                                              

© 1998-2019