Dataset for CDS BCL-2-like of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

515 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          atgatgcac-----------------------------------------
F7ETY1_MCL1-01          atgatgcgc-----------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          ---at---------------------------------------------
Q8UWD6_MCL1-01          ---atgttc-----------------------------------------
F8W4Q8_MCL1-01          ---atgttc-----------------------------------------
Q568W5_MCL1-01          ---atgttc-----------------------------------------
A0A087YBW4_BCL2L1-      ---atgtcc-----------------------------------------
M4A558_BCL2L1-01        ---atggcc-----------------------------------------
A0A0F7L1T6_BCL2L1-      ---atgtcg-----------------------------------------
H2U5I3_BCL2L1-01        ---atgtcg-----------------------------------------
H2U5I3_BCL2L1-02        ---atgtcg-----------------------------------------
G3P7B4_BCL2L1-01        ---atggcg-----------------------------------------
E6ZFR0_BCL2L1-01        ---atgtcg-----------------------------------------
A0A0B4KJI5_BCL2L1-      ---atgtcg-----------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          ---atggct-----------------------------------------
Q9I9N3_MCL1-01          ---atggct-----------------------------------------
A0A1X9JZA1_BCL2-01      ---atggcg-----------------------------------------
Q6GLI5_BCL2L1-01        ---atggag-----------------------------------------
Q2TAP5_BCL2L1-01        ---atggag-----------------------------------------
Q91828_BCL2L1-01        ---atggag-----------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        ---atggac-----------------------------------------
U3IS71_BCL2L1-01        ---atgtcc-----------------------------------------
K7F655_BCL2L1-01        ---atgtcg-----------------------------------------
G1N5N5_BCL2L1-01        ---atgtcc-----------------------------------------
Q07816_BCL2L1-03        ---atgtcc-----------------------------------------
Q07816_BCL2L1-01        ---atgtcc-----------------------------------------
Q07816_BCL2L1-02        ---atgtcc-----------------------------------------
U3JSL7_BCL2L1-01        ---atgtac-----------------------------------------
Q4U2V6_BCL2L1-01        ---atgtcc-----------------------------------------
H0Z8G3_BCL2L1-01        ---atgtac-----------------------------------------
F6WA14_BCL2L1-01        ---atgtcg-----------------------------------------
G3WKX6_BCL2L1-01        ---atgtct-----------------------------------------
W5PSA5_BCL2L1-01        ---atgtct-----------------------------------------
G3SPN0_BCL2L1-01        ---atgtct-----------------------------------------
H0X6V2_BCL2L1-01        ---atgtct-----------------------------------------
P53563_BCL2L1-04        ---atgtct-----------------------------------------
P53563_BCL2L1-02        ---atgtct-----------------------------------------
P53563_BCL2L1-03        ---atgtct-----------------------------------------
P53563_BCL2L1-01        ---atgtct-----------------------------------------
O35843_BCL2L1-01        ---atgtct-----------------------------------------
Q64373_BCL2L1-09        ---atgtct-----------------------------------------
Q64373_BCL2L1-01        ---atgtct-----------------------------------------
Q64373_BCL2L1-03        ---atgtct-----------------------------------------
Q64373_BCL2L1-04        ---atgtct-----------------------------------------
B2Z3Z4_BCL2L1-01        ---atgtct-----------------------------------------
A0A1U7QU73_BCL2L1-      ---atgtct-----------------------------------------
Q9MYW4_BCL2L1-01        ---atgtct-----------------------------------------
A0A1S3EPX7_BCL2L1-      ---atgtct-----------------------------------------
O77737_BCL2L1-01        ---atgtct-----------------------------------------
A0A286Y5D6_BCL2L1-      ---atgtct-----------------------------------------
G1P9D2_BCL2L1-01        ---atgtct-----------------------------------------
Q05KJ0_BCL2L1-01        ---atgtct-----------------------------------------
Q9MZS7_BCL2L1-01        ---atgtct-----------------------------------------
A0A1S2ZQT6_BCL2L1-      ---atgtct-----------------------------------------
A0A1L5BWY3_BCL2L1-      ---atgtct-----------------------------------------
A0A287CZ07_BCL2L1-      ---atgtct-----------------------------------------
I3MUP5_BCL2L1-03        ---atgtct-----------------------------------------
I3MUP5_BCL2L1-02        ---atgtct-----------------------------------------
I3MUP5_BCL2L1-01        ---atgtct-----------------------------------------
F6WQI0_BCL2L1-01        ---atgtct-----------------------------------------
E2IV76_BCL2L1-01        ---atgtct-----------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ---atgtct-----------------------------------------
G1RER8_BCL2L1-01        ---atgtct-----------------------------------------
A0A2J8VIH3_BCL2L1-      ---atgtct-----------------------------------------
Q07817_BCL2L1-03        ---atgtct-----------------------------------------
Q07817_BCL2L1-01        ---atgtct-----------------------------------------
Q07817_BCL2L1-02        ---atgtct-----------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ---atgtct-----------------------------------------
A0A2K5H963_BCL2L1-      ---atgtct-----------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ---atgtct-----------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ---atgtct-----------------------------------------
A0A2K5VPG2_BCL2L1-      ---atgtct-----------------------------------------
F6UKR4_BCL2L1-01        ---atgtct-----------------------------------------
A0A0D9RJZ8_BCL2L1-      ---atgtct-----------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ---atgtct-----------------------------------------
A0A2K6QFA2_BCL2L1-      ---atgtct-----------------------------------------
A0A2K6QFA2_BCL2L1-      ---atgtct-----------------------------------------
A0A2K5YR37_BCL2L1-      ---atgtct-----------------------------------------
A0A2K6UWY8_BCL2L1-      ---atgtct-----------------------------------------
E2IV77_BCL2L1-01        ---atgtct-----------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        ---atgtct-----------------------------------------
F7IT34_BCL2L1-01        ---atgtct-----------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ---atgtct-----------------------------------------
E2IV75_BCL2L1-01        ---atgtct-----------------------------------------
M3Z2H9_BCL2L1-01        ---atgtct-----------------------------------------
M3XA94_BCL2L1-01        ---atgtct-----------------------------------------
Q76LT7_BCL2L1-01        ---atgtct-----------------------------------------
Q8SQ42_BCL2L1-01        ---atgtct-----------------------------------------
H3AAS7_BCL2L2-01        ---atggat-----------------------------------------
H3AAS7_BCL2L2-02        ---atggat-----------------------------------------
F6VJQ0_BCL2L10-01       ---atggat-----------------------------------------
H3ANS8_BCL2L1-01        aaaatgtccttcaac-----------------------------------
D2ITA2_BCL2L1-02        ---atgagc-----------------------------------------
C1BLI0_BCL2L1-01        ---atgtctta---------------------------------------
A0A287APJ6_BCL2-01      ---atgctgctgc-------------------------------------
A0A286MU87_BCL2L1-      ---atgtctta---------------------------------------
C0HAD8_BCL2L1-01        ---atgtctta---------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        ---atgtc------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ---atgttt---------------------------------gcagtcaa
A0A1L1RNM6_MCL1-02      ---atgttt---------------------------------gcagtcaa
A0A286XUI2_BCL2A1-      ---atgggt-----------------------------------------
I3J363_BCL2L10-01       ---atgtc------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          ---atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgag
H2MBQ3_BCL2L10-01       ---atgtc------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      ---atgcac------------------------------cgag-------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       ---atgtc------------------------------------------
F6ZMX1_MCL1-01          ---atgtta------------------------------ggccctttcaa
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ---atgttt------------------------------ggcc---ccaa
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          ---atgttt------------------------------ggcc---ttcg
P97287_MCL1-02          ---atgttt------------------------------ggcc---tgcg
P97287_MCL1-01          ---atgttt------------------------------ggcc---tgcg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      ---atgttt------------------------------ggct---tcca
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          ---atgttt------------------------------agcc---tgag
G1T2Q0_MCL1-01          ---atgttt------------------------------agcc---tgag
A0A287DCH9_MCL1-01      ---atgttc------------------------------ggcc---ttaa
A0A287DCH9_MCL1-02      ---atgttc------------------------------ggcc---ttaa
G3T756_MCL1-01          ---atgttc------------------------------ggct---tcaa
W5QI41_MCL1-01          --------g------------------------------ggag---ccgg
A5PJR2_MCL1-01          ---atgttc------------------------------ggcc---tcaa
F1MQX4_MCL1-01          ----tgtc------------------------------------------
A0A1S3F3I1_MCL1-01      ---atgttt------------------------------ggcc---tcag
J9PBC4_MCL1-01          ---atgttc------------------------------ggcc---tcaa
J9PBC4_MCL1-02          ---atgttc------------------------------ggcc---tcaa
Q8HYS5_MCL1-01          ---atgttt------------------------------ggcc---tcaa
M3XAP4_MCL1-02          ---atgttt------------------------------ggcc---tcaa
Q7YRZ9_MCL1-01          ---atgttt------------------------------ggcc---tcaa
M3XAP4_MCL1-01          ---atgttt------------------------------ggcc---tcaa
M3XAP4_MCL1-03          ---atgttt------------------------------ggcc---tcaa
F7AVA6_MCL1-01          ---atgttt------------------------------ggcc---tgaa
G1L3M8_MCL1-01          ---atgttt------------------------------ggcc---tcaa
G1L3M8_MCL1-02          ---atgttt------------------------------ggcc---tcaa
M3XZZ5_MCL1-01          ---atgttt------------------------------ggcc---tcaa
Q95KR3_MCL1-01          ---atgttt------------------------------ggcc---tcca
K9IWB2_MCL1-02          ---atgttt------------------------------ggcc---tcca
K9IWB2_MCL1-01          ---atgttt------------------------------ggcc---tcca
K9IWB2_MCL1-03          ---atgttt------------------------------ggcc---tcca
A0A2K5C7L5_MCL1-01      ---atgttt------------------------------ggcc---tcca
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ---atgttt------------------------------ggcc---tcaa
A0A2K6GI15_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2K6GI15_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2K6GI15_MCL1-03      ---atgttt------------------------------ggcc---tcaa
H2N5Y9_MCL1-01          ---atgttc------------------------------ggcc---tcaa
A0A2K5I9Q7_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2K5I9Q7_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2K5I9Q7_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A2K6KRW9_MCL1-02      ---atgttt------------------------------ggct---tcaa
A0A2K6PPL1_MCL1-02      ---atgttt------------------------------ggct---tcaa
A0A2K6KRW9_MCL1-01      ---atgttt------------------------------ggct---tcaa
A0A2K6PPL1_MCL1-01      ---atgttt------------------------------ggct---tcaa
A0A2K6KRW9_MCL1-03      ---atgttt------------------------------ggct---tcaa
A0A2K6PPL1_MCL1-03      ---atgttt------------------------------ggct---tcaa
A0A2I3GB35_MCL1-01      ---atgttt------------------------------ggcc---tcag
A0A2I3GB35_MCL1-02      ---atgttt------------------------------ggcc---tcag
A0A2I3GB35_MCL1-03      ---atgttt------------------------------ggcc---tcag
A0A2K5LXU8_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2K5XSC7_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2K5W0W9_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2K6ECR0_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2I3M3D6_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2K5LXU8_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2K5LXU8_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A0D9RZP5_MCL1-01      ---atgttt------------------------------ggcc---tcaa
I7G687_MCL1-01          ---atgttt------------------------------ggcc---tcaa
A0A2K5W0W9_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2K5W0W9_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A2K6ECR0_MCL1-01      ---atgttt------------------------------ggcc---tcaa
F7HUE9_MCL1-02          ---atgttt------------------------------ggcc---tcaa
A0A2K6ECR0_MCL1-03      ---atgttt------------------------------ggcc---tcaa
F7HUE9_MCL1-01          ---atgttt------------------------------ggcc---tcaa
A0A2K5XSC7_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A2K5XSC7_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2I3M3D6_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A2I3M3D6_MCL1-02      ---atgttt------------------------------ggcc---tcaa
G2HFR3_MCL1-01          ---atg--------------------------------------------
C8YZ26_MCL1-01          ---atgttt------------------------------ggcc---tcaa
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ---atgttt------------------------------ggcc---tcaa
A0A2I2YQH7_MCL1-03      ---atgttt------------------------------ggcc---tcaa
A0A2I2YQH7_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2R9BYH6_MCL1-02      ---atgttt------------------------------ggcc---tcaa
K7DE58_MCL1-02          ---atgttt------------------------------ggcc---tcaa
Q07820_MCL1-03          ---atgttt------------------------------ggcc---tcaa
K7DE58_MCL1-01          ---atgttt------------------------------ggcc---tcaa
A0A2R9BYH6_MCL1-01      ---atgttt------------------------------ggcc---tcaa
A0A2R9BYH6_MCL1-03      ---atgttt------------------------------ggcc---tcaa
K7DE58_MCL1-03          ---atgttt------------------------------ggcc---tcaa
B4DU51_MCL1-01          ---atgttt------------------------------ggcc---tcaa
Q07820_MCL1-04          ---atgttt------------------------------ggcc---tcaa
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          ---atgttt------------------------------ggcc---tcaa
Q07820_MCL1-01          ---atgttt------------------------------ggcc---tcaa
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      ---atgttc------------------------------ggcc---tcca
A0A2K6V5Y3_MCL1-03      ---atgttc------------------------------ggcc---tcca
A0A2K6V5Y3_MCL1-01      ---atgttc------------------------------ggcc---tcca
A0A2K5CFH3_MCL1-03      ---atgttt------------------------------ggcc---tcca
A0A2K5CFH3_MCL1-02      ---atgttt------------------------------ggcc---tcca
A0A2K5CFH3_MCL1-01      ---atgttt------------------------------ggcc---tcca
F7GTF7_MCL1-01          ---atgttt------------------------------ggcc---tcca
F7GTF7_MCL1-02          ---atgttt------------------------------ggcc---tcca
F7GTF7_MCL1-03          ---atgttt------------------------------ggcc---tcca
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      ----------------tggctgccgccttcctcgtggcgttcgtgctgct
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       -----------------ggtcggccccccggtagaggcggagccatggtg
E1B9B3_BCL2L10-01       --------------------------------------ggagccatggtg
F1MV39_BCL2L10-01       --------------------------------------ggagccatggtg
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gcggaacgccgtcat-cggcttcaacctctactgcggcggaggaagcccg
A0A1L1RNM6_MCL1-02      gcggaacgccgtcat-cggcttcaacctctactgcggcggaggaagcccg
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --gagaggcggagtcacacattctctatcagctgaagggaagact-----
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          -atggccccgaacacgccggcctcacct----------ggagccggcgga
R4GAJ0_MCL1-01          catggccccgaacacgccggcctcacct----------ggagccggcgga
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          gaagaacgccgtcat-cggcctcaacctttactgtggcggggcagggatg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          aagaaatgcattcat-cggactcaacctccactgcgggggggcag--ttg
G1PZ39_MCL1-01          ------------------gccccgccctctcccat---------------
Q9Z1P3_MCL1-01          gagaaacgcggtaat-cggcttgaacctgtactgcggcggcgctagcctc
P97287_MCL1-02          gagaaacgcggtcat-cggcttgaacctgtactgcggc------------
P97287_MCL1-01          gagaaacgcggtcat-cggcttgaacctgtactgcggcggcgccagcctc
A0A2K6F6N9_MCL1-01      ------------gat----------------ctgtggattaacc----tg
A0A2K5DMS4_MCL1-01      a------gtggtaat-cagactcaacctctact-----------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          aagaaacgcggtaat-cggactcaacctctacttgggggggcccgggttg
G1T2Q0_MCL1-01          aagaaacgcggtaat-cggactcaacctctacttgggggggcccgggttg
A0A287DCH9_MCL1-01      gaggaacgcggtcat-cggactcaacctctactgcgggggcgccgggctg
A0A287DCH9_MCL1-02      gaggaacgcggtcat-cggactcaacctctactgcggg------------
G3T756_MCL1-01          gagaaacgcagtaat-cggactcaacctttactgtgggggggccggcttg
W5QI41_MCL1-01          aaaccccgccctgccccaggccccgcccctgccttgaccccgccggttag
A5PJR2_MCL1-01          gagaaacgcagtaat-cggactaaacctctattgtgggggagccggatta
F1MQX4_MCL1-01          -----------------------aacct----------------------
A0A1S3F3I1_MCL1-01      aagaaacgcggtaat-cggactcaacttctactgtgggggcgccgggctg
J9PBC4_MCL1-01          gagaaacgcagtaat-cggactcaacctctactgtgggggggccgggctg
J9PBC4_MCL1-02          gagaaacgcagtaat-cggactcaacctctactgtgggggggccgggctg
Q8HYS5_MCL1-01          gagaaacgcagtaatccggactcaa-ctctactgtgggggggccgggctg
M3XAP4_MCL1-02          gagaaacgctgtaat-cggactcaacctctactgtgggggggccgggttg
Q7YRZ9_MCL1-01          gagaaacgctgtaat-cggactcaacctctactgtgggggggccgggttg
M3XAP4_MCL1-01          gagaaacgctgtaat-cggactcaacctctactgtgggggggccgggttg
M3XAP4_MCL1-03          gagaaacgctgtaat-cggactcaacctctactgtgggggggccgggttg
F7AVA6_MCL1-01          aagaaacgcagtaat-cggactcaacctctactgtgggggggccgggttg
G1L3M8_MCL1-01          aagaaacgcagtaat-cggactcaacctctactgtgggggggccgggttg
G1L3M8_MCL1-02          aagaaacgcagtaat-cggactcaacctctactgtgggggggccgggttg
M3XZZ5_MCL1-01          aagaaacgcagtaat-cggactcaacctctactgtgggggggccgggctg
Q95KR3_MCL1-01          gagaaacgcagtaat-cggactcaacctctactgtgggggggccggattg
K9IWB2_MCL1-02          gagaaacgcagtaat-cggactcaacctctactgtgggggggccggattg
K9IWB2_MCL1-01          gagaaacgcagtaat-cggactcaacctctactgtgggggggccggattg
K9IWB2_MCL1-03          gagaaacgcagtaat-cggactcaacctctactgtgggggggccggattg
A0A2K5C7L5_MCL1-01      aagaaacgcgctaat-cggactcaacctctactgtgagtgggccggcttg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gagaaacgcagtgat-cggactcaacctctactgtgggggcgccgggctg
A0A2K6GI15_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggattg
A0A2K6GI15_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggattg
A0A2K6GI15_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggattg
H2N5Y9_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5I9Q7_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5I9Q7_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5I9Q7_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6KRW9_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6PPL1_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6KRW9_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6PPL1_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6KRW9_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6PPL1_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3GB35_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3GB35_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3GB35_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5LXU8_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5XSC7_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5W0W9_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgcgggggggccggcttg
A0A2K6ECR0_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3M3D6_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5LXU8_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5LXU8_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A0D9RZP5_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
I7G687_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5W0W9_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgcgggggggccggcttg
A0A2K5W0W9_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgcgggggggccggcttg
A0A2K6ECR0_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F7HUE9_MCL1-02          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6ECR0_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F7HUE9_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5XSC7_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5XSC7_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3M3D6_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I3M3D6_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
G2HFR3_MCL1-01          ------------------gac------------------------atttg
C8YZ26_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I2YQH7_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2I2YQH7_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2R9BYH6_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
K7DE58_MCL1-02          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
Q07820_MCL1-03          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
K7DE58_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2R9BYH6_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2R9BYH6_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
K7DE58_MCL1-03          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
B4DU51_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
Q07820_MCL1-04          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
Q07820_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6V5Y3_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K6V5Y3_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5CFH3_MCL1-03      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5CFH3_MCL1-02      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
A0A2K5CFH3_MCL1-01      aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F7GTF7_MCL1-01          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F7GTF7_MCL1-02          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F7GTF7_MCL1-03          aagaaacgcggtaat-cggactcaacctctactgtgggggggccggcttg
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      gctctacatggtg-------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       gacccgtttagggagcgcacggcc--------------------------
E1B9B3_BCL2L10-01       gacccgtttagggagcgcaccgcc--------------------------
F1MV39_BCL2L10-01       gacccgtttagggagcgcaccgcc--------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ggcctggtgcccg-------------------------------------
A0A1L1RNM6_MCL1-02      ggcctggtgcccg-------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --------caactgtaccgacgct--------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctc
R4GAJ0_MCL1-01          ggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctc
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          ggcgccggcggcggcgccagcggt----cccccgtccggcgggcgcctgc
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ggggcctgtggcggcagcgaagcctacatctccttcaggaaggaggtccc
G1PZ39_MCL1-01          --------tagcg-------------------------------------
Q9Z1P3_MCL1-01          ggcgcgggcggcg----------------gctctccggccgggacgcgcc
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          ggcgcgggcggcg----------------gttctccggcaggggcgcgcc
A0A2K6F6N9_MCL1-01      gggatcagctgcg-------------------------------------
A0A2K5DMS4_MCL1-01      ----------------gcggtgcc----atccctccaggaccgcggcttt
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          ggagccggtggcg---gcggcgtc----gcccctccggcagagcggcttt
G1T2Q0_MCL1-01          ggagccggtggcg---gcggcgtc----gcccctccggcagagcggcttt
A0A287DCH9_MCL1-01      ggggccagcggcg------gcgcc----accccgccgggagcgcagctct
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          ggggccggcggct------gcgcc----acccctccgggagggcgacttc
W5QI41_MCL1-01          g-------------------------------------------------
A5PJR2_MCL1-01          ggacagggcagcg------gcgcc----tcctctccgggggggcggcttt
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      ggcgccggcagcg---gggccgcc----gccgcgccgggagggcggctct
J9PBC4_MCL1-01          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
J9PBC4_MCL1-02          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
Q8HYS5_MCL1-01          ggggccggcagcg---gcggcgcc----tcctcttcgggagggcggcttt
M3XAP4_MCL1-02          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
Q7YRZ9_MCL1-01          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
M3XAP4_MCL1-01          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
M3XAP4_MCL1-03          gcggccgggagcg---gcggcgcc----tcctcttcgggagggcggcttg
F7AVA6_MCL1-01          ggggccggcggcg---gcggcgcc----tcgtcgccgggagggcggcttt
G1L3M8_MCL1-01          ggggccggcagcggcgggggggna----t------cgggagggcggcttt
G1L3M8_MCL1-02          ggggccggcagcggcgggggggna----t------cgggagggcggcttt
M3XZZ5_MCL1-01          ggggccggcaccg---ggggcgcc----tcctcttcgggagggcggcttt
Q95KR3_MCL1-01          gggcctggaagcggcagcagc-----------------------------
K9IWB2_MCL1-02          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
K9IWB2_MCL1-01          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
K9IWB2_MCL1-03          gggcctggaagcggcagcagcgcc----tccgctccgggaggccgtctct
A0A2K5C7L5_MCL1-01      gggactggcagtg---gcggcacc----acccctccgggagggcggcttt
A0A2K5EPY9_MCL1-01      ------------------aatgcc----tcatgttccagac---------
A0A2K5EPY9_MCL1-02      ------------------ag---------------ccagag---------
H0XFB7_MCL1-01          ggggctggcagcg---gcggcgcc----acacccccgggagggcggcttt
A0A2K6GI15_MCL1-01      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
A0A2K6GI15_MCL1-02      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
A0A2K6GI15_MCL1-03      ggggccggcagca---gcggcgcc----acccccccgggagggcggcttt
H2N5Y9_MCL1-01          ggtgctggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5I9Q7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6KRW9_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6PPL1_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3GB35_MCL1-03      ggggccggcagcg---gc--------------------------------
A0A2K5LXU8_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5LXU8_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5LXU8_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A0D9RZP5_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
I7G687_MCL1-01          ggggccggcagca---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5W0W9_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7HUE9_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K6ECR0_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7HUE9_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5XSC7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2I3M3D6_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
G2HFR3_MCL1-01          ccggctctcagca---gcaatgc-------------------gtgaattt
C8YZ26_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2I2YQH7_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2I2YQH7_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
K7DE58_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
Q07820_MCL1-03          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
K7DE58_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
A0A2R9BYH6_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
K7DE58_MCL1-03          ggggccggcagcg---gcggcgcc----acccctccgggagggcgacttt
B4DU51_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
Q07820_MCL1-04          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
Q07820_MCL1-01          ggggccggcagcg---gcggcgcc----acccgcccgggagggcgacttt
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K6V5Y3_MCL1-03      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K6V5Y3_MCL1-01      ggggccggcagcg---gcggcgcc----acccccccgggagggcggcttc
A0A2K5CFH3_MCL1-03      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5CFH3_MCL1-02      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
A0A2K5CFH3_MCL1-01      ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-01          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-02          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F7GTF7_MCL1-03          ggggccggcagcg---gcggcgcc----acccctccgggagggcggcttt
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gg------------------------------------------------
R4GAJ0_MCL1-01          gg------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          tagcttctggcaaaggccctacggttgagagtactccgccgcagcgcgat
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          tgcc-----------------------------------cccaagagtca
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          tggcggccg---aggaggccaagg---------------cgcggcgcgag
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          tggtggccg---aggaggccaagg---------------cgcggcgcgag
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      t-------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          tggctgcggagaaggaggccgcgg---------------cccggctagag
G1T2Q0_MCL1-01          tggctgcggagaaggaggccgcgg---------------cccggctagag
A0A287DCH9_MCL1-01      tagccgccgagaaggaggccgcgg---------------cccggcgagag
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          cagctcctggaaaggaggccacgg---------------cccggcaagag
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          tggctgcggggaaggaggccacgg---------------cgcggcgagag
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      tg---acggcggaggaggccagtg---------------cccggcgggag
J9PBC4_MCL1-01          tggcttcggggaaggaggccacga---------------ccagacgggag
J9PBC4_MCL1-02          tggcttcggggaaggaggccacga---------------ccagacgggag
Q8HYS5_MCL1-01          tggcttcggggagggaggccacga---------------ccagacgggag
M3XAP4_MCL1-02          tggctgtggggaaggaggccacgg---------------ccaggcgagag
Q7YRZ9_MCL1-01          tggctgtggggaaggaggccacgg---------------ccaggcgagag
M3XAP4_MCL1-01          tggctgtggggaaggaggccacgg---------------ccaggcgagag
M3XAP4_MCL1-03          t-------------------------------------------------
F7AVA6_MCL1-01          tggctgcggggaaggaggccacgg---------------cccggcgagag
G1L3M8_MCL1-01          tggcttcggggaaggaggccacgg---------------cccggagggag
G1L3M8_MCL1-02          tggcttcggggaaggaggccacgg---------------cccggagggag
M3XZZ5_MCL1-01          tggcttcggggaaggaggccacgg---------------cccggcgggag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          tggctacgggaaaagaggccacgg---------------cccggcaagag
K9IWB2_MCL1-01          tggctacgggaaaagaggccacgg---------------cccggcaagag
K9IWB2_MCL1-03          tggctacgggaaaagaggccacgg---------------cccggcaagag
A0A2K5C7L5_MCL1-01      tggccacggagaaggaggcctcgg---------------cccagcgagag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          tggctgcggagaaggaggccgcgg---------------cccggcgagag
A0A2K6GI15_MCL1-01      tggctgccgagaaggaggccacgg---------------cccggcgagag
A0A2K6GI15_MCL1-02      tggctgccgagaaggaggccacgg---------------cccggcgagag
A0A2K6GI15_MCL1-03      t-------------------------------------------------
H2N5Y9_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5I9Q7_MCL1-03      t-------------------------------------------------
A0A2K6KRW9_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6PPL1_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6KRW9_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6PPL1_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6KRW9_MCL1-03      t-------------------------------------------------
A0A2K6PPL1_MCL1-03      t-------------------------------------------------
A0A2I3GB35_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3GB35_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5XSC7_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K6ECR0_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3M3D6_MCL1-01      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5LXU8_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5LXU8_MCL1-03      t-------------------------------------------------
A0A0D9RZP5_MCL1-01      tggctacggagaaggaggcctcgg---------------ctcggcgagag
I7G687_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5W0W9_MCL1-03      t-------------------------------------------------
A0A2K6ECR0_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
F7HUE9_MCL1-02          t-------------------------------------------------
A0A2K6ECR0_MCL1-03      t-------------------------------------------------
F7HUE9_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2K5XSC7_MCL1-03      t-------------------------------------------------
A0A2K5XSC7_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I3M3D6_MCL1-03      ta------------------------------------------------
A0A2I3M3D6_MCL1-02      tagctacggagaaggaggcctcgg---------------cccggcgagag
G2HFR3_MCL1-01          ta------------------------------------------------
C8YZ26_MCL1-01          t-------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2I2YQH7_MCL1-03      ta------------------------------------------------
A0A2I2YQH7_MCL1-01      tagctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-02      tggctacggagaaggaggcctcgg---------------cccggcgagag
K7DE58_MCL1-02          tggctacggagaaggaggcctcgg---------------cccggcgagag
Q07820_MCL1-03          tggctacggagaaggaggcctcgg---------------cccggcgagag
K7DE58_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-01      tggctacggagaaggaggcctcgg---------------cccggcgagag
A0A2R9BYH6_MCL1-03      t-------------------------------------------------
K7DE58_MCL1-03          t-------------------------------------------------
B4DU51_MCL1-01          tggctacggag---------------------------------------
Q07820_MCL1-04          t-------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
Q07820_MCL1-01          tggctacggagaaggaggcctcgg---------------cccggcgagag
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      tggccgcggagaaggaggcctcgg---------------cccagcgagag
A0A2K6V5Y3_MCL1-03      t-------------------------------------------------
A0A2K6V5Y3_MCL1-01      tggccgcggagaaggaggcctcgg---------------cccagcgagag
A0A2K5CFH3_MCL1-03      tggccacggagaaggaggcctcgg---------------cccagcgagag
A0A2K5CFH3_MCL1-02      t-------------------------------------------------
A0A2K5CFH3_MCL1-01      tggccacggagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-01          tggccacagagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-02          tggccacagagaaggaggcctcgg---------------cccagcgagag
F7GTF7_MCL1-03          t-------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        -----------------------------atgccaagtgcccggaattct
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          -----------------------------------------ttccgaagg
R4GAJ0_MCL1-01          -----------------------------------------ttccgaagg
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          ggaggggaagtggaaacagggacggcgggggcagggttgattggcggagg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ggggcggggagggaaacgggcacgg------------tgattggctggag
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          gggggaggggagg-------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          gggggaggggagg-------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          gtagggggaggggaggccggcgcgg------------tgattggcggaag
G1T2Q0_MCL1-01          gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A287DCH9_MCL1-01      gcagggggaggggaagccg-------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          gtagggggagggga------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          gtagggggaggggaagccggcacgg------------tgattggcggaag
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      gcggggggaggggaagccggcgcgg------------ggattggcggaag
J9PBC4_MCL1-01          ggagggggaggggaagccggtgcgg------------tgattggcggaag
J9PBC4_MCL1-02          ggagggggaggggaagccggtgcgg------------tgattggcggaag
Q8HYS5_MCL1-01          ggagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-02          gtagggggaggggaagccggtgcgg------------tgattggcggaag
Q7YRZ9_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ggagggggaggggaggccggcgcgg------------tgattggcggaag
G1L3M8_MCL1-01          atagggggaggggaagccggtgcgg------------tgattggcggaag
G1L3M8_MCL1-02          atagggggaggggaagccggtgcgg------------tgattggcggaag
M3XZZ5_MCL1-01          gtagggggaggggaagccggtgcgg------------tgattggcggaag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gtagggggaggggaagccggcatgg------------tgattggcggaag
K9IWB2_MCL1-01          gtagggggaggggaagccggcatgg------------tgattggcggaag
K9IWB2_MCL1-03          gtagggggaggggaagccggcatgg------------tgattggcggaag
A0A2K5C7L5_MCL1-01      gtagggggaggggaggccggcgtgg------------tgattggcggaag
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gcagggggaggggaagccggcgagg------------tgattggcggaag
A0A2K6GI15_MCL1-01      gtagggggaggggaagacggcacgg------------tgattggcggaag
A0A2K6GI15_MCL1-02      gtagggggaggggaagacggcacgg------------tgattggcggaag
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6PPL1_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6KRW9_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6PPL1_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcgaaag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I3GB35_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5XSC7_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K6ECR0_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2I3M3D6_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaac
A0A2K5LXU8_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
I7G687_MCL1-01          atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      atagggggaggggaggccggcacgg------------tgattggcggaag
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      atagggggaggggaggccggcacgg------------tgattggcggaac
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-02      atagggggaggggaggccggcgcgg------------tgattggcggaag
K7DE58_MCL1-02          atagggggaggggaggccggcgcgg------------tgattggcggaag
Q07820_MCL1-03          atagggggaggggaggccggcgcgg------------tgattggcggaag
K7DE58_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-01      atagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
Q07820_MCL1-01          atagggggaggggaggccggcgcgg------------tgattggcggaag
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5CFH3_MCL1-03      gtagggggaggggaggccggcgcgg------------tgattggcggaag
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gtagggggaggggaggccggcgcgg------------tgattggcggaag
F7GTF7_MCL1-01          gtagggggaggggaggccggcgcgg------------tgactggcggaag
F7GTF7_MCL1-02          gtagggggaggggaggccggcgcgg------------tgactggcggaag
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        ---------------cgaaaaaaggggaataacggcgtaaaggaccgaga
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       ---------------------------------------atgggtgtggc
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        cccctcccccgccagtcggccgcccctcagccctgctgtcttgccccctg
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        ------------------------------------atgaatgaattttc
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        ------------------------------------------------cc
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        ------------------------------------------------aa
W5QDH5_BCL2L2-01        ------------------------------------atgggctggccaaa
W5QDH5_BCL2L2-02        ------------------------------------atgggctggccaaa
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        ------------------------------------------------at
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------cttcaccagcaggagagcaaaccc
A0A1L1RNM6_MCL1-02      --------------------------cttcaccagcaggagagcaaaccc
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       -------------------------------------------------c
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          cctcaggtcttttctcagagaggccgcgccctctgattggcggggggcct
R4GAJ0_MCL1-01          cctcaggtcttttctcagagaggccgcgccctctgattggcggggggcct
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      ----------------------------------------------gttc
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          aatccgtgcgagtcctccgaatcctgtctcgccgggcgcccggggggtcg
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          cgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcg
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------ccgctctgctgcccggcgcgcgggtggtcg
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------ccgccctgctgcccggcgcgcgggtggtcg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcg
G1T2Q0_MCL1-01          cccgggcgct----------------------------------------
A0A287DCH9_MCL1-01      -----------------------cccagccgcccagcgcccgcagggtcg
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          cgccggcgcgagccccccggccgctgtcgctccggacggccggagggtcg
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcg
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      cgccggcgcgagcccctcgaccaccctggcgccggacgcccggagggtcg
J9PBC4_MCL1-01          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
J9PBC4_MCL1-02          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
Q8HYS5_MCL1-01          cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcg
M3XAP4_MCL1-02          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
Q7YRZ9_MCL1-01          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
M3XAP4_MCL1-01          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          cgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcg
G1L3M8_MCL1-01          cgccggcgctagtcccccggn-----------------------------
G1L3M8_MCL1-02          cgccggcgctagtcccccggcc------nnnnnnnnnnnnnnnnnnnnnn
M3XZZ5_MCL1-01          cgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcg
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
K9IWB2_MCL1-01          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
K9IWB2_MCL1-03          cgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcg
A0A2K5C7L5_MCL1-01      cgccggcgctagcccctcggccgccctcacgcctgacgcccgg-gggtcg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcg
A0A2K6GI15_MCL1-01      ccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcg
A0A2K6GI15_MCL1-02      ccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcg
A0A2K5I9Q7_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5I9Q7_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6PPL1_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6KRW9_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6PPL1_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcg
A0A2I3GB35_MCL1-02      cgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5XSC7_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K6ECR0_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2I3M3D6_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
I7G687_MCL1-01          cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-02      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
K7DE58_MCL1-02          cgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
Q07820_MCL1-03          cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
K7DE58_MCL1-01          cgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-01      cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          cgccggcgcaagccccccgtccaccctcacgccagactcccggagg----
Q07820_MCL1-01          cgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      cgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcg
A0A2K5CFH3_MCL1-03      cgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcg
F7GTF7_MCL1-01          cgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcg
F7GTF7_MCL1-02          cgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcg
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        ttgggaagaacagcatgcgacgggaaatatcatcttccgggggagccccg
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       ----------------------------------------------aggc
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      ----------------------------------------------atgg
A0A2K6M5H5_BCL2L10      ----------------------------------------------atgg
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       ----------------------------------------------atgg
H2NN92_BCL2L10-01       ----------------------------------------------atgg
Q9HD36_BCL2L10-01       ----------------------------------------------atgg
Q9HD36_BCL2L10-02       ----------------------------------------------atgg
G3QLU6_BCL2L10-01       ----------------------------------------------atgg
A0A2R9BCD9_BCL2L10      ----------------------------------------------atgg
H2Q9G4_BCL2L10-01       ----------------------------------------------atgg
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       ggcccctccctgggcggaggcgcagcgggacctagaaaaccgggtcgggt
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        cccctccaggccccccggcagccctcctgacgcccctccacggcctcccc
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        ----------------------------catagctcaagccccattttct
G1Q051_BCL2L2-01        tctagacaactttatgctctatagttttgattctgttgatattaggccca
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        -------ctgagcctctgtctacatattcccgatattcatgccggtcttt
G1P3J2_BCL2L2-01        tgaaatgctccattctgtgtctctgactaaatatactcatgccagtcttt
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        -------atgccccttctgattctctctccatatattcatgccagtgttt
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        ----------------------------ccatatattcatgccagtcttt
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        gcctgaagcaccccttctggctttccaaccatatattcacgccagccttt
W5QDH5_BCL2L2-01        cctgaaatacctccttctgggcctctcaccatatattcatgccagtcttt
W5QDH5_BCL2L2-02        cctgaaatacctccttctgggcctctcaccatatattcatgccagtcttt
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      -------------cttctggttctctgtccatatattaatgccagtcttt
A0A2K6TM77_BCL2L2-      -------------------------------------------catcttt
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      -------atgccccttctggttctctgtccatatattcatgccagtcttt
A0A2K5CWZ4_BCL2L2-      -------------------------------------------catcttt
G3TMU7_BCL2L2-01        -------------------------------tatattcatgttagtcttt
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        gtccctttttggtctctgtcaatatttttcatatatttatgtcagtctgt
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          ----------------------------ccatttggctgctctccttggt
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------atgttcgcctcccagggc
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          ---------cagtcagtaattgccaagcagcgcccctcgactagtttcct
F7ETY1_MCL1-01          ---------cagtcggtcattgccaagcagcgtacctctgcgggcttcct
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      -----tctccgctcatcagccccaagcccctcgccctgcccggagctcat
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          ---------------cattttgggctggtttcacccaactcagaagcgag
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1L1RNM6_MCL1-02      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       tccttccgccgtctgtatgtgcagaga-----------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          cgcgccggacccctgagggcgctgattggccc------------------
R4GAJ0_MCL1-01          cgcgccggacccctgagggcgctgattggccc------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      tccttccgccgtctggatgtgcagagagccgtcacat-------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          cgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatc--
G3WBC5_MCL1-01          --------------------------------gacgtcaccgccccgc--
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ctcgcccctcgcccatgggcacggagggtcccgatggcaccgcggccc-c
G1PZ39_MCL1-01          --------------------gccgagggccccgacgtcatcgggaccctt
Q9Z1P3_MCL1-01          cccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcgg-c
P97287_MCL1-02          -----------------ggcgccgaggaccccgacgtcaccgcgtcgg-c
P97287_MCL1-01          cccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcgg-c
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cgcggccggcgcccattggcgccgagctccccgacgtcagcgcgaccc-c
G1T2Q0_MCL1-01          --------------attggcgccgagctccccgacgtcagcgcgaccc-c
A0A287DCH9_MCL1-01      cgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A287DCH9_MCL1-02      -----------------ggcgccgaggtccccgacgtcaccgcgaccc-c
G3T756_MCL1-01          tgcggccggcgcccattggcgccgagggccccgacgtcactgcgattc-c
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
F1MQX4_MCL1-01          ---------------------------------------------ccc-c
A0A1S3F3I1_MCL1-01      cgcgtcccgcgcccattggcgccgaggtccccgacgtcaccgggaccc-c
J9PBC4_MCL1-01          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
J9PBC4_MCL1-02          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
Q8HYS5_MCL1-01          cgcggccctcacccattggcgctgagggccccaacgtcagcgcgaccc-c
M3XAP4_MCL1-02          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
Q7YRZ9_MCL1-01          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
M3XAP4_MCL1-01          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccc-c
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          cgcggccctcccccattggcgccgagggccccgacgtcaccgcgccct-c
G1L3M8_MCL1-01          ----------------tggcgccgagggtcccgacgtcacggcgaccc-c
G1L3M8_MCL1-02          nnnnnnnnnnnnnnnntggcgccgagggtcccgacgtcacggcgaccc-c
M3XZZ5_MCL1-01          cgcggccctcgcccattggcgccgagggccccaacgtcaccgcgaccc-c
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
K9IWB2_MCL1-01          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
K9IWB2_MCL1-03          cgcggccctcgcccattggcgccgagggccccgacgtcaccgcgaccc-c
A0A2K5C7L5_MCL1-01      tgcggccgctgc--------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          cgcggccgccgcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-01      cgcggccggctcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-02      cgcggccggctcccattggtgccgaagtccccgacgtcaccgcgaccc-c
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6PPL1_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6KRW9_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6PPL1_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgggaccc-c
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgcggccgccgcccattggcgccgaggtctccgacgtcactgcgaccc-c
A0A2I3GB35_MCL1-02      cgcggccgccgcccattggcgccgaggtctccgacgtcactgcgaccc-c
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5XSC7_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5W0W9_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K6ECR0_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2I3M3D6_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5LXU8_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
I7G687_MCL1-01          cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5W0W9_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc-c
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccc-c
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-02      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
K7DE58_MCL1-02          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
Q07820_MCL1-03          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
K7DE58_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-01      cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          cgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5CFH3_MCL1-03      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-01          tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-02          tgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgaccc-c
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        ataagtacctgacggagcaaggctggatg-----------------gcgc
Q5XGJ4_BCL2L2-01        --------------------------atg-----------------gcgc
B9ZYL7_BCL2-01          --------------------------atg-----------------gctc
F7BXJ7_BCL2-01          --------------------------atg-----------------gctc
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        ----------------------------------------------cgaa
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------atgtttccttt---------gcaa
H2MLZ3_MCL1-02          --------------------------atgtttccttt---------gcaa
Q0KFR9_MCL1-01          --------------------------atgagyctg-----------tcga
F1RZB9_BCL2L10-01       --------------------------atg-----------------gcgg
H0WZ06_BCL2L10-01       --------------------------atg-----------------gcag
G1T264_BCL2L10-01       cccagcggaggctggcc---------atg-----------------gcag
A0A2K6F2Q2_BCL2L10      --------------------------atg-----------------ggtg
A0A2K6TIT7_BCL2L10      --------------------------atg-----------------gctg
A0A2K5F974_BCL2L10      --------------------------atg-----------------gctg
F7CT87_BCL2L10-01       --------------------------atg-----------------gctg
A0A0D9RG38_BCL2L10      --------------------------atg-----------------gctg
A0A2K5TKG9_BCL2L10      --------------------------atg-----------------gctg
F7H6U5_BCL2L10-01       --------------------------atg-----------------gctg
A0A2K6B2D9_BCL2L10      --------------------------atg-----------------gctg
A0A2K5MMZ4_BCL2L10      --------------------------atg-----------------gctg
A0A096NM44_BCL2L10      --------------------------atg-----------------gctg
A0A2K5K3B0_BCL2L10      ctgaccagttgcgggagcgcaccaacgtg-----------------gctg
A0A2K6M5H5_BCL2L10      ctgacccgttgcgggagcgcaccaccgtg-----------------gctg
A0A2K6R5T5_BCL2L10      --------------------------atg-----------------gctg
G1R3W6_BCL2L10-01       ttgaccagt-----------------------------------------
H2NN92_BCL2L10-01       ttgaccagttgcgggagcgcactatcacg-----------------gccg
Q9HD36_BCL2L10-01       ttgaccagttgcgggagcgcaccaccatg-----------------gccg
Q9HD36_BCL2L10-02       ttgaccagttgcgggagcgcaccaccatg-----------------gccg
G3QLU6_BCL2L10-01       ttgaccagtggcgggagcgcaccaccatg-----------------gccg
A0A2R9BCD9_BCL2L10      ttgaccagtggcgtgagcgcactaccatg-----------------gccg
H2Q9G4_BCL2L10-01       ttgaccagtggcgtgagcgcaccaccatg-----------------gccg
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------atg-----------------gctg
G1LKR4_BCL2L10-01       --------------------------atg-----------------gcgg
M3Y8D1_BCL2L10-01       cgggcagcgcggggagaggtcgggccatg-----------------gcgg
A0A087X830_MCL1-01      --------------------------atg-----------------acg-
I3JHR5_MCL1-01          --------------------------atg-----------------acca
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------atg-----------------gcaa
H9GPE7_BCL2-01          --------------------------atg-----------------gctc
Q4SW32_MCL1-01          --------------------------atgagcgttatc--------gcga
F7G6M3_BCL2L2-01        ctccccgctgtcctgcagccccccggatg-----------------gcg-
F6U940_BCL2L2-01        --------------------------atg-----------------gcg-
G3WPT2_BCL2L2-02        --------------------------atg-----------------gcg-
G3WPT2_BCL2L2-01        tctctctgccttttatagccagccagatg-----------------gcg-
G1Q051_BCL2L2-01        aagtgctgggtccta-------------a-----------------gag-
A0A1U7RC37_BCL2L2-      --------------------------atg-----------------gcg-
D3Z5F7_BCL2L2-01        --------------------------atg-----------------gcg-
P70345_BCL2L2-04        --------------------------atg-----------------gcg-
G1TV33_BCL2L2-01        catccttgcctcttacagccgcccggatg-----------------gcg-
G1P3J2_BCL2L2-01        tatccttgacctttacagccgcccggatg-----------------gcg-
A0A2K6GWN0_BCL2L2-      --------------------------atg-----------------gcg-
A0A2R9A7B2_BCL2L2-      --------------------------atg-----------------gcg-
H2Q805_BCL2L2-02        --------------------------atg-----------------gcg-
A0A2I2YPX6_BCL2L2-      --------------------------atg-----------------gcg-
G1RYB4_BCL2L2-01        --------------------------atg-----------------gcg-
F7G4L5_BCL2L2-05        --------------------------atg-----------------gcg-
F7G4L5_BCL2L2-04        catccttgcctcttatagctgcccggatg-----------------gcg-
A0A2I3MUE4_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5V0Q3_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6AI30_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5MZX9_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6EA73_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5HEK7_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6MEE6_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6RW46_BCL2L2-      --------------------------atg-----------------gcg-
A0A2R8M4C0_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5CWZ4_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6TM77_BCL2L2-      --------------------------atg-----------------gcg-
A0A287AW74_BCL2L2-      --------------------------atg-----------------gcg-
F6PH48_BCL2L2-01        --------------------------atg-----------------gcg-
Q45T69_BCL2L2-01        --------------------------atg-----------------gcg-
G1LMC3_BCL2L2-01        catccttgactcttacagccgcccggatg-----------------gcg-
A0A2I2UAE3_BCL2L2-      --------------------------atg-----------------gcg-
M3Y5X5_BCL2L2-01        catccttgactcttacagccgcccggatg-----------------gcg-
W5QDH5_BCL2L2-01        tatgtttgactccaacagccgcccggatg-----------------gcg-
W5QDH5_BCL2L2-02        tatgtttgactccaacagccgcccggatg-----------------gcg-
Q05KI8_BCL2L2-01        --------------------------atg-----------------gcg-
Q1RMX3_BCL2L2-01        --------------------------atg-----------------gcg-
A0A1U7RC37_BCL2L2-      --------------------------atg-----------------gcg-
A0A287AW74_BCL2L2-      --------------------------atg-----------------gcg-
A0A286XQQ9_BCL2L2-      --------------------------atg-----------------gcg-
H0XR82_BCL2L2-01        --------------------------atg-----------------gcg-
A0A2K6GWN0_BCL2L2-      --------------------------atg-----------------gcg-
I3ND50_BCL2L2-02        --------------------------atg-----------------gcg-
A0A1S3FYD8_BCL2L2-      --------------------------atg-----------------gcg-
A0A2R9A7B2_BCL2L2-      --------------------------atg-----------------gcg-
H2Q805_BCL2L2-01        --------------------------atg-----------------gcg-
G1RYB4_BCL2L2-03        --------------------------atg-----------------gcg-
A0A2I2YPX6_BCL2L2-      --------------------------atg-----------------gcg-
Q92843_BCL2L2-02        --------------------------atg-----------------gcg-
A0A2K5MZX9_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6EA73_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5V0Q3_BCL2L2-      --------------------------atg-----------------gcg-
F7G4L5_BCL2L2-02        --------------------------atg-----------------gcg-
F7G4L5_BCL2L2-03        --------------------------atg-----------------gcg-
A0A2K6AI30_BCL2L2-      --------------------------atg-----------------gcg-
A0A2I3MUE4_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6RW46_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6RW46_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K6MEE6_BCL2L2-      --------------------------atg-----------------gcg-
A0A0D9RU30_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5HEK7_BCL2L2-      --------------------------atg-----------------gcg-
A0A2R8M4C0_BCL2L2-      catccttgcctcttatagctgcccggatg-----------------gcg-
A0A2K6TM77_BCL2L2-      catccttgcctcttatagccgcccggatg-----------------gcg-
A0A2K6TM77_BCL2L2-      --------------------------atg-----------------gcg-
A0A2K5CWZ4_BCL2L2-      catccttgcctcttatagccgcccggatg-----------------gcg-
A0A2K5CWZ4_BCL2L2-      catccttgcctcttatagccgcccggatg-----------------gcg-
G3TMU7_BCL2L2-01        catccctgactcttgcagccgcccgcatg-----------------gcg-
O88996_BCL2L2-01        --------------------------atg-----------------gcg-
Q7TS60_BCL2L2-01        catccttgcccctttcagccgcccggatg-----------------gcg-
I3ND50_BCL2L2-01        --------------------------atg-----------------gcg-
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------atg-----------------gcg-
W5N4F7_BCL2-01          --------------------------atg-----------------gcaa
A0A2U9CJ81_MCL1-01      --------------------------atg---------------aatatc
G3PJT0_MCL1-01          --------------------------atg---------------aatata
W5MMB7_MCL1-01          --------------------------atgagcctctcctcgctgaagcgc
F6YNL8_BCL2-01          -----------------------atgatg-----------------gctc
G3WZW9_BCL2-02          gttcactgctctctcctttgggaataatg-----------------gctc
G3WZW9_BCL2-01          --------------------------atg-----------------gctc
K7F5Y4_BCL2-02          --------------------------atg-----------------gctc
K7F5Y4_BCL2-01          --------------------------atg-----------------gctc
K7F5Y4_BCL2-03          --------------------------atg-----------------gctc
H0W1T3_BCL2-01          --------------------------atg-----------------gctc
F1LNV0_BCL2-01          --------------------------atg-----------------gcgc
P49950_BCL2-01          --------------------------atg-----------------gcgc
P10417_BCL2-01          --------------------------atg-----------------gcgc
Q7TSN8_BCL2-01          --------------------------atg-----------------gcgc
P10417_BCL2-02          --------------------------atg-----------------gcgc
Q6R755_BCL2-01          --------------------------atg-----------------gcgc
Q9JJV8_BCL2-01          --------------------------atg-----------------gctc
Q923R6_BCL2-01          --------------------------atg-----------------gctc
G3ULB7_BCL2-02          --------------------------atg-----------------gcgc
G3ULB7_BCL2-01          --------------------------atg-----------------gcgc
F6R2C4_BCL2-01          --------------------------atg-----------------gcgc
O02718_BCL2-01          --------------------------atg-----------------gcgc
A0A076FU27_BCL2-01      --------------------------atg-----------------gcgc
A0A076FZV9_BCL2-01      --------------------------atg-----------------gcgc
G1TW27_BCL2-01          --------------------------atg-----------------gcgc
I3MVK9_BCL2-01          --------------------------atg-----------------gctc
M3YYK3_BCL2-01          --------------------------atg-----------------gcgc
G1LID1_BCL2-01          ----------------------------------------------cccc
F7CDX6_BCL2-01          --------------------------atg-----------------gcgc
A0A287APJ6_BCL2-03      --------------------------atg-----------------gcgc
G1LID1_BCL2-02          --------------------------atg-----------------gcgc
M3X1R9_BCL2-01          --------------------------atg-----------------gcgc
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------atg-----------------gcgc
Q75SV7_BCL2-01          --------------------------atg-----------------gcgc
H0WKI0_BCL2-01          --------------------------atg-----------------gcgc
A0A2K6G3I7_BCL2-01      --------------------------atg-----------------gcgc
A0A2K5EB04_BCL2-01      --------------------------atg-----------------gcgc
A0A1D5QRF2_BCL2-01      --------------------------atg-----------------gcgc
A0A2K6UEL3_BCL2-01      --------------------------atg-----------------gcgc
A0A2R8MY14_BCL2-01      --------------------------atg-----------------gcgc
A0A2K6R2I6_BCL2-02      --------------------------atg-----------------gcgc
A0A2K5HK49_BCL2-01      --------------------------atg-----------------gcgc
A0A2K6KHG1_BCL2-01      --------------------------atg-----------------gcgc
A0A2K6R2I6_BCL2-01      --------------------------atg-----------------gcgc
A0A2K5XRD4_BCL2-01      --------------------------atg-----------------gcgc
A0A2K5NZS5_BCL2-01      --------------------------atg-----------------gcgc
A0A0D9S017_BCL2-01      --------------------------atg-----------------gcgc
A0A2K5UDI5_BCL2-01      --------------------------atg-----------------gcgc
A0A2K6CIX3_BCL2-01      --------------------------atg-----------------gcgc
A0A096MPU7_BCL2-01      --------------------------atg-----------------gcgc
H2NWH5_BCL2-01          --------------------------atg-----------------gcgc
P10415_BCL2-04          --------------------------atg-----------------gcgc
G3QES9_BCL2-01          --------------------------atg-----------------gcgc
A0A2I3GZF9_BCL2-01      --------------------------atg-----------------gcgc
A9QXG9_BCL2-01          --------------------------atg-----------------gcgc
P10415_BCL2-01          --------------------------atg-----------------gcgc
P10415_BCL2-02          --------------------------atg-----------------gcgc
H2QEM8_BCL2-01          --------------------------atg-----------------gcgc
A0A2R9APW6_BCL2-01      --------------------------atg-----------------gcgc
U3KEW4_BCL2-01          --------------------------atg-----------------gctc
H0YUX3_BCL2-01          --------------------------atg-----------------gctc
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------atg-----------------gctc
Q00709_BCL2-02          --------------------------atg-----------------gctc
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -----------------------------------------atgaaccag
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          ----------------------------atggccaacgaaattcgctatg
Q564A4_BCL2-01          ----------------------------atggctaacgaaattagctatg
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        ttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagca
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      ----------------------------------atggcc---------g
Q9Z0F3_BCL2L10-01       ----------------------------------atggccgactcgcagg
Q99M66_BCL2L10-01       ----------------------------------atgg---------gtg
B6V6J0_MCL1-01          cattccctgccagttttactgctcgggcggcgg---------ctcctcag
F7ETY1_MCL1-01          catcccctgccagttctactgctcgggtggcggcggcgggaacgcctcag
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------atgctgtcacagaaactaacttca
D2ITA0_MCL1-04          --------------------------atgctgtcacagaaactaacttca
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      -----------------------------------------------tac
M4A558_BCL2L1-01        -----------------------------------------------tac
A0A0F7L1T6_BCL2L1-      -----------------------------------------------tat
H2U5I3_BCL2L1-01        -----------------------------------------------tat
H2U5I3_BCL2L1-02        -----------------------------------------------tat
G3P7B4_BCL2L1-01        -----------------------------------------------aac
E6ZFR0_BCL2L1-01        -----------------------------------------------tac
A0A0B4KJI5_BCL2L1-      -----------------------------------------------tac
Q568V1_MCL1-01          -----------------------------------------------atg
Q1L8X3_MCL1-01          -----------------ctgagtttggattttaggcgaacggccacgatg
Q9I9N3_MCL1-01          -----------------ctgagtttggattttaggcgaacggccacgatg
A0A1X9JZA1_BCL2-01      --------------------------------------------aacgag
Q6GLI5_BCL2L1-01        -----------------------------------------------ggc
Q2TAP5_BCL2L1-01        -----------------------------------------------ggc
Q91828_BCL2L1-01        -----------------------------------------------ggc
H3AR18_MCL1-01          ----------------------------------------------atgg
H3AR18_MCL1-02          ---------------------------------------------ggtta
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        -----------------------------------------------agc
K7F655_BCL2L1-01        -----------------------------------------------aac
G1N5N5_BCL2L1-01        -----------------------------------------------agc
Q07816_BCL2L1-03        -----------------------------------------------agc
Q07816_BCL2L1-01        -----------------------------------------------agc
Q07816_BCL2L1-02        -----------------------------------------------agc
U3JSL7_BCL2L1-01        -----------------------------------------------agc
Q4U2V6_BCL2L1-01        -----------------------------------------------agc
H0Z8G3_BCL2L1-01        -----------------------------------------------agc
F6WA14_BCL2L1-01        -----------------------------------------------cac
G3WKX6_BCL2L1-01        -----------------------------------------------cac
W5PSA5_BCL2L1-01        -----------------------------------------------cag
G3SPN0_BCL2L1-01        -----------------------------------------------cag
H0X6V2_BCL2L1-01        -----------------------------------------------cag
P53563_BCL2L1-04        -----------------------------------------------cag
P53563_BCL2L1-02        -----------------------------------------------cag
P53563_BCL2L1-03        -----------------------------------------------cag
P53563_BCL2L1-01        -----------------------------------------------cag
O35843_BCL2L1-01        -----------------------------------------------cag
Q64373_BCL2L1-09        -----------------------------------------------cag
Q64373_BCL2L1-01        -----------------------------------------------cag
Q64373_BCL2L1-03        -----------------------------------------------cag
Q64373_BCL2L1-04        -----------------------------------------------cag
B2Z3Z4_BCL2L1-01        -----------------------------------------------cag
A0A1U7QU73_BCL2L1-      -----------------------------------------------cag
Q9MYW4_BCL2L1-01        -----------------------------------------------cag
A0A1S3EPX7_BCL2L1-      -----------------------------------------------cag
O77737_BCL2L1-01        -----------------------------------------------cag
A0A286Y5D6_BCL2L1-      -----------------------------------------------caa
G1P9D2_BCL2L1-01        -----------------------------------------------cag
Q05KJ0_BCL2L1-01        -----------------------------------------------cag
Q9MZS7_BCL2L1-01        -----------------------------------------------cag
A0A1S2ZQT6_BCL2L1-      -----------------------------------------------cag
A0A1L5BWY3_BCL2L1-      -----------------------------------------------cag
A0A287CZ07_BCL2L1-      -----------------------------------------------cag
I3MUP5_BCL2L1-03        -----------------------------------------------cag
I3MUP5_BCL2L1-02        -----------------------------------------------cag
I3MUP5_BCL2L1-01        -----------------------------------------------cag
F6WQI0_BCL2L1-01        -----------------------------------------------cag
E2IV76_BCL2L1-01        -----------------------------------------------cag
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------------------------------------------cag
G1RER8_BCL2L1-01        -----------------------------------------------cag
A0A2J8VIH3_BCL2L1-      -----------------------------------------------cag
Q07817_BCL2L1-03        -----------------------------------------------cag
Q07817_BCL2L1-01        -----------------------------------------------cag
Q07817_BCL2L1-02        -----------------------------------------------cag
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        -----------------------------------------------cag
A0A2K5H963_BCL2L1-      -----------------------------------------------cag
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------------------------------------------cag
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------------------------------------------cag
A0A2K5VPG2_BCL2L1-      -----------------------------------------------cag
F6UKR4_BCL2L1-01        -----------------------------------------------cag
A0A0D9RJZ8_BCL2L1-      -----------------------------------------------cag
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      -----------------------------------------------cag
A0A2K6QFA2_BCL2L1-      -----------------------------------------------cag
A0A2K6QFA2_BCL2L1-      -----------------------------------------------cag
A0A2K5YR37_BCL2L1-      -----------------------------------------------cag
A0A2K6UWY8_BCL2L1-      -----------------------------------------------cag
E2IV77_BCL2L1-01        -----------------------------------------------cag
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        -----------------------------------------------cag
F7IT34_BCL2L1-01        -----------------------------------------------cag
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------------------------------------------cag
E2IV75_BCL2L1-01        -----------------------------------------------cag
M3Z2H9_BCL2L1-01        -----------------------------------------------cag
M3XA94_BCL2L1-01        -----------------------------------------------cag
Q76LT7_BCL2L1-01        -----------------------------------------------cag
Q8SQ42_BCL2L1-01        -----------------------------------------------cag
H3AAS7_BCL2L2-01        ------------------------------tcgctttacagtaacagagg
H3AAS7_BCL2L2-02        ------------------------------tcgctttacagtaacagagg
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      gtggtggttactggaggctccagcggcatcggaaagtgcattgccattga
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        ----------------------------------------------gagc
U3IRH3_MCL1-01          ctcccgagccagctg-----------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1L1RNM6_MCL1-02      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A286XUI2_BCL2A1-      ------------------------cacatcctgctcagcgccact-----
I3J363_BCL2L10-01       -----------------------------gcagtctgatatcgctgggag
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --ctgggaggggtctcagcgggcgctgattggctgcgacgctgagggaga
R4GAJ0_MCL1-01          --ctgggaggggtctcagcgggcgctgattggctgcgacgctgagggaga
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          --cgatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccg
G3WBC5_MCL1-01          --cgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccg
H0XHA5_MCL1-01          ----------------------------------------ctaccagacc
G1QAV8_MCL1-01          tgccaggtggctgttct---cgcccatcagccg-gaattgc--cctgaag
G1PZ39_MCL1-01          cgcgcggcggctgttt---gcgccccttggctgtgcggggctgcccgcgg
Q9Z1P3_MCL1-01          agagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgagg
P97287_MCL1-02          cgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgagg
P97287_MCL1-01          cgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgagg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          cgcgaggctgctgtacttggcgcccacccgccgcgcgtcgccgctcgagg
G1T2Q0_MCL1-01          cgcgaggctgctgtacttggcgcccacccgccgcgcgtcgccgctcgagg
A0A287DCH9_MCL1-01      ggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgaga
A0A287DCH9_MCL1-02      ggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgaga
G3T756_MCL1-01          cgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtgg
W5QI41_MCL1-01          ----------------------------tgccgtgcgcaaccgcc-----
A5PJR2_MCL1-01          caccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaag
F1MQX4_MCL1-01          caccaa--------------------------------------ctgaag
A0A1S3F3I1_MCL1-01      aactaagcgggtgttcttcgcgcccacccaccgtgcgccgacgccggacg
J9PBC4_MCL1-01          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
J9PBC4_MCL1-02          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
Q8HYS5_MCL1-01          cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaag
M3XAP4_MCL1-02          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaa
Q7YRZ9_MCL1-01          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaag
M3XAP4_MCL1-01          cccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaa
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ctccaggctgctgttcttcgcgcccacccgctgcgcgtcgccgcctgagg
G1L3M8_MCL1-01          cccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaag
G1L3M8_MCL1-02          cccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaag
M3XZZ5_MCL1-01          cccgaggctgctgttcttcgagcctacccaccgcgcgtcgccgcctgaag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
K9IWB2_MCL1-01          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
K9IWB2_MCL1-03          cgccagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaag
A0A2K5C7L5_MCL1-01      ----------tggttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          cacgaggctgctgttcttcgcgcccaccctccgtgcggcgccgcgggagg
A0A2K6GI15_MCL1-01      ggagaggctgctgttcttcgcgcccacccgccgcgcattgccgtccgagg
A0A2K6GI15_MCL1-02      ggagaggctgctgttcttcgcgcccacccgccgcgcattgccgtccgagg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          cgcgaggctgtttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6PPL1_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6KRW9_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6PPL1_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgagg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      cgcgaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgagg
A0A2I3GB35_MCL1-02      cgcgaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgagg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5XSC7_MCL1-02      cgcgaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5W0W9_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K6ECR0_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2I3M3D6_MCL1-01      cgcgaggccgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5LXU8_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
I7G687_MCL1-01          cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5W0W9_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          cgcgaggctgcttttctttgcgcccacccgccgcgcgtcgccgcttgagg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      cgcgaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      cgcgaggccgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-02      cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
K7DE58_MCL1-02          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
Q07820_MCL1-03          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
K7DE58_MCL1-01          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-01      cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          cgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgagg
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
A0A2K5CFH3_MCL1-03      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgagg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgagg
F7GTF7_MCL1-01          ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
F7GTF7_MCL1-02          ctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggagg
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        aatctg---------------------------------------aacta
Q5XGJ4_BCL2L2-01        aatctg---------------------------------------aacta
B9ZYL7_BCL2-01          atccta-----------------------------gaagaggaggctatg
F7BXJ7_BCL2-01          atccta-----------------------------ggagaggaggctatg
Q90Z98_BCL2L1-01        -----------------------------------------atgtcttac
Q90Z98_BCL2L1-02        -----------------------------------------atgtcttac
H2SNZ8_BCL2L1-02        -----------------------------------------atgtctca-
H2SNZ8_BCL2L1-01        -----------------------------------------atgtctca-
H3CH49_BCL2L1-01        gtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtctct-
A0A059PJI5_BCL2L1-      -----------------------------------------atgtcttac
B5XAY3_BCL2L1-01        --------------------------------------atgatgacttac
W5MG74_BCL2L1-01        --------------------------------------aagatgtcatac
A0A087X9B7_BCL2L1-      -----------------------------------------atgtcacg-
A0A2U9BY16_BCL2L1-      -----------------------------------------atgtctca-
A0A0D6DR75_BCL2L1-      -----------------------------------------atgtctca-
I3IZK7_BCL2L1-01        -----------------------------------tacaaaatgtctca-
A0A219P0Y3_BCL2L1-      -----------------------------------------atgtgtca-
G3NJY1_BCL2L1-01        -----------------------------------------atgtctca-
C3VIT1_BCL2L1-01        -----------------------------------------atgtctca-
H2MLZ3_MCL1-01          aaacag----------------------------------atggttaaca
H2MLZ3_MCL1-02          aaacag----------------------------------atggttaaca
Q0KFR9_MCL1-01          actcgatta------------------------------cacgagccaca
F1RZB9_BCL2L10-01       acgcgt---------------------------------tcagggagcgc
H0WZ06_BCL2L10-01       acccgt---------------------------------tgagggagcgc
G1T264_BCL2L10-01       acgctt---------------------------------tggaggagcgc
A0A2K6F2Q2_BCL2L10      accggt---------------------------------tcagggagcgc
A0A2K6TIT7_BCL2L10      acccgc---------------------------------tgcagcagcgc
A0A2K5F974_BCL2L10      acccgc---------------------------------tgcggcagcgc
F7CT87_BCL2L10-01       acccgc---------------------------------tgcggcagcgc
A0A0D9RG38_BCL2L10      acccgt---------------------------------tgcgggagcgc
A0A2K5TKG9_BCL2L10      acccgt---------------------------------tgcgggagcgc
F7H6U5_BCL2L10-01       acccgt---------------------------------tgcgggagcgc
A0A2K6B2D9_BCL2L10      acccgt---------------------------------tgcgggagcgc
A0A2K5MMZ4_BCL2L10      acccgt---------------------------------tgcgggagcgc
A0A096NM44_BCL2L10      acccgt---------------------------------tgcgggagcgc
A0A2K5K3B0_BCL2L10      acccgt---------------------------------tgcgcgagcgc
A0A2K6M5H5_BCL2L10      acccgt---------------------------------tgcgcgagcgc
A0A2K6R5T5_BCL2L10      acccgt---------------------------------tgcgcgagcgc
G1R3W6_BCL2L10-01       ---------------------------------------tgcgggagcgc
H2NN92_BCL2L10-01       acctgc---------------------------------tgagggagcgc
Q9HD36_BCL2L10-01       acccgc---------------------------------tgcgggagcgc
Q9HD36_BCL2L10-02       acccgc---------------------------------tgcgggagcgc
G3QLU6_BCL2L10-01       acccgc---------------------------------tgcgggagcgc
A0A2R9BCD9_BCL2L10      acccgc---------------------------------tgcgggagcgc
H2Q9G4_BCL2L10-01       acccgc---------------------------------tgcgggagcgc
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      acgcgt---------------------------------tgagggagcgc
G1LKR4_BCL2L10-01       acgcgt---------------------------------tgaggg---gc
M3Y8D1_BCL2L10-01       acgctt---------------------------------tgagggagcgc
A0A087X830_MCL1-01      --gcta---------------------------------------attcg
I3JHR5_MCL1-01          actttt---------------------------------tgatgtcgaaa
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      ac-----------------------------------gagaatccttatg
H9GPE7_BCL2-01          atcctg-------------------------ggataag----aggttacg
Q4SW32_MCL1-01          accgcaccgcgatagacaccatgaatgttatgtttcaa-aatggagtcgg
F7G6M3_BCL2L2-01        accccg-------------------------gccccggcctcggtctcag
F6U940_BCL2L2-01        actcca-------------------------gcctcag-c-----cccag
G3WPT2_BCL2L2-02        actcca-------------------------gcctcag-c-----cccag
G3WPT2_BCL2L2-01        actcca-------------------------gcctcag-c-----cccag
G1Q051_BCL2L2-01        ctccca-------------------------gcctcaggc-----cccag
A0A1U7RC37_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
D3Z5F7_BCL2L2-01        acccca-------------------------gcctcaa-c-----cccag
P70345_BCL2L2-04        acccca-------------------------gcctcaa-c-----cccag
G1TV33_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
G1P3J2_BCL2L2-01        acccca-------------------------gcctcgg-c-----cccag
A0A2K6GWN0_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A2R9A7B2_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
H2Q805_BCL2L2-02        acccca-------------------------gcctcag-c-----cccag
A0A2I2YPX6_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
G1RYB4_BCL2L2-01        acccca-------------------------gcctcgg-c-----cccag
F7G4L5_BCL2L2-05        acccca-------------------------gcctcgg-c-----cccag
F7G4L5_BCL2L2-04        acccca-------------------------gcctcgg-c-----cccag
A0A2I3MUE4_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5V0Q3_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6AI30_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5MZX9_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6EA73_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5HEK7_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6MEE6_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6RW46_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2R8M4C0_BCL2L2-      acccca-------------------------gcctccg-c-----cccag
A0A2K5CWZ4_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6TM77_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A287AW74_BCL2L2-      accccg-------------------------gcctcag-c-----cccag
F6PH48_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
Q45T69_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
G1LMC3_BCL2L2-01        acccca-------------------------gcttcag-c-----cccag
A0A2I2UAE3_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
M3Y5X5_BCL2L2-01        accccg-------------------------gcctcag-c-----cccag
W5QDH5_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
W5QDH5_BCL2L2-02        acccca-------------------------gcctcag-c-----cccag
Q05KI8_BCL2L2-01        acccca-------------------------gcctcgg-c-----cccag
Q1RMX3_BCL2L2-01        acccca-------------------------gcctcgg-c-----cccag
A0A1U7RC37_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A287AW74_BCL2L2-      accccg-------------------------gcctcag-c-----cccag
A0A286XQQ9_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
H0XR82_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
A0A2K6GWN0_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
I3ND50_BCL2L2-02        acccca-------------------------gcctcgg-c-----cccag
A0A1S3FYD8_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A2R9A7B2_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
H2Q805_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
G1RYB4_BCL2L2-03        acccca-------------------------gcctcgg-c-----cccag
A0A2I2YPX6_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
Q92843_BCL2L2-02        acccca-------------------------gcctcgg-c-----cccag
A0A2K5MZX9_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6EA73_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5V0Q3_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
F7G4L5_BCL2L2-02        acccca-------------------------gcctcgg-c-----cccag
F7G4L5_BCL2L2-03        acccca-------------------------gcctcgg-c-----cccag
A0A2K6AI30_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2I3MUE4_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6RW46_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6RW46_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K6MEE6_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A0D9RU30_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5HEK7_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2R8M4C0_BCL2L2-      acccca-------------------------gcctccg-c-----cccag
A0A2K6TM77_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A2K6TM77_BCL2L2-      acccca-------------------------gcctcag-c-----cccag
A0A2K5CWZ4_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
A0A2K5CWZ4_BCL2L2-      acccca-------------------------gcctcgg-c-----cccag
G3TMU7_BCL2L2-01        acccca-------------------------gcctcag-c-----cccag
O88996_BCL2L2-01        acccca-------------------------gcctcaa-c-----cccag
Q7TS60_BCL2L2-01        acccca-------------------------gcctcaa-c-----cccag
I3ND50_BCL2L2-01        acccca-------------------------gcctcgg-c-----cccag
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        acccca-------------------------gcctcaa-c-----cccag
W5N4F7_BCL2-01          ataacg-------------------------------a-agccccgtacg
A0A2U9CJ81_MCL1-01      attcct-------------------------tccacaa-agcgggccgcc
G3PJT0_MCL1-01          attcag-------------------------agaccga-aactggccgcg
W5MMB7_MCL1-01          acctcg-------------------------g----------------cc
F6YNL8_BCL2-01          accctg-------------------------gaa---g-aagaggatatg
G3WZW9_BCL2-02          accctg-------------------------gaa---g-aagaggatatg
G3WZW9_BCL2-01          accctg-------------------------gaa---g-aagaggatatg
K7F5Y4_BCL2-02          atcctg-------------------------gga---g-aagaggctatg
K7F5Y4_BCL2-01          atcctg-------------------------gga---g-aagaggctatg
K7F5Y4_BCL2-03          atcctg-------------------------gga---g-aagaggctatg
H0W1T3_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
F1LNV0_BCL2-01          aagccg-------------------------gga---g-aacagggtatg
P49950_BCL2-01          aagccg-------------------------gga---g-aacagggtatg
P10417_BCL2-01          aagccg-------------------------gga---g-aacagggtatg
Q7TSN8_BCL2-01          aagccg-------------------------gga---g-aacagggtatg
P10417_BCL2-02          aagccg-------------------------gga---g-aacagggtatg
Q6R755_BCL2-01          aagccg-------------------------gga---g-aacagggtatg
Q9JJV8_BCL2-01          aagctg-------------------------gga---g-aacagggtatg
Q923R6_BCL2-01          aagctg-------------------------gga---g-aacagggtatg
G3ULB7_BCL2-02          acgcag-------------------------gga---g-aacaggttatg
G3ULB7_BCL2-01          acgcag-------------------------gga---g-aacaggttatg
F6R2C4_BCL2-01          acgcgg-------------------------ggg---g-aacaggctacg
O02718_BCL2-01          acgcgg-------------------------ggg---g-aacaggctacg
A0A076FU27_BCL2-01      acgcgg-------------------------ggg---g-cacaggctacg
A0A076FZV9_BCL2-01      acgcgg-------------------------ggg---g-cacaggctacg
G1TW27_BCL2-01          acgccg-------------------------ggc---g-aacagggtacg
I3MVK9_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
M3YYK3_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
G1LID1_BCL2-01          accccg-----------------------------------cagcgt---
F7CDX6_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
A0A287APJ6_BCL2-03      acgctg-------------------------gga---g-aacagggtatg
G1LID1_BCL2-02          acgctg-------------------------gga---g-aacagggtatg
M3X1R9_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          acgctg-------------------------ggc---g-aacagggtacg
Q75SV7_BCL2-01          acgctg-------------------------ggc---g-aacagggtacg
H0WKI0_BCL2-01          acgctg-------------------------gga---g-aacagggtatg
A0A2K6G3I7_BCL2-01      acgccg-------------------------gga---g-aacagggtatg
A0A2K5EB04_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A1D5QRF2_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K6UEL3_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2R8MY14_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K6R2I6_BCL2-02      acgctg-------------------------gga---g-aacagggtacg
A0A2K5HK49_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K6KHG1_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K6R2I6_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K5XRD4_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K5NZS5_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A0D9S017_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K5UDI5_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A2K6CIX3_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A0A096MPU7_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
H2NWH5_BCL2-01          acgctg-------------------------gga---c-aacagggtacg
P10415_BCL2-04          acgctg-------------------------gga---g-aacagggtacg
G3QES9_BCL2-01          acgctg-------------------------gga---g-aacagggtacg
A0A2I3GZF9_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
A9QXG9_BCL2-01          acgctg-------------------------gga---g-aacggggtacg
P10415_BCL2-01          acgctg-------------------------gga---g-aacagggtacg
P10415_BCL2-02          acgctg-------------------------gga---g-aacagggtacg
H2QEM8_BCL2-01          acgctg-------------------------gga---g-aacagggtacg
A0A2R9APW6_BCL2-01      acgctg-------------------------gga---g-aacagggtacg
U3KEW4_BCL2-01          atccgg-------------------------gga---g-aagaggctacg
H0YUX3_BCL2-01          atccgg-------------------------gga---g-aagaggctacg
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          accccg-------------------------gga---g-aagaggctacg
Q00709_BCL2-02          accccg-------------------------gga---g-aagaggctacg
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        tttagttcaagatatttagtggcagactttat------------------
K7G130_BCL2A1-01        ----atggaaagttctgagttccgctatgttt------------------
Q9W6F2_BCL2A1-01        ----atggaaactgctgagttctattacgttt------------------
G1N8C5_BCL2A1-01        ----atggaaactgctgagttctattatgttt------------------
U3JTB2_BCL2A1-01        ----atggaaactgctgagttctattacgttt------------------
H0ZCL9_BCL2A1-01        ----atggaaactgctgagttctattacgttt------------------
X4ZGI8_BCL2-01          acaatcggaatattgtggagaaatacctcaat------------------
Q564A4_BCL2-01          acaatcggaatattgtggagaaatacctcaag------------------
F6SFL4_BCL2A1-01        ----atggatgattacgagttccattatgttc------------------
G3WSP8_BCL2A1-01        ----atggctgattgtgaattccattatgttc------------------
A0A337STN9_BCL2A1-      ----atggccgacggcgagtttgggtacgttc------------------
A0A337STN9_BCL2A1-      ----atggccgacggcgagtttgggtacgttc------------------
E2RS00_BCL2A1-01        ----atgacggactgcgagtttggctacacgc------------------
M3YVH4_BCL2A1-01        ----atgacagacagtgagttcgggtacacgc------------------
G1T1L8_BCL2A1-01        gaagatgagtgactgcgagtttggctatgtgc------------------
G3V977_BCL2A1-01        ----atgacagactgtgagttcatgtatatcc------------------
Q925A9_BCL2A1-01        ----atgacagactgtgagttcatgtatatcc------------------
O55178_BCL2A1-01        ----atggctgagtacgagctcatgcatatcc------------------
Q0P538_BCL2A1-01        ----atggctgagtacgagctcatgcatatcc------------------
Q07440_BCL2A1-01        ----atggctgagtctgagctcatgcatatcc------------------
O55179_BCL2A1-01        ----atgtctgagtacgagttcatgtatatcc------------------
Q8K164_BCL2A1-01        ----atggctgagtacgagttcatgtatatcc------------------
Q4FK02_BCL2A1-01        ----atgtctgagtacgagttcatgtatatcc------------------
O55177_BCL2A1-02        ----atggctgagtacgagttcatgtatatcc------------------
Q497M6_BCL2A1-01        ----atggctgagtacgagttcatgtatatcc------------------
A0A2K6EKG1_BCL2A1-      ----atgactgactgtgagtttggatacaccc------------------
I3MCZ7_BCL2A1-01        ----atgaatgactgtgagttcaggttcatcc------------------
Q3C2I0_BCL2A1-01        ----atgactgacactgagtttggctacgttc------------------
W5Q0N6_BCL2A1-01        ----atgactgacactgagtttgactacgttc------------------
G3T8E6_BCL2A1-01        ----atgactgactgtgagtttggatacattt------------------
F7CP56_BCL2A1-01        ----atgaccgactgtgagtttggatatattc------------------
C7F841_BCL2A1-02        ----atgactgacgacgagtttggatatattc------------------
C7F841_BCL2A1-01        ----atgactgacgacgagtttggatatattc------------------
H0WZ23_BCL2A1-01        ----atgactgactgtgagtttggatacattc------------------
U3DBA0_BCL2A1-02        ----atgacagactctgaatttggatatattc------------------
U3DBA0_BCL2A1-01        ----atgacagactctgaatttggatatattc------------------
A0A2K6TLM0_BCL2A1-      ----atgacagaccacgaatttggatatattc------------------
A0A2K6TLM0_BCL2A1-      ----atgacagaccacgaatttggatatattc------------------
A0A2K6TLM0_BCL2A1-      ----atgacagaccacgaatttggatatattc------------------
A0A2K5D2I1_BCL2A1-      ----atgacagactgtgaatttggatatattc------------------
A0A2K5D2I1_BCL2A1-      ----atgacagactgtgaatttggatatattc------------------
H2NNZ9_BCL2A1-01        ----atgacagactgtgaatttgggtatattt------------------
A0A2I3T6T8_BCL2A1-      ----gtggc-----gcgatcttggct------------------------
A0A2I3HNF3_BCL2A1-      ----atgacagactgcgaatttggatatattt------------------
A0A2I3HNF3_BCL2A1-      ----atgacagactgcgaatttggatatattt------------------
A0A2I3HNF3_BCL2A1-      ----atgacagactgcgaatttggatatattt------------------
A0A2K5KAB6_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6AD55_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A0D9RRC3_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6LV22_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6PHG5_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K5KHH9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A096NMX5_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6DS80_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K5KHH9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K5TMD8_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
F7E8V5_BCL2A1-01        ----atgacagactgtgaatttggatatattt------------------
A0A2K5KAB6_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6LV22_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6PHG5_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6AD55_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A096NMX5_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K5KHH9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K5TMD8_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2K6DS80_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
F7E8V5_BCL2A1-02        ----atgacagactgtgaatttggatatattt------------------
B4E1X9_BCL2A1-01        ----atgacagactgtgaatttggatatattt------------------
A0A2R8ZJX9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2I3T6T8_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2R8ZJX9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2I3T6T8_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
Q16548_BCL2A1-01        ----atgacagactgtgaatttggatatattt------------------
A0A2I2YML2_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2I2YML2_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2R8ZJX9_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2I3T6T8_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
A0A2I2YML2_BCL2A1-      ----atgacagactgtgaatttggatatattt------------------
Q16548_BCL2A1-02        ----atgacagactgtgaatttggatatattt------------------
A0A1U7QVA0_BCL2L10      acccgctgcgggtccgcact------------------------------
Q9Z0F3_BCL2L10-01       acccactgcatgaacgcact------------------------------
Q99M66_BCL2L10-01       acccgctgcaggatcgcact------------------------------
B6V6J0_MCL1-01          agaagacattgagcgcgcgtggggcttctccgtgggaccccgatatggac
F7ETY1_MCL1-01          agaaggcagtgaatgaccgaggggcttctccgtgggacgccgatatggag
J7H260_MCL1-01          ----atgggcggctctctgc------cctccc-------cgcagt-----
D2ITA0_MCL1-03          aactacggaaccagcttagt-ccagacctgctggtttaacagccc-----
D2ITA0_MCL1-04          aactacggaaccagcttagt-ccagacctgctggtttaacagccc-----
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      agcaacagagaactggtgga----gttctaca-------taagct-----
M4A558_BCL2L1-01        agcaacagagaactggtgga----gttctaca-------taagct-----
A0A0F7L1T6_BCL2L1-      aacaacagagagctggtgga----gcacttct-------taagat-----
H2U5I3_BCL2L1-01        aacaacagagagctggtgga----gcacttct-------taagat-----
H2U5I3_BCL2L1-02        aacaacagagagctggtgga----gcacttct-------taagat-----
G3P7B4_BCL2L1-01        attaacagggagctggtgga----gttcttcc-------taagct-----
E6ZFR0_BCL2L1-01        agtaacagagagctggtgga----gttcttta-------taagct-----
A0A0B4KJI5_BCL2L1-      agtaacagagagctagtgga----gtcctttt-------taagct-----
Q568V1_MCL1-01          agcttcctcgcgcagggcgt-tcaaactccga-------cgctga-----
Q1L8X3_MCL1-01          agcttcttcgcgcagggcgt-tcaaactccga-------cgctaa-----
Q9I9N3_MCL1-01          agcttcttcgcgcagggcgt-tcaaactccga-------cgctaa-----
A0A1X9JZA1_BCL2-01      tgtaatcgcaacattgtgga-a--aagtatat-------ctg-cc-----
Q6GLI5_BCL2L1-01        agcagtagagatctggtgga-g--aagtttgt-------ttg-ca-----
Q2TAP5_BCL2L1-01        agcagtagagatctggtgga-g--aagtttgt-------tag-ta-----
Q91828_BCL2L1-01        agcagtagagatctggtgga-g--aagtttgt-------tag-ta-----
H3AR18_MCL1-01          aattaccgggggacgggtgc-----------c-------cgc--------
H3AR18_MCL1-02          caacgccgacggctccgtgc-c--gccttcgc-------cgccca-----
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        ggcaaccgggagctggtgat-c--gactttgt-------ctc-ct-----
K7F655_BCL2L1-01        actaacagggaattagtgat-t--gacttcct-------ctc-ct-----
G1N5N5_BCL2L1-01        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
Q07816_BCL2L1-03        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
Q07816_BCL2L1-01        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
Q07816_BCL2L1-02        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
U3JSL7_BCL2L1-01        agtaatcgggagttagtgat-t--gactttgt-------ttc-tt-----
Q4U2V6_BCL2L1-01        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
H0Z8G3_BCL2L1-01        agtaaccgggagttagtgat-t--gactttgt-------ttc-ct-----
F6WA14_BCL2L1-01        agtaaccgggagctggtgat-t--gactttct-------ttc-tt-----
G3WKX6_BCL2L1-01        agtaaccgggagctggtggt-t--gactttct-------ttc-tt-----
W5PSA5_BCL2L1-01        agcaaccgggaactagtggt-t--gactttct-------ctc-tt-----
G3SPN0_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
H0X6V2_BCL2L1-01        agcaaccgggagctggtggt-t--gactttat-------ctc-ct-----
P53563_BCL2L1-04        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
P53563_BCL2L1-02        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
P53563_BCL2L1-03        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
P53563_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
O35843_BCL2L1-01        agcaaccgggagctggtggt-c--gactttct-------ctc-ct-----
Q64373_BCL2L1-09        agcaaccgggagctggtggt-c--gactttct-------ctc-ct-----
Q64373_BCL2L1-01        agcaaccgggagctggtggt-c--gactttct-------ctc-ct-----
Q64373_BCL2L1-03        agcaaccgggagctggtggt-c--gactttct-------ctc-ct-----
Q64373_BCL2L1-04        agcaaccgggagctggtggt-c--gactttct-------ctc-ct-----
B2Z3Z4_BCL2L1-01        agcaaccgggagctagtggt-t--gactttct-------ctc-ct-----
A0A1U7QU73_BCL2L1-      agcaaccgggagctagtggt-t--gactttct-------ctc-ct-----
Q9MYW4_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A1S3EPX7_BCL2L1-      agcaaccgtgagctggtggt-t--gactttct-------ctc-ct-----
O77737_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A286Y5D6_BCL2L1-      agcaactgggagctggtggt-t--gactttct-------ctc-ct-----
G1P9D2_BCL2L1-01        agcaaccgggaactggtggt-t--gactttct-------ctc-ct-----
Q05KJ0_BCL2L1-01        agtaaccgggagctggtggt-t--gactttct-------ctc-tt-----
Q9MZS7_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-tt-----
A0A1S2ZQT6_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A1L5BWY3_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A287CZ07_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
I3MUP5_BCL2L1-03        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
I3MUP5_BCL2L1-02        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
I3MUP5_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
F6WQI0_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
E2IV76_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
G1RER8_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2J8VIH3_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
Q07817_BCL2L1-03        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
Q07817_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
Q07817_BCL2L1-02        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K5H963_BCL2L1-      agcaaccgggagctagtggt-t--gactttct-------ctc-ct-----
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K5VPG2_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
F6UKR4_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A0D9RJZ8_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K6QFA2_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K6QFA2_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K5YR37_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K6UWY8_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
E2IV77_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
F7IT34_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
E2IV75_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
M3Z2H9_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
M3XA94_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
Q76LT7_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
Q8SQ42_BCL2L1-01        agcaaccgggagctggtggt-t--gactttct-------ctc-ct-----
H3AAS7_BCL2L2-01        ag------------------------------------------------
H3AAS7_BCL2L2-02        ag------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      gtgctataaacaaggagcgt-t--tataactc------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        agtaaccgagcgctcgtggt-g--gacttcct-------ttc-ct-----
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgccgaagccccccgcgctc-c--cattggct-------ccg-gg-----
A0A1L1RNM6_MCL1-02      cgccgaagccccccgcgctc-c--cattggct-------ccg-gg-----
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       gaaaatgaaatt--------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          aggagagcaaccaaaatggc-g--cccggcct-------ccc-tg-----
R4GAJ0_MCL1-01          aggagagcaaccaaaatggc-g--cccggcct-------ccc-tg-----
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      -------atcgctgggagga-a--aatgtc--------------------
M4AUW7_BCL2L10-01       -------------------------atgtc--------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          aggtgg-ccgatggggctgc-g--gacgtccc-------a----------
G3WBC5_MCL1-01          aggtgg-ccgatggagccgc-g--gacgccat-------c----------
H0XHA5_MCL1-01          agatgg-aagcccaagttgc-c--gatgccgt-------c----------
G1QAV8_MCL1-01          agctgg-gagctctggcagc-c--gacgccat-------c----------
G1PZ39_MCL1-01          agatggaaagccgcggccgc-c--gacgccat-------c----------
Q9Z1P3_MCL1-01          agatgg-ccgcgtcg---gc-c--gccgccat-------c----------
P97287_MCL1-02          agatgg-ccgcgtcggccgc-c--gccgccat-------c----------
P97287_MCL1-01          agatgg-ccgcgtcggccgc-c--gccgccat-------c----------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          agatgg-aagccccggctgc-g--gacgccat-------c----------
G1T2Q0_MCL1-01          agatgg-aagccccggctgc-g--gacgccat-------c----------
A0A287DCH9_MCL1-01      agatgg-aagcccccgccgc-c--gcc-----------------------
A0A287DCH9_MCL1-02      agatgg-aagcccccgccgc-c--gcc-----------------------
G3T756_MCL1-01          agatgg-aggctctagccgc-c--gacgccat-------c----------
W5QI41_MCL1-01          ----gg-aagctttcgctgc-c--ttccccat-------tta-cg-----
A5PJR2_MCL1-01          agatgg-aatccccgatctc-c--gacgccat-------c----------
F1MQX4_MCL1-01          agatgg-aatccctgatctc-c--gatgccat-------c----------
A0A1S3F3I1_MCL1-01      agatgg-aagccgcggccgc-c--ggcgccat-------c----------
J9PBC4_MCL1-01          agatgg-aaggcccggccgc-c--gacgccat-------c----------
J9PBC4_MCL1-02          agatgg-aaggcccggccgc-c--gacgccat-------c----------
Q8HYS5_MCL1-01          agatgg-aaggcccggccgc-c--gacgccat-------c----------
M3XAP4_MCL1-02          agatgg-aaggcccagccgc-c--gacgccat-------c----------
Q7YRZ9_MCL1-01          agatgg-aaggcccagccgc-c--gacgccat-------c----------
M3XAP4_MCL1-01          agatgg-aaggcccagccgc-c--gacgccat-------c----------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ggatgg-aagccccggccgc-c--gacgccat-------c----------
G1L3M8_MCL1-01          agatgg-aaggcccagccgc-c--gacgccat-------c----------
G1L3M8_MCL1-02          agatgg-aaggcccagccgc-c--gacgccat-------c----------
M3XZZ5_MCL1-01          agatgg-aaggcccagctgc-c--gacgccat-------c----------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          agatgg-aatccccggcctc-c--gacgccat-------c----------
K9IWB2_MCL1-01          agatgg-aatccccggcctc-c--gacgccat-------c----------
K9IWB2_MCL1-03          agatgg-aatccccggcctc-c--gacgccat-------c----------
A0A2K5C7L5_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          agatgg-aagcccctgccgc-c--gacgccat-------c----------
A0A2K6GI15_MCL1-01      agatgg-aagcccctgccgc-c--gacgccat-------c----------
A0A2K6GI15_MCL1-02      agatgg-aagcccctgccgc-c--gacgccat-------c----------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5I9Q7_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5I9Q7_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6PPL1_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6KRW9_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6PPL1_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2I3GB35_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5XSC7_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5W0W9_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6ECR0_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2I3M3D6_MCL1-01      agatgg-aagccccggctgc-c--gacgccat-------c----------
A0A2K5LXU8_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
I7G687_MCL1-01          agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5W0W9_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      agatgg-aagccccggctgc-c--gacgccat-------c----------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2R9BYH6_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
K7DE58_MCL1-02          agatgg-aagccccggccgc-c--gacgccat-------c----------
Q07820_MCL1-03          agatgg-aagccccggccgc-t--gacgccat-------c----------
K7DE58_MCL1-01          agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2R9BYH6_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --atgg-aagccccggccgc-t--gacgccat-------c----------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --atgg-aagccccggccgc-t--gacgccat-------c----------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          agatgg-aagccccggccgc-t--gacgccat-------c----------
B4DG83_MCL1-01          --atgg-aagccccggccgc-t--gacgccat-------c----------
A0A2K6V5Y3_MCL1-02      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5CFH3_MCL1-03      agatgg-aagccccggccgc-c--gacgccat-------c----------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      agatgg-aagccccggccgc-c--gacgccat-------c----------
F7GTF7_MCL1-01          agatgg-aagccccggccgc-c--gacgccat-------c----------
F7GTF7_MCL1-02          agatgg-aagccccggccgc-c--gacgccat-------c----------
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        ggatcccgggcttt---ggt-agaggattttg-------tgcgat-----
Q5XGJ4_BCL2L2-01        ggatcccgggcttt---ggt-agaggattttg-------tgcgat-----
B9ZYL7_BCL2-01          atcaccggga-cat---agt-ggtaaaatata-------tccatt-----
F7BXJ7_BCL2-01          atcaccggga-cat---agt-ggtaaaatata-------tccatt-----
Q90Z98_BCL2L1-01        tataaccgagaact---ggt-ggtatttttta-------tcaaat-----
Q90Z98_BCL2L1-02        tataaccgagaact---ggt-ggtatttttta-------tcaaat-----
H2SNZ8_BCL2L1-02        --aaacagagaact---ggt-cattttctata-------ttaagt-----
H2SNZ8_BCL2L1-01        --aaacagagaact---ggt-cattttctata-------ttaagt-----
H3CH49_BCL2L1-01        --aaacagagaact---ggt-cattttctaca-------ttaaat-----
A0A059PJI5_BCL2L1-      tacaacagagaact---tgt-cgtgtacttca-------tcaagt-----
B5XAY3_BCL2L1-01        aacaacagagaact---ggt-ggtgtactata-------ttacct-----
W5MG74_BCL2L1-01        agcaacagagacct---cgt-cgtctactaca-------tcaact-----
A0A087X9B7_BCL2L1-      --aaacagagaact---ggt-gcttttctaca-------ttaagt-----
A0A2U9BY16_BCL2L1-      --gaacaaagaact---ggt-ggttttctaca-------tacagt-----
A0A0D6DR75_BCL2L1-      --aaacagagaact---ggt-ggtttactaca-------taacat-----
I3IZK7_BCL2L1-01        --aaacagagaact---ggt-gcttttctaca-------taaggt-----
A0A219P0Y3_BCL2L1-      --aaacagagaact---ggt-ggtttgctaca-------taaaat-----
G3NJY1_BCL2L1-01        --aaacagagaact---ggt-ggttttctaca-------taaact-----
C3VIT1_BCL2L1-01        --aaacagagaact---ggt-ggttttctaca-------taaagt-----
H2MLZ3_MCL1-01          gctacatcacgtctaactgtggatttacggga-------cacatc-----
H2MLZ3_MCL1-02          gctacatcacgtctaactgtggatttacggga-------cacatc-----
Q0KFR9_MCL1-01          actacgatgttgcattttcaaaatggaggatc-------ttcgta-----
F1RZB9_BCL2L10-01       acagcccggcttct-------gaccgactacc------------------
H0WZ06_BCL2L10-01       accgagcggctgct-------gactgactacc------------------
G1T264_BCL2L10-01       actgcgcgcctgct-------caccgactacc------------------
A0A2K6F2Q2_BCL2L10      accgagcggctgct-------ggccgactacc------------------
A0A2K6TIT7_BCL2L10      accgagcagctggt-------ggcggactacc------------------
A0A2K5F974_BCL2L10      accgagcggctggt-------ggcggactacc------------------
F7CT87_BCL2L10-01       accgagcagctggt-------gacggactacc------------------
A0A0D9RG38_BCL2L10      accgagcggctcct-------ggccgactatc------------------
A0A2K5TKG9_BCL2L10      accgagcggctcct-------ggccgactatc------------------
F7H6U5_BCL2L10-01       accgagcggctcct-------ggccgactatc------------------
A0A2K6B2D9_BCL2L10      accgagcggctcct-------ggccgactatc------------------
A0A2K5MMZ4_BCL2L10      accgagcggctcct-------ggccgactatc------------------
A0A096NM44_BCL2L10      accgagcggctcct-------ggccgactatc------------------
A0A2K5K3B0_BCL2L10      accgagcggctgct-------ggccgactatc------------------
A0A2K6M5H5_BCL2L10      accgagcggttgct-------ggccgactatc------------------
A0A2K6R5T5_BCL2L10      accgagcggttgct-------ggccgactatc------------------
G1R3W6_BCL2L10-01       accgagcggctgct-------ggccgactacc------------------
H2NN92_BCL2L10-01       accgagcggctgct-------ggccgactacc------------------
Q9HD36_BCL2L10-01       accgagctgttgct-------ggccgactacc------------------
Q9HD36_BCL2L10-02       accgagctgttgct-------ggccgactacc------------------
G3QLU6_BCL2L10-01       accgagcggttgct-------ggccgactacc------------------
A0A2R9BCD9_BCL2L10      accgagcggttgct-------ggccgactacc------------------
H2Q9G4_BCL2L10-01       accgagcggttgct-------ggccgactacc------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      acggcgcagctact-------gactgactacc------------------
G1LKR4_BCL2L10-01       acggcgcggctgct-------gaccgactacc------------------
M3Y8D1_BCL2L10-01       acggcgcagctgct-------gaccgactacc------------------
A0A087X830_MCL1-01      acaaccgcat-------------taaactatctaattttttctca-----
I3JHR5_MCL1-01          aggaaccagtgtaccttcatagactatcttct-------tcctca-----
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      acagtcgctt-tat---tgt-cgaaaaataca-------tccata-----
H9GPE7_BCL2-01          acaacaggga-aat---cgt-gctgaggtaca-------tccatt-----
Q4SW32_MCL1-01          ggacgcggatctttcttcct-cgcagatcccg------------------
F7G6M3_BCL2L2-01        acacccgggc-cct---ggt-ggcggactttg-------tgggct-----
F6U940_BCL2L2-01        atactcgagc-cct---ggt-ggcagattttg-------tgggtt-----
G3WPT2_BCL2L2-02        atactcgagc-cct---ggt-ggcagattttg-------tgggtt-----
G3WPT2_BCL2L2-01        atactcgagc-cct---ggt-ggcagattttg-------tgggtt-----
G1Q051_BCL2L2-01        acacacaggc-tct---ggt-ggcagactttg-------taggct-----
A0A1U7RC37_BCL2L2-      acacacgggc-tct---agt-ggctgactttg-------taggct-----
D3Z5F7_BCL2L2-01        acacacgggc-tct---agt-ggctgactttg-------taggct-----
P70345_BCL2L2-04        acacacgggc-tct---agt-ggctgactttg-------taggct-----
G1TV33_BCL2L2-01        acacacgggc-tct---ggt-ggccgactttg-------taggct-----
G1P3J2_BCL2L2-01        acacacgggc-tct---ggt-ggcagactttg-------taggct-----
A0A2K6GWN0_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggct-----
A0A2R9A7B2_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
H2Q805_BCL2L2-02        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2I2YPX6_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
G1RYB4_BCL2L2-01        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
F7G4L5_BCL2L2-05        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
F7G4L5_BCL2L2-04        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2I3MUE4_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5V0Q3_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6AI30_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5MZX9_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6EA73_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5HEK7_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6MEE6_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6RW46_BCL2L2-      acacacgggc-tct---ggt-ggcagactttt-------taggtt-----
A0A2R8M4C0_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5CWZ4_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6TM77_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A287AW74_BCL2L2-      acacacgggc-tct---agt-ggcagactttg-------tgggct-----
F6PH48_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------taggct-----
Q45T69_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------taggct-----
G1LMC3_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------taggct-----
A0A2I2UAE3_BCL2L2-      acacacgggc-tct---agt-ggcagactttg-------taggct-----
M3Y5X5_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------taggct-----
W5QDH5_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------tgggct-----
W5QDH5_BCL2L2-02        acacacgggc-tct---agt-ggcagactttg-------tgggct-----
Q05KI8_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------tgggct-----
Q1RMX3_BCL2L2-01        acacacgggc-tct---agt-ggcagactttg-------tgggct-----
A0A1U7RC37_BCL2L2-      acacacgggc-tct---agt-ggctgactttg-------taggct-----
A0A287AW74_BCL2L2-      acacacgggc-tct---agt-ggcagactttg-------tgggct-----
A0A286XQQ9_BCL2L2-      acacacgggc-tct---ggt-ggctgactttg-------taggct-----
H0XR82_BCL2L2-01        acacacgggc-tct---ggt-ggcagactttg-------taggct-----
A0A2K6GWN0_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggct-----
I3ND50_BCL2L2-02        acacacgggc-tct---ggt-ggccgactttg-------taggct-----
A0A1S3FYD8_BCL2L2-      acacacgggc-tct---ggt-ggctgactttg-------taggct-----
A0A2R9A7B2_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
H2Q805_BCL2L2-01        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
G1RYB4_BCL2L2-03        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2I2YPX6_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
Q92843_BCL2L2-02        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5MZX9_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6EA73_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5V0Q3_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
F7G4L5_BCL2L2-02        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
F7G4L5_BCL2L2-03        acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6AI30_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2I3MUE4_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6RW46_BCL2L2-      acacacgggc-tct---ggt-ggcagactttt-------taggtt-----
A0A2K6RW46_BCL2L2-      acacacgggc-tct---ggt-ggcagactttt-------taggtt-----
A0A2K6MEE6_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A0D9RU30_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5HEK7_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2R8M4C0_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6TM77_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K6TM77_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5CWZ4_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
A0A2K5CWZ4_BCL2L2-      acacacgggc-tct---ggt-ggcagactttg-------taggtt-----
G3TMU7_BCL2L2-01        acacacgggc-tct---ggt-ggcagactttg-------tgggct-----
O88996_BCL2L2-01        acacacgggc-tct---agt-ggctgactttg-------taggct-----
Q7TS60_BCL2L2-01        acacacgggc-tct---agt-ggctgactttg-------taggct-----
I3ND50_BCL2L2-01        acacacgggc-tct---ggt-ggccgactttg-------taggct-----
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        acacacgggc-tct---agt-ggctgactttg-------taggct-----
W5N4F7_BCL2-01          atactcggaa-tat---cgt-gacaaaataca-------tccatc-----
A0A2U9CJ81_MCL1-01      ttcaacgttacgaccggagt-catgggctgcctcattcttcctca-----
G3PJT0_MCL1-01          ttaaacatgaccgg---agt-catgagctgca-------t----t-----
W5MMB7_MCL1-01          agcgccgtga-tac---agc-tctattgcccc-------aacgcc-----
F6YNL8_BCL2-01          ataaccggga-gat---agt-gatgaaataca-------ttcatt-----
G3WZW9_BCL2-02          ataaccggga-aat---agt-gatgaaataca-------ttcatt-----
G3WZW9_BCL2-01          ataaccggga-aat---agt-gatgaaataca-------ttcatt-----
K7F5Y4_BCL2-02          ataaccggga-gat---agt-gttgaagtaca-------tccatt-----
K7F5Y4_BCL2-01          ataaccggga-gat---agt-gttgaagtaca-------tccatt-----
K7F5Y4_BCL2-03          ataaccggga-gat---agt-gttgaagtaca-------tccatt-----
H0W1T3_BCL2-01          ataaccggga-aat---agt-gatgaagtaca-------tccact-----
F1LNV0_BCL2-01          ataaccggga-gat---cgt-gatgaagtaca-------tccatt-----
P49950_BCL2-01          ataaccggga-gat---cgt-gatgaagtaca-------tccatt-----
P10417_BCL2-01          ataaccggga-gat---cgt-gatgaagtaca-------tacatt-----
Q7TSN8_BCL2-01          ataaccggga-gat---cgt-gatgaagtaca-------tacatt-----
P10417_BCL2-02          ataaccggga-gat---cgt-gatgaagtaca-------tacatt-----
Q6R755_BCL2-01          ataaccggga-gat---cgt-gatgaagtaca-------tacatt-----
Q9JJV8_BCL2-01          ataaccgaga-gat---cgt-gatgaagtaca-------tccatt-----
Q923R6_BCL2-01          ataaccgaga-gat---cgt-gatgaagtaca-------tccatt-----
G3ULB7_BCL2-02          acaaccggga-gat---agt-gatgaagtata-------tccact-----
G3ULB7_BCL2-01          acaaccggga-gat---agt-gatgaagtata-------tccact-----
F6R2C4_BCL2-01          ataaccgaga-gat---cgt-gatgaagtaca-------tccact-----
O02718_BCL2-01          ataaccgaga-gat---cgt-gatgaagtaca-------tccact-----
A0A076FU27_BCL2-01      ataaccgcga-gat---cgt-gatgaagtaca-------tccact-----
A0A076FZV9_BCL2-01      ataaccgcga-gat---cgt-gatgaagtaca-------tccact-----
G1TW27_BCL2-01          acaaccggga-gat---cgt-gatgaagtaca-------tccact-----
I3MVK9_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
M3YYK3_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
G1LID1_BCL2-01          -----------------------------------------cccc-----
F7CDX6_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A287APJ6_BCL2-03      ataaccggga-aat---agt-gatgaagtaca-------tccact-----
G1LID1_BCL2-02          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
M3X1R9_BCL2-01          ataaccggga-gat---agt-catgaagtaca-------tccact-----
J9NXG3_BCL2-01          ----------------------atgaagtaca-------tccact-----
J9NXG3_BCL2-02          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
Q75SV7_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
H0WKI0_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6G3I7_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
A0A2K5EB04_BCL2-01      ataaccgaga-gat---agt-gatgaagtaca-------tccact-----
A0A1D5QRF2_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6UEL3_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2R8MY14_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6R2I6_BCL2-02      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K5HK49_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6KHG1_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6R2I6_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K5XRD4_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K5NZS5_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A0D9S017_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K5UDI5_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A2K6CIX3_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
A0A096MPU7_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccact-----
H2NWH5_BCL2-01          ataaccggga-gat---agtcgatgaaa-nca-------tccatt-----
P10415_BCL2-04          ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
G3QES9_BCL2-01          ataaccgaga-gat---agt-gatgaagtaca-------tccatt-----
A0A2I3GZF9_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
A9QXG9_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
P10415_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
P10415_BCL2-02          ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
H2QEM8_BCL2-01          ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
A0A2R9APW6_BCL2-01      ataaccggga-gat---agt-gatgaagtaca-------tccatt-----
U3KEW4_BCL2-01          ataaccggga-gat---agt-gctgaagtaca-------tccact-----
H0YUX3_BCL2-01          ataaccggga-gat---agt-gctgaagtaca-------tccact-----
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          acaaccgcga-gat---agt-gctgaagtaca-------tccact-----
Q00709_BCL2-02          acaaccgcga-gat---agt-gctgaagtaca-------tccact-----
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        ------------------taatgaccgacttcgaaaacatggaatgcgat
K7G130_BCL2A1-01        -------------------actatttagtccagg-----------attat
Q9W6F2_BCL2A1-01        -------------------attatttagctcaag-----------attat
G1N8C5_BCL2A1-01        -------------------attatttagctcaag-----------attat
U3JTB2_BCL2A1-01        -------------------attacttagcccagg-----------attat
H0ZCL9_BCL2A1-01        -------------------attacttagcccagg-----------attat
X4ZGI8_BCL2-01          ------------------cacaaactttcaaagaagg--------gatat
Q564A4_BCL2-01          ------------------cataaactttcaaagcgag--------gatat
F6SFL4_BCL2A1-01        -------------------acatgttagctcggg-----------actac
G3WSP8_BCL2A1-01        -------------------acatgctagcccagg-----------actac
A0A337STN9_BCL2A1-      -------------------tcacgctggcccggg-----------actat
A0A337STN9_BCL2A1-      -------------------tcacgctggcccggg-----------actat
E2RS00_BCL2A1-01        -------------------tggcgctggcccagg-----------actac
M3YVH4_BCL2A1-01        -------------------tgtcgctggcccagg-----------actac
G1T1L8_BCL2A1-01        -------------------acacactggctcagg-----------actat
G3V977_BCL2A1-01        -------------------actccctggctgaga-----------actat
Q925A9_BCL2A1-01        -------------------actccctggctgaga-----------actat
O55178_BCL2A1-01        -------------------actccctggctgagc-----------actac
Q0P538_BCL2A1-01        -------------------actccctggctgagc-----------actac
Q07440_BCL2A1-01        -------------------actccctggctgagc-----------actac
O55179_BCL2A1-01        -------------------actccctggctgagc-----------actac
Q8K164_BCL2A1-01        -------------------actccctggctgagc-----------actat
Q4FK02_BCL2A1-01        -------------------actccctggctgagc-----------actat
O55177_BCL2A1-02        -------------------actccctggctgagc-----------actat
Q497M6_BCL2A1-01        -------------------actccctggctgagc-----------actat
A0A2K6EKG1_BCL2A1-      -------------------acaggctggtccagg-----------actac
I3MCZ7_BCL2A1-01        -------------------acacgctggctcagg-----------actac
Q3C2I0_BCL2A1-01        -------------------acgggctggctgagg-----------actat
W5Q0N6_BCL2A1-01        -------------------acaagctggctgagg-----------actat
G3T8E6_BCL2A1-01        -------------------acaagctggtccagg-----------actat
F7CP56_BCL2A1-01        -------------------acatgctggcccagg-----------actac
C7F841_BCL2A1-02        -------------------acatgctggcccagg-----------actat
C7F841_BCL2A1-01        -------------------acatgctggcccagg-----------actat
H0WZ23_BCL2A1-01        -------------------acaggctggctcagg-----------actat
U3DBA0_BCL2A1-02        -------------------acaatctaactcagg-----------actat
U3DBA0_BCL2A1-01        -------------------acaatctaactcagg-----------actat
A0A2K6TLM0_BCL2A1-      -------------------acaatctaactcagg-----------actat
A0A2K6TLM0_BCL2A1-      -------------------acaatctaactcagg-----------actat
A0A2K6TLM0_BCL2A1-      -------------------acaatctaactcagg-----------actat
A0A2K5D2I1_BCL2A1-      -------------------acaatctaactcagg-----------actat
A0A2K5D2I1_BCL2A1-      -------------------acaatctaactcagg-----------actat
H2NNZ9_BCL2A1-01        -------------------acaggctagctcagg-----------actat
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2I3HNF3_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2I3HNF3_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5KAB6_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6AD55_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A0D9RRC3_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6LV22_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6PHG5_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5KHH9_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A096NMX5_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6DS80_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5KHH9_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5TMD8_BCL2A1-      -------------------acaggctagctcagg-----------actat
F7E8V5_BCL2A1-01        -------------------acaggctagctcagg-----------actat
A0A2K5KAB6_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6LV22_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6PHG5_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6AD55_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A096NMX5_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5KHH9_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K5TMD8_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2K6DS80_BCL2A1-      -------------------acaggctagctcagg-----------actat
F7E8V5_BCL2A1-02        -------------------acaggctagctcagg-----------actat
B4E1X9_BCL2A1-01        -------------------acaggctggctcagg-----------actat
A0A2R8ZJX9_BCL2A1-      -------------------acaggctggctcagg-----------actat
A0A2I3T6T8_BCL2A1-      -------------------acaggctggctcagg-----------actat
A0A2R8ZJX9_BCL2A1-      -------------------acaggctggctcagg-----------actat
A0A2I3T6T8_BCL2A1-      -------------------acaggctggctcagg-----------actat
Q16548_BCL2A1-01        -------------------acaggctggctcagg-----------actat
A0A2I2YML2_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2I2YML2_BCL2A1-      -------------------acaggctagctcagg-----------actat
A0A2R8ZJX9_BCL2A1-      -------------------acaggctggctcagg-----------actat
A0A2I3T6T8_BCL2A1-      -------------------acaggctggctcagg-----------actat
A0A2I2YML2_BCL2A1-      -------------------acaggctagctcagg-----------actat
Q16548_BCL2A1-02        -------------------acaggctggctcagg-----------actat
A0A1U7QVA0_BCL2L10      ---------------------agactgctgctaactg--------actac
Q9Z0F3_BCL2L10-01       ---------------------agacggctgctgtctg--------actac
Q99M66_BCL2L10-01       ---------------------agacggctgctgactg--------actac
B6V6J0_MCL1-01          acgc---------------acaggccgcagctgaatg--------gcttg
F7ETY1_MCL1-01          gcgcatagggataagctggacaggccgcagctgaatg--------gcttc
J7H260_MCL1-01          -------------------ccgagctggacgaggacg-------------
D2ITA0_MCL1-03          -------------------tcaaaatggaggcgaaga-------------
D2ITA0_MCL1-04          -------------------tcaaaatggaggcgaaga-------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      -------------------acaaattgtctcagagaa--------actat
M4A558_BCL2L1-01        -------------------acaaattgtctcagagaa--------actat
A0A0F7L1T6_BCL2L1-      -------------------acaagctgtctcagagga--------actac
H2U5I3_BCL2L1-01        -------------------acaagctgtctcagagga--------actac
H2U5I3_BCL2L1-02        -------------------acaagctgtctcagagga--------actac
G3P7B4_BCL2L1-01        -------------------acaagctgtctcagaaga--------accac
E6ZFR0_BCL2L1-01        -------------------ataaactgtctcagagga--------accac
A0A0B4KJI5_BCL2L1-      -------------------acaaactgtctcagagga--------actat
Q568V1_MCL1-01          -------------------agacgtgcgtcgaagacg--------aactg
Q1L8X3_MCL1-01          -------------------agacgtgcgtcgaagacg--------aactg
Q9I9N3_MCL1-01          -------------------agacgtgcgtcgaagacg--------aactg
A0A1X9JZA1_BCL2-01      -------------------ataaactctccaaacagg--------gctac
Q6GLI5_BCL2L1-01        -------------------agaaactgtcccagaaag--------gagcc
Q2TAP5_BCL2L1-01        -------------------agaaactttcccagaatg--------aagcc
Q91828_BCL2L1-01        -------------------agaaactttcccagaatg--------aagcc
H3AR18_MCL1-01          ------------------------------------------------ag
H3AR18_MCL1-02          -------------------ccccgtcgacccccgagg--------acggg
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        -------------------acaagctgtcgcagaaag--------gctac
K7F655_BCL2L1-01        -------------------acaagctatcgcagaggg--------gacac
G1N5N5_BCL2L1-01        -------------------acaagctctcgcagaagg--------ggcac
Q07816_BCL2L1-03        -------------------acaagctctcacagaggg--------ggcac
Q07816_BCL2L1-01        -------------------acaagctctcacagaggg--------ggcac
Q07816_BCL2L1-02        -------------------acaagctctcacagaggg--------ggcac
U3JSL7_BCL2L1-01        -------------------acaagctctcacagaaag--------gctac
Q4U2V6_BCL2L1-01        -------------------acaagctctcacagaaag--------gatac
H0Z8G3_BCL2L1-01        -------------------acaagctctcacagaaag--------gatac
F6WA14_BCL2L1-01        -------------------acaagctctcacagaaag--------gatac
G3WKX6_BCL2L1-01        -------------------acaagctttcacagaagg--------gatac
W5PSA5_BCL2L1-01        -------------------acaagttttttcagaaag--------gatac
G3SPN0_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
H0X6V2_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
P53563_BCL2L1-04        -------------------acaagctctcccagaaag--------gatac
P53563_BCL2L1-02        -------------------acaagctctcccagaaag--------gatac
P53563_BCL2L1-03        -------------------acaagctctcccagaaag--------gatac
P53563_BCL2L1-01        -------------------acaagctctcccagaaag--------gatac
O35843_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q64373_BCL2L1-09        -------------------acaagctttcccagaaag--------gatac
Q64373_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q64373_BCL2L1-03        -------------------acaagctttcccagaaag--------gatac
Q64373_BCL2L1-04        -------------------acaagctttcccagaaag--------gatac
B2Z3Z4_BCL2L1-01        -------------------acaagttctcccagaaag--------gatac
A0A1U7QU73_BCL2L1-      -------------------acaagctctcccagaaag--------gatac
Q9MYW4_BCL2L1-01        -------------------acaagctttcgcagaaag--------gatac
A0A1S3EPX7_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
O77737_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A286Y5D6_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
G1P9D2_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q05KJ0_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q9MZS7_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A1S2ZQT6_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A1L5BWY3_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A287CZ07_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
I3MUP5_BCL2L1-03        -------------------acaagctttcccagaaag--------gatac
I3MUP5_BCL2L1-02        -------------------acaagctttcccagaaag--------gatac
I3MUP5_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
F6WQI0_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
E2IV76_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
G1RER8_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A2J8VIH3_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
Q07817_BCL2L1-03        -------------------acaagctttcccagaaag--------gatac
Q07817_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q07817_BCL2L1-02        -------------------acaagctttcccagaaag--------gatac
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        -------------------ataagctttcccagaaag--------gatac
A0A2K5H963_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K5VPG2_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
F6UKR4_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A0D9RJZ8_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K6QFA2_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K6QFA2_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K5YR37_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
A0A2K6UWY8_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
E2IV77_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        -------------------acaagctttcccagaaag--------gatac
F7IT34_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -------------------acaagctttcccagaaag--------gatac
E2IV75_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
M3Z2H9_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
M3XA94_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q76LT7_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
Q8SQ42_BCL2L1-01        -------------------acaagctttcccagaaag--------gatac
H3AAS7_BCL2L2-01        ----------------------------tggtggagg--------acttc
H3AAS7_BCL2L2-02        ----------------------------tggtggagg--------acttc
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        ---------------------aggttgctggtggtgg--------accat
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        ---------------------cagtaaccgtgagctg--------gtggt
A0A287APJ6_BCL2-01      ---------------------tggttgcacgaaatga--------ggaca
A0A286MU87_BCL2L1-      ---------------------cagtaacagggaactg--------gtggt
C0HAD8_BCL2L1-01        ---------------------cagtaacagggaactg--------gtggt
G1QEX2_BCL2L10-01       ---------------------------------gacg--------agttg
W5QIG4_BCL2L10-01       ---------------------cggctgctgatggact--------ggctg
E1B9B3_BCL2L10-01       ---------------------cggctgctgatggact--------acctg
F1MV39_BCL2L10-01       ---------------------cggctgctgatggact--------acctg
H9GHK7_BCL2L1-01        -------------------acaagctgtcgcagcggg--------gccac
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      -------------------gcggccccccacgctccg--------atcgg
A0A1L1RNM6_MCL1-02      -------------------gcggccccccacgctccg--------atcgg
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       ---------------------ctgtgggctgtggaaa-------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          ---------------------ccgctgcctgaagggg--------agctc
R4GAJ0_MCL1-01          ---------------------ccgctgcctgaagggg--------agctc
H2MBQ3_BCL2L10-01       ---------------------ttgtgggctgaggaaa--------ga---
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      ---------------------ctgtgggctgtggaaa-------------
M4AUW7_BCL2L10-01       ---------------------ctgtgggctgtggaaa-------------
D2IT42_BCL2L10-02       ---------------------gtgtaggctgtggaaa--------ga---
F6ZMX1_MCL1-01          ---------------------atgtgccctgaggagg--------aactg
G3WBC5_MCL1-01          ---------------------ctatcccccgaggacg--------agctg
H0XHA5_MCL1-01          ---------------------aagtcgcccgaaggtg--------aggtg
G1QAV8_MCL1-01          ---------------------atgtcgcccggagagg--------agctg
G1PZ39_MCL1-01          ---------------------atgtcgccggaagagg--------agctg
Q9Z1P3_MCL1-01          ---------------------atgtctcccgaggagg--------agctg
P97287_MCL1-02          ---------------------gtgtctccggaggagg--------aactg
P97287_MCL1-01          ---------------------gtgtctccggaggagg--------aactg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ---------------------atgtcgcctgaggagg--------agctg
G1T2Q0_MCL1-02          ---------------------atgtcgcccgaagagg--------agctg
G1T2Q0_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A287DCH9_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A287DCH9_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
G3T756_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
W5QI41_MCL1-01          -------------------ggatgcagataaagaggc--------agcag
A5PJR2_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
F1MQX4_MCL1-01          ---------------------atgtcgcccgaagagg--------agccg
A0A1S3F3I1_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
J9PBC4_MCL1-01          ---------------------atgtcgcccgaagagg--------agcta
J9PBC4_MCL1-02          ---------------------atgtcgcccgaagagg--------agcta
Q8HYS5_MCL1-01          ---------------------atgtcgcccgaagagg--------agcta
M3XAP4_MCL1-02          ---------------------atgtcgcccgaagagg--------agcta
Q7YRZ9_MCL1-01          ---------------------atgtcgcccgaagagg--------agcta
M3XAP4_MCL1-01          ---------------------atgtcgcccgaagagg--------agcta
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ---------------------atgtcgcccgaggagg--------agctg
G1L3M8_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
G1L3M8_MCL1-02          ---------------------atgtcgcccgaagagg--------agctg
M3XZZ5_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ---------------------atgtctcccgaagagg--------agctg
K9IWB2_MCL1-01          ---------------------atgtctcccgaagagg--------agctg
K9IWB2_MCL1-03          ---------------------atgtctcccgaagagg--------agctg
A0A2K5C7L5_MCL1-01      ---------------------atgtcgcccgaagaag--------agctg
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ---------------------atgtcgccggaagatg--------agctg
A0A2K6GI15_MCL1-01      ---------------------atgtcgcccgaagatg--------agctg
A0A2K6GI15_MCL1-02      ---------------------atgtcgcccgaagatg--------agctg
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A2K5I9Q7_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5I9Q7_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K6PPL1_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K6KRW9_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K6PPL1_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2I3GB35_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5XSC7_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5W0W9_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K6ECR0_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2I3M3D6_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5LXU8_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
I7G687_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A2K5W0W9_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2R9BYH6_MCL1-02      ---------------------atgtcgcccgaagagg--------agctg
K7DE58_MCL1-02          ---------------------atgtcgcccgaagagg--------agctg
Q07820_MCL1-03          ---------------------atgtcgcccgaagagg--------agctg
K7DE58_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A2R9BYH6_MCL1-01      ---------------------atgtcgcccgaagagg--------agctg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
B4DLY8_MCL1-01          -----------------------gtcgcgcg-------------------
Q07820_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
B4DG83_MCL1-01          ---------------------atgtcgcccgaagagg--------agctg
A0A2K6V5Y3_MCL1-02      ---------------------atgtcgcccgaagacg--------agctg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ---------------------atgtcgcccgaagacg--------agctg
A0A2K5CFH3_MCL1-03      ---------------------atgtcgcctgaagaag--------agctg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ---------------------atgtcgcctgaagaag--------agctg
F7GTF7_MCL1-01          ---------------------atgtcgccggaagaag--------agctg
F7GTF7_MCL1-02          ---------------------atgtcgccggaagaag--------agctg
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        -------------------acaagttatgccagcgta--------gtcta
Q5XGJ4_BCL2L2-01        -------------------acaagttatgccagcgta--------gtcta
B9ZYL7_BCL2-01          -------------------ataaactatctcagaagg--------ggtat
F7BXJ7_BCL2-01          -------------------ataaactgtctcaaaagg--------ggtat
Q90Z98_BCL2L1-01        -------------------ataaactctcgcagagga--------actac
Q90Z98_BCL2L1-02        -------------------ataaactctcgcagagga--------actac
H2SNZ8_BCL2L1-02        -------------------acaaactctcccaaagaa--------attac
H2SNZ8_BCL2L1-01        -------------------acaaactctcccaaagaa--------attac
H3CH49_BCL2L1-01        -------------------acaaactttcccaaagaa--------actac
A0A059PJI5_BCL2L1-      -------------------acaagctctcccagaaaa--------actac
B5XAY3_BCL2L1-01        -------------------ataaactatcacagaggg--------actac
W5MG74_BCL2L1-01        -------------------ataaactctcgcagaaga--------actac
A0A087X9B7_BCL2L1-      -------------------ttaaactgtctcagagga--------actat
A0A2U9BY16_BCL2L1-      -------------------ataaactctcccagagga--------aatat
A0A0D6DR75_BCL2L1-      -------------------ataaactgtcggagaaaa--------actat
I3IZK7_BCL2L1-01        -------------------ataaactctcccagagaa--------actat
A0A219P0Y3_BCL2L1-      -------------------ataaactaacccagagaa--------actat
G3NJY1_BCL2L1-01        -------------------ataaactctcccagagga--------actta
C3VIT1_BCL2L1-01        -------------------ataaactctcccagagaa--------actat
H2MLZ3_MCL1-01          -------------------ctcggcagcagagcggga--------gagat
H2MLZ3_MCL1-02          -------------------ctcggcagcagagcggga--------gagat
Q0KFR9_MCL1-01          -------------------cctagctgatgatgctaggccgttgtactat
F1RZB9_BCL2L10-01       -------------------------------tggagt--------actgc
H0WZ06_BCL2L10-01       -------------------------------tggagt--------actgc
G1T264_BCL2L10-01       -------------------------------tggagt--------gctgc
A0A2K6F2Q2_BCL2L10      -------------------------------tggagt--------actgc
A0A2K6TIT7_BCL2L10      -------------------------------tggagt--------actgc
A0A2K5F974_BCL2L10      -------------------------------tggagt--------actgc
F7CT87_BCL2L10-01       -------------------------------tggagt--------actgc
A0A0D9RG38_BCL2L10      -------------------------------tggggt--------gctgc
A0A2K5TKG9_BCL2L10      -------------------------------tggggt--------gctgc
F7H6U5_BCL2L10-01       -------------------------------tggggt--------gctgc
A0A2K6B2D9_BCL2L10      -------------------------------tggggt--------gctgc
A0A2K5MMZ4_BCL2L10      -------------------------------tggggt--------gctgc
A0A096NM44_BCL2L10      -------------------------------tggggt--------gctgc
A0A2K5K3B0_BCL2L10      -------------------------------tggggt--------gctgc
A0A2K6M5H5_BCL2L10      -------------------------------tggggt--------gctgc
A0A2K6R5T5_BCL2L10      -------------------------------tggggt--------gctgc
G1R3W6_BCL2L10-01       -------------------------------tggggt--------gctgc
H2NN92_BCL2L10-01       -------------------------------tggggt--------gctgc
Q9HD36_BCL2L10-01       -------------------------------tggggt--------actgc
Q9HD36_BCL2L10-02       -------------------------------tggggt--------actgc
G3QLU6_BCL2L10-01       -------------------------------tggggt--------actgc
A0A2R9BCD9_BCL2L10      -------------------------------tggggt--------actgc
H2Q9G4_BCL2L10-01       -------------------------------tggggt--------actgc
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      -------------------------------tggagt--------actgc
G1LKR4_BCL2L10-01       -------------------------------tggagt--------actgc
M3Y8D1_BCL2L10-01       -------------------------------tggagt--------actgc
A0A087X830_MCL1-01      -------------------aaatggagtcggggatggacaaacacactac
I3JHR5_MCL1-01          -------------------aaatggagtcctggagggaccaatgcactat
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      -------------------acaaactgttgaagaagg--------gattt
H9GPE7_BCL2-01          -------------------acaagctgtcgcagaaag--------gatat
Q4SW32_MCL1-01          -------------------atgggctctcccagggac--------gcttt
F7G6M3_BCL2L2-01        -------------------acaagctgcggcagaagg--------gcttc
F6U940_BCL2L2-01        -------------------acaagctgaggcagaagg--------gctat
G3WPT2_BCL2L2-02        -------------------ataagctaaggcagaagg--------gctat
G3WPT2_BCL2L2-01        -------------------ataagctaaggcagaagg--------gctat
G1Q051_BCL2L2-01        -------------------acaagctgaggcagaagg--------gttat
A0A1U7RC37_BCL2L2-      -------------------ataagctgaggcagaagg--------gctat
D3Z5F7_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
P70345_BCL2L2-04        -------------------ataagctgaggcagaagg--------gttat
G1TV33_BCL2L2-01        -------------------acaagctgaggcagaagg--------gttat
G1P3J2_BCL2L2-01        -------------------acaagctgaggcagaagg--------gttat
A0A2K6GWN0_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2R9A7B2_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
H2Q805_BCL2L2-02        -------------------ataagctgaggcagaagg--------gttat
A0A2I2YPX6_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
G1RYB4_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
F7G4L5_BCL2L2-05        -------------------ataagctgaggcagaagg--------gttat
F7G4L5_BCL2L2-04        -------------------ataagctgaggcagaagg--------gttat
A0A2I3MUE4_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5V0Q3_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6AI30_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5MZX9_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6EA73_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5HEK7_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6MEE6_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6RW46_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2R8M4C0_BCL2L2-      -------------------ataagctgaggcagaaag--------gttat
A0A2K5CWZ4_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6TM77_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A287AW74_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
F6PH48_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
Q45T69_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
G1LMC3_BCL2L2-01        -------------------ataagctgaggcagaaag--------gttat
A0A2I2UAE3_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
M3Y5X5_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
W5QDH5_BCL2L2-01        -------------------ataagctgaggcagaagg--------ggtat
W5QDH5_BCL2L2-02        -------------------ataagctgaggcagaagg--------ggtat
Q05KI8_BCL2L2-01        -------------------ataagctgaggcagaagg--------ggtat
Q1RMX3_BCL2L2-01        -------------------ataagctgaggcagaagg--------ggtat
A0A1U7RC37_BCL2L2-      -------------------ataagctgaggcagaagg--------gctat
A0A287AW74_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A286XQQ9_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
H0XR82_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
A0A2K6GWN0_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
I3ND50_BCL2L2-02        -------------------ataagctgaggcagaagg--------gttac
A0A1S3FYD8_BCL2L2-      -------------------ataaactgaggcagaagg--------gttat
A0A2R9A7B2_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
H2Q805_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
G1RYB4_BCL2L2-03        -------------------ataagctgaggcagaagg--------gttat
A0A2I2YPX6_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
Q92843_BCL2L2-02        -------------------ataagctgaggcagaagg--------gttat
A0A2K5MZX9_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6EA73_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5V0Q3_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
F7G4L5_BCL2L2-02        -------------------ataagctgaggcagaagg--------gttat
F7G4L5_BCL2L2-03        -------------------ataagctgaggcagaagg--------gttat
A0A2K6AI30_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2I3MUE4_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6RW46_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6RW46_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6MEE6_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A0D9RU30_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5HEK7_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2R8M4C0_BCL2L2-      -------------------ataagctgaggcagaaag--------gttat
A0A2K6TM77_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K6TM77_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5CWZ4_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
A0A2K5CWZ4_BCL2L2-      -------------------ataagctgaggcagaagg--------gttat
G3TMU7_BCL2L2-01        -------------------acaagctgaggcagaagg--------gttat
O88996_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
Q7TS60_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
I3ND50_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttac
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        -------------------ataagctgaggcagaagg--------gttat
W5N4F7_BCL2-01          -------------------acaaactcctgaagaagg--------gctac
A0A2U9CJ81_MCL1-01      -------------------aaatggagtcgtggagggagcgatgcactac
G3PJT0_MCL1-01          -------------------attctccctcaaaatgga--------gtcgc
W5MMB7_MCL1-01          -------------------accaccattcaccccggc--------ctcgc
F6YNL8_BCL2-01          -------------------ataaactgtcacagaggg--------ggtac
G3WZW9_BCL2-02          -------------------ataagctatcacagagag--------ggtac
G3WZW9_BCL2-01          -------------------ataagctatcacagagag--------ggtac
K7F5Y4_BCL2-02          -------------------acaaactgtcacagaggg--------ggtat
K7F5Y4_BCL2-01          -------------------acaaactgtcacagaggg--------ggtat
K7F5Y4_BCL2-03          -------------------acaaactgtcacagaggg--------ggtat
H0W1T3_BCL2-01          -------------------ataagctgtcccagagag--------gctac
F1LNV0_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
P49950_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
P10417_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
Q7TSN8_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
P10417_BCL2-02          -------------------ataagctgtcacagaggg--------gctac
Q6R755_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
Q9JJV8_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
Q923R6_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
G3ULB7_BCL2-02          -------------------ataagctgtcgcagcggg--------gctac
G3ULB7_BCL2-01          -------------------ataagctgtcgcagcggg--------gctac
F6R2C4_BCL2-01          -------------------ataagctgtcgcagcggg--------gctac
O02718_BCL2-01          -------------------ataagctgtcgcagcggg--------gctac
A0A076FU27_BCL2-01      -------------------acaagctgtcgcagcgcg--------gctac
A0A076FZV9_BCL2-01      -------------------acaagctgtcgcagcgcg--------gctac
G1TW27_BCL2-01          -------------------ataagctgtcccagaggg--------gctac
I3MVK9_BCL2-01          -------------------ataagctgtcacagaggg--------gctac
M3YYK3_BCL2-01          -------------------ataagctgtcgcagaggg--------g----
G1LID1_BCL2-01          -------------------ccggcccttcgt-gaggc--------gctg-
F7CDX6_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
A0A287APJ6_BCL2-03      -------------------ataagctgtcgcagaggg--------gctac
G1LID1_BCL2-02          -------------------ataagctgtcgcagaggg--------gctac
M3X1R9_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
J9NXG3_BCL2-01          -------------------acaagctgtcgcagaggg--------gctac
J9NXG3_BCL2-02          -------------------acaagctgtcgcagaggg--------gctac
Q75SV7_BCL2-01          -------------------acaagctgtcgcagaggg--------gctac
H0WKI0_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
A0A2K6G3I7_BCL2-01      -------------------ataagctggcgcagaggg--------gctac
A0A2K5EB04_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A1D5QRF2_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K6UEL3_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2R8MY14_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K6R2I6_BCL2-02      -------------------ataagctgtcgcagaggg--------gctac
A0A2K5HK49_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K6KHG1_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K6R2I6_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K5XRD4_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K5NZS5_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A0D9S017_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K5UDI5_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A2K6CIX3_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A0A096MPU7_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
H2NWH5_BCL2-01          -------------------ataagttgtcgcagaggg--------gctac
P10415_BCL2-04          -------------------ataagctgtcgcagaggg--------gctac
G3QES9_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
A0A2I3GZF9_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
A9QXG9_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
P10415_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
P10415_BCL2-02          -------------------ataagctgtcgcagaggg--------gctac
H2QEM8_BCL2-01          -------------------ataagctgtcgcagaggg--------gctac
A0A2R9APW6_BCL2-01      -------------------ataagctgtcgcagaggg--------gctac
U3KEW4_BCL2-01          -------------------ataaactctcgcagaggg--------gatac
H0YUX3_BCL2-01          -------------------ataaactctctcagaggg--------gatac
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          -------------------ataaactctcgcagcggg--------gctac
Q00709_BCL2-02          -------------------ataaactctcgcagcggg--------gctac
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        g-------------------------------------------------
K7G130_BCL2A1-01        c-------------------------------------------------
Q9W6F2_BCL2A1-01        c-------------------------------------------------
G1N8C5_BCL2A1-01        c-------------------------------------------------
U3JTB2_BCL2A1-01        c-------------------------------------------------
H0ZCL9_BCL2A1-01        c-------------------------------------------------
X4ZGI8_BCL2-01          g-------------------------------------------------
Q564A4_BCL2-01          g-------------------------------------------------
F6SFL4_BCL2A1-01        t-------------------------------------------------
G3WSP8_BCL2A1-01        t-------------------------------------------------
A0A337STN9_BCL2A1-      a-------------------------------------------------
A0A337STN9_BCL2A1-      a-------------------------------------------------
E2RS00_BCL2A1-01        g-------------------------------------------------
M3YVH4_BCL2A1-01        g-------------------------------------------------
G1T1L8_BCL2A1-01        c-------------------------------------------------
G3V977_BCL2A1-01        c-------------------------------------------------
Q925A9_BCL2A1-01        c-------------------------------------------------
O55178_BCL2A1-01        c-------------------------------------------------
Q0P538_BCL2A1-01        c-------------------------------------------------
Q07440_BCL2A1-01        c-------------------------------------------------
O55179_BCL2A1-01        c-------------------------------------------------
Q8K164_BCL2A1-01        c-------------------------------------------------
Q4FK02_BCL2A1-01        c-------------------------------------------------
O55177_BCL2A1-02        c-------------------------------------------------
Q497M6_BCL2A1-01        c-------------------------------------------------
A0A2K6EKG1_BCL2A1-      c-------------------------------------------------
I3MCZ7_BCL2A1-01        c-------------------------------------------------
Q3C2I0_BCL2A1-01        c-------------------------------------------------
W5Q0N6_BCL2A1-01        c-------------------------------------------------
G3T8E6_BCL2A1-01        c-------------------------------------------------
F7CP56_BCL2A1-01        c-------------------------------------------------
C7F841_BCL2A1-02        c-------------------------------------------------
C7F841_BCL2A1-01        c-------------------------------------------------
H0WZ23_BCL2A1-01        c-------------------------------------------------
U3DBA0_BCL2A1-02        c-------------------------------------------------
U3DBA0_BCL2A1-01        c-------------------------------------------------
A0A2K6TLM0_BCL2A1-      c-------------------------------------------------
A0A2K6TLM0_BCL2A1-      c-------------------------------------------------
A0A2K6TLM0_BCL2A1-      c-------------------------------------------------
A0A2K5D2I1_BCL2A1-      c-------------------------------------------------
A0A2K5D2I1_BCL2A1-      c-------------------------------------------------
H2NNZ9_BCL2A1-01        c-------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      c-------------------------------------------------
A0A2I3HNF3_BCL2A1-      c-------------------------------------------------
A0A2I3HNF3_BCL2A1-      c-------------------------------------------------
A0A2K5KAB6_BCL2A1-      t-------------------------------------------------
A0A2K6AD55_BCL2A1-      t-------------------------------------------------
A0A0D9RRC3_BCL2A1-      t-------------------------------------------------
A0A2K6LV22_BCL2A1-      t-------------------------------------------------
A0A2K6PHG5_BCL2A1-      t-------------------------------------------------
A0A2K5KHH9_BCL2A1-      t-------------------------------------------------
A0A096NMX5_BCL2A1-      t-------------------------------------------------
A0A2K6DS80_BCL2A1-      t-------------------------------------------------
A0A2K5KHH9_BCL2A1-      t-------------------------------------------------
A0A2K5TMD8_BCL2A1-      t-------------------------------------------------
F7E8V5_BCL2A1-01        t-------------------------------------------------
A0A2K5KAB6_BCL2A1-      t-------------------------------------------------
A0A2K6LV22_BCL2A1-      t-------------------------------------------------
A0A2K6PHG5_BCL2A1-      t-------------------------------------------------
A0A2K6AD55_BCL2A1-      t-------------------------------------------------
A0A096NMX5_BCL2A1-      t-------------------------------------------------
A0A2K5KHH9_BCL2A1-      t-------------------------------------------------
A0A2K5TMD8_BCL2A1-      t-------------------------------------------------
A0A2K6DS80_BCL2A1-      t-------------------------------------------------
F7E8V5_BCL2A1-02        t-------------------------------------------------
B4E1X9_BCL2A1-01        c-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      c-------------------------------------------------
A0A2I3T6T8_BCL2A1-      c-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      c-------------------------------------------------
A0A2I3T6T8_BCL2A1-      c-------------------------------------------------
Q16548_BCL2A1-01        c-------------------------------------------------
A0A2I2YML2_BCL2A1-      c-------------------------------------------------
A0A2I2YML2_BCL2A1-      c-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      c-------------------------------------------------
A0A2I3T6T8_BCL2A1-      c-------------------------------------------------
A0A2I2YML2_BCL2A1-      c-------------------------------------------------
Q16548_BCL2A1-02        c-------------------------------------------------
A0A1U7QVA0_BCL2L10      t-------------------------------------------------
Q9Z0F3_BCL2L10-01       a-------------------------------------------------
Q99M66_BCL2L10-01       a-------------------------------------------------
B6V6J0_MCL1-01          g---------------------------------------------gctt
F7ETY1_MCL1-01          g---------------------------------------------ggtt
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          g-------------------------------------------------
Q1L8X3_MCL1-01          g-------------------------------------------------
Q9I9N3_MCL1-01          g-------------------------------------------------
A0A1X9JZA1_BCL2-01      g-------------------------------------------------
Q6GLI5_BCL2L1-01        t-------------------------------------------------
Q2TAP5_BCL2L1-01        t-------------------------------------------------
Q91828_BCL2L1-01        t-------------------------------------------------
H3AR18_MCL1-01          g-------------------------------------------------
H3AR18_MCL1-02          g-------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        a-------------------------------------------------
K7F655_BCL2L1-01        a-------------------------------------------------
G1N5N5_BCL2L1-01        t-------------------------------------------------
Q07816_BCL2L1-03        t-------------------------------------------------
Q07816_BCL2L1-01        t-------------------------------------------------
Q07816_BCL2L1-02        t-------------------------------------------------
U3JSL7_BCL2L1-01        a-------------------------------------------------
Q4U2V6_BCL2L1-01        a-------------------------------------------------
H0Z8G3_BCL2L1-01        a-------------------------------------------------
F6WA14_BCL2L1-01        a-------------------------------------------------
G3WKX6_BCL2L1-01        a-------------------------------------------------
W5PSA5_BCL2L1-01        a-------------------------------------------------
G3SPN0_BCL2L1-01        a-------------------------------------------------
H0X6V2_BCL2L1-01        a-------------------------------------------------
P53563_BCL2L1-04        a-------------------------------------------------
P53563_BCL2L1-02        a-------------------------------------------------
P53563_BCL2L1-03        a-------------------------------------------------
P53563_BCL2L1-01        a-------------------------------------------------
O35843_BCL2L1-01        a-------------------------------------------------
Q64373_BCL2L1-09        a-------------------------------------------------
Q64373_BCL2L1-01        a-------------------------------------------------
Q64373_BCL2L1-03        a-------------------------------------------------
Q64373_BCL2L1-04        a-------------------------------------------------
B2Z3Z4_BCL2L1-01        a-------------------------------------------------
A0A1U7QU73_BCL2L1-      a-------------------------------------------------
Q9MYW4_BCL2L1-01        a-------------------------------------------------
A0A1S3EPX7_BCL2L1-      a-------------------------------------------------
O77737_BCL2L1-01        a-------------------------------------------------
A0A286Y5D6_BCL2L1-      a-------------------------------------------------
G1P9D2_BCL2L1-01        a-------------------------------------------------
Q05KJ0_BCL2L1-01        a-------------------------------------------------
Q9MZS7_BCL2L1-01        a-------------------------------------------------
A0A1S2ZQT6_BCL2L1-      a-------------------------------------------------
A0A1L5BWY3_BCL2L1-      a-------------------------------------------------
A0A287CZ07_BCL2L1-      a-------------------------------------------------
I3MUP5_BCL2L1-03        a-------------------------------------------------
I3MUP5_BCL2L1-02        a-------------------------------------------------
I3MUP5_BCL2L1-01        a-------------------------------------------------
F6WQI0_BCL2L1-01        a-------------------------------------------------
E2IV76_BCL2L1-01        a-------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      a-------------------------------------------------
G1RER8_BCL2L1-01        a-------------------------------------------------
A0A2J8VIH3_BCL2L1-      a-------------------------------------------------
Q07817_BCL2L1-03        a-------------------------------------------------
Q07817_BCL2L1-01        a-------------------------------------------------
Q07817_BCL2L1-02        a-------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        a-------------------------------------------------
A0A2K5H963_BCL2L1-      a-------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      a-------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      a-------------------------------------------------
A0A2K5VPG2_BCL2L1-      a-------------------------------------------------
F6UKR4_BCL2L1-01        a-------------------------------------------------
A0A0D9RJZ8_BCL2L1-      a-------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      a-------------------------------------------------
A0A2K6QFA2_BCL2L1-      a-------------------------------------------------
A0A2K6QFA2_BCL2L1-      a-------------------------------------------------
A0A2K5YR37_BCL2L1-      a-------------------------------------------------
A0A2K6UWY8_BCL2L1-      a-------------------------------------------------
E2IV77_BCL2L1-01        a-------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        a-------------------------------------------------
F7IT34_BCL2L1-01        a-------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      a-------------------------------------------------
E2IV75_BCL2L1-01        a-------------------------------------------------
M3Z2H9_BCL2L1-01        a-------------------------------------------------
M3XA94_BCL2L1-01        a-------------------------------------------------
Q76LT7_BCL2L1-01        a-------------------------------------------------
Q8SQ42_BCL2L1-01        a-------------------------------------------------
H3AAS7_BCL2L2-01        a-------------------------------------------------
H3AAS7_BCL2L2-02        a-------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        a-------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        g-------------------------------------------------
A0A287APJ6_BCL2-01      a-------------------------------------------------
A0A286MU87_BCL2L1-      g-------------------------------------------------
C0HAD8_BCL2L1-01        g-------------------------------------------------
G1QEX2_BCL2L10-01       a-------------------------------------------------
W5QIG4_BCL2L10-01       g-------------------------------------------------
E1B9B3_BCL2L10-01       g-------------------------------------------------
F1MV39_BCL2L10-01       g-------------------------------------------------
H9GHK7_BCL2L1-01        a-------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      t-------------------------------------------------
A0A1L1RNM6_MCL1-02      t-------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          g-------------------------------------------------
R4GAJ0_MCL1-01          g-------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          g-------------------------------------------------
G3WBC5_MCL1-01          g-------------------------------------------------
H0XHA5_MCL1-01          g-------------------------------------------------
G1QAV8_MCL1-01          g-------------------------------------------------
G1PZ39_MCL1-01          g-------------------------------------------------
Q9Z1P3_MCL1-01          g-------------------------------------------------
P97287_MCL1-02          g-------------------------------------------------
P97287_MCL1-01          g-------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      g-------------------------------------------------
G1T2Q0_MCL1-02          g-------------------------------------------------
G1T2Q0_MCL1-01          g-------------------------------------------------
A0A287DCH9_MCL1-01      g-------------------------------------------------
A0A287DCH9_MCL1-02      g-------------------------------------------------
G3T756_MCL1-01          g-------------------------------------------------
W5QI41_MCL1-01          c-------------------------------------------------
A5PJR2_MCL1-01          g-------------------------------------------------
F1MQX4_MCL1-01          g-------------------------------------------------
A0A1S3F3I1_MCL1-01      g-------------------------------------------------
J9PBC4_MCL1-01          g-------------------------------------------------
J9PBC4_MCL1-02          g-------------------------------------------------
Q8HYS5_MCL1-01          g-------------------------------------------------
M3XAP4_MCL1-02          g-------------------------------------------------
Q7YRZ9_MCL1-01          g-------------------------------------------------
M3XAP4_MCL1-01          g-------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          g-------------------------------------------------
G1L3M8_MCL1-01          g-------------------------------------------------
G1L3M8_MCL1-02          g-------------------------------------------------
M3XZZ5_MCL1-01          g-------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          g-------------------------------------------------
K9IWB2_MCL1-01          g-------------------------------------------------
K9IWB2_MCL1-03          g-------------------------------------------------
A0A2K5C7L5_MCL1-01      g-------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          g-------------------------------------------------
A0A2K6GI15_MCL1-01      g-------------------------------------------------
A0A2K6GI15_MCL1-02      g-------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          g-------------------------------------------------
A0A2K5I9Q7_MCL1-02      g-------------------------------------------------
A0A2K5I9Q7_MCL1-01      g-------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      g-------------------------------------------------
A0A2K6PPL1_MCL1-02      g-------------------------------------------------
A0A2K6KRW9_MCL1-01      g-------------------------------------------------
A0A2K6PPL1_MCL1-01      g-------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      g-------------------------------------------------
A0A2I3GB35_MCL1-02      g-------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      g-------------------------------------------------
A0A2K5XSC7_MCL1-02      g-------------------------------------------------
A0A2K5W0W9_MCL1-01      g-------------------------------------------------
A0A2K6ECR0_MCL1-02      g-------------------------------------------------
A0A2I3M3D6_MCL1-01      g-------------------------------------------------
A0A2K5LXU8_MCL1-01      g-------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      g-------------------------------------------------
I7G687_MCL1-01          g-------------------------------------------------
A0A2K5W0W9_MCL1-02      g-------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      g-------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          g-------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      g-------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      g-------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      g-------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      g-------------------------------------------------
A0A2R9BYH6_MCL1-02      g-------------------------------------------------
K7DE58_MCL1-02          g-------------------------------------------------
Q07820_MCL1-03          g-------------------------------------------------
K7DE58_MCL1-01          g-------------------------------------------------
A0A2R9BYH6_MCL1-01      g-------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          g-------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          g-------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          g-------------------------------------------------
B4DG83_MCL1-01          g-------------------------------------------------
A0A2K6V5Y3_MCL1-02      g-------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      g-------------------------------------------------
A0A2K5CFH3_MCL1-03      g-------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      g-------------------------------------------------
F7GTF7_MCL1-01          g-------------------------------------------------
F7GTF7_MCL1-02          g-------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        g-------------------------------------------------
Q5XGJ4_BCL2L2-01        g-------------------------------------------------
B9ZYL7_BCL2-01          g-------------------------------------------------
F7BXJ7_BCL2-01          g-------------------------------------------------
Q90Z98_BCL2L1-01        c-------------------------------------------------
Q90Z98_BCL2L1-02        c-------------------------------------------------
H2SNZ8_BCL2L1-02        c-------------------------------------------------
H2SNZ8_BCL2L1-01        c-------------------------------------------------
H3CH49_BCL2L1-01        c-------------------------------------------------
A0A059PJI5_BCL2L1-      c-------------------------------------------------
B5XAY3_BCL2L1-01        c-------------------------------------------------
W5MG74_BCL2L1-01        t-------------------------------------------------
A0A087X9B7_BCL2L1-      c-------------------------------------------------
A0A2U9BY16_BCL2L1-      c-------------------------------------------------
A0A0D6DR75_BCL2L1-      c-------------------------------------------------
I3IZK7_BCL2L1-01        c-------------------------------------------------
A0A219P0Y3_BCL2L1-      c-------------------------------------------------
G3NJY1_BCL2L1-01        c-------------------------------------------------
C3VIT1_BCL2L1-01        c-------------------------------------------------
H2MLZ3_MCL1-01          g-------------------------------------------------
H2MLZ3_MCL1-02          g-------------------------------------------------
Q0KFR9_MCL1-01          t-------------------------------------------------
F1RZB9_BCL2L10-01       g-------------------------------------------------
H0WZ06_BCL2L10-01       g-------------------------------------------------
G1T264_BCL2L10-01       g-------------------------------------------------
A0A2K6F2Q2_BCL2L10      a-------------------------------------------------
A0A2K6TIT7_BCL2L10      t-------------------------------------------------
A0A2K5F974_BCL2L10      t-------------------------------------------------
F7CT87_BCL2L10-01       t-------------------------------------------------
A0A0D9RG38_BCL2L10      g-------------------------------------------------
A0A2K5TKG9_BCL2L10      g-------------------------------------------------
F7H6U5_BCL2L10-01       g-------------------------------------------------
A0A2K6B2D9_BCL2L10      g-------------------------------------------------
A0A2K5MMZ4_BCL2L10      g-------------------------------------------------
A0A096NM44_BCL2L10      g-------------------------------------------------
A0A2K5K3B0_BCL2L10      g-------------------------------------------------
A0A2K6M5H5_BCL2L10      g-------------------------------------------------
A0A2K6R5T5_BCL2L10      g-------------------------------------------------
G1R3W6_BCL2L10-01       g-------------------------------------------------
H2NN92_BCL2L10-01       g-------------------------------------------------
Q9HD36_BCL2L10-01       g-------------------------------------------------
Q9HD36_BCL2L10-02       g-------------------------------------------------
G3QLU6_BCL2L10-01       g-------------------------------------------------
A0A2R9BCD9_BCL2L10      g-------------------------------------------------
H2Q9G4_BCL2L10-01       g-------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      g-------------------------------------------------
G1LKR4_BCL2L10-01       g-------------------------------------------------
M3Y8D1_BCL2L10-01       g-------------------------------------------------
A0A087X830_MCL1-01      gaccaggggctcgttgtgcctgaagtcgcaatggg---------------
I3JHR5_MCL1-01          ggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactc
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      g----------------------------tatggg-----------aatt
H9GPE7_BCL2-01          g----------------------------actggg--------ttgccag
Q4SW32_MCL1-01          c----------------------------aacggg---------------
F7G6M3_BCL2L2-01        g-------------------------------------------------
F6U940_BCL2L2-01        g-------------------------------------------------
G3WPT2_BCL2L2-02        g-------------------------------------------------
G3WPT2_BCL2L2-01        g-------------------------------------------------
G1Q051_BCL2L2-01        g-------------------------------------------------
A0A1U7RC37_BCL2L2-      g-------------------------------------------------
D3Z5F7_BCL2L2-01        g-------------------------------------------------
P70345_BCL2L2-04        g-------------------------------------------------
G1TV33_BCL2L2-01        g-------------------------------------------------
G1P3J2_BCL2L2-01        g-------------------------------------------------
A0A2K6GWN0_BCL2L2-      g-------------------------------------------------
A0A2R9A7B2_BCL2L2-      g-------------------------------------------------
H2Q805_BCL2L2-02        g-------------------------------------------------
A0A2I2YPX6_BCL2L2-      g-------------------------------------------------
G1RYB4_BCL2L2-01        g-------------------------------------------------
F7G4L5_BCL2L2-05        g-------------------------------------------------
F7G4L5_BCL2L2-04        g-------------------------------------------------
A0A2I3MUE4_BCL2L2-      g-------------------------------------------------
A0A2K5V0Q3_BCL2L2-      g-------------------------------------------------
A0A2K6AI30_BCL2L2-      g-------------------------------------------------
A0A2K5MZX9_BCL2L2-      g-------------------------------------------------
A0A2K6EA73_BCL2L2-      g-------------------------------------------------
A0A2K5HEK7_BCL2L2-      g-------------------------------------------------
A0A2K6MEE6_BCL2L2-      g-------------------------------------------------
A0A2K6RW46_BCL2L2-      g-------------------------------------------------
A0A2R8M4C0_BCL2L2-      g-------------------------------------------------
A0A2K5CWZ4_BCL2L2-      g-------------------------------------------------
A0A2K6TM77_BCL2L2-      g-------------------------------------------------
A0A287AW74_BCL2L2-      g-------------------------------------------------
F6PH48_BCL2L2-01        g-------------------------------------------------
Q45T69_BCL2L2-01        g-------------------------------------------------
G1LMC3_BCL2L2-01        g-------------------------------------------------
A0A2I2UAE3_BCL2L2-      g-------------------------------------------------
M3Y5X5_BCL2L2-01        g-------------------------------------------------
W5QDH5_BCL2L2-01        g-------------------------------------------------
W5QDH5_BCL2L2-02        g-------------------------------------------------
Q05KI8_BCL2L2-01        g-------------------------------------------------
Q1RMX3_BCL2L2-01        g-------------------------------------------------
A0A1U7RC37_BCL2L2-      g-------------------------------------------------
A0A287AW74_BCL2L2-      g-------------------------------------------------
A0A286XQQ9_BCL2L2-      g-------------------------------------------------
H0XR82_BCL2L2-01        g-------------------------------------------------
A0A2K6GWN0_BCL2L2-      g-------------------------------------------------
I3ND50_BCL2L2-02        g-------------------------------------------------
A0A1S3FYD8_BCL2L2-      g-------------------------------------------------
A0A2R9A7B2_BCL2L2-      g-------------------------------------------------
H2Q805_BCL2L2-01        g-------------------------------------------------
G1RYB4_BCL2L2-03        g-------------------------------------------------
A0A2I2YPX6_BCL2L2-      g-------------------------------------------------
Q92843_BCL2L2-02        g-------------------------------------------------
A0A2K5MZX9_BCL2L2-      g-------------------------------------------------
A0A2K6EA73_BCL2L2-      g-------------------------------------------------
A0A2K5V0Q3_BCL2L2-      g-------------------------------------------------
F7G4L5_BCL2L2-02        g-------------------------------------------------
F7G4L5_BCL2L2-03        g-------------------------------------------------
A0A2K6AI30_BCL2L2-      g-------------------------------------------------
A0A2I3MUE4_BCL2L2-      g-------------------------------------------------
A0A2K6RW46_BCL2L2-      g-------------------------------------------------
A0A2K6RW46_BCL2L2-      g-------------------------------------------------
A0A2K6MEE6_BCL2L2-      g-------------------------------------------------
A0A0D9RU30_BCL2L2-      g-------------------------------------------------
A0A2K5HEK7_BCL2L2-      g-------------------------------------------------
A0A2R8M4C0_BCL2L2-      g-------------------------------------------------
A0A2K6TM77_BCL2L2-      g-------------------------------------------------
A0A2K6TM77_BCL2L2-      g-------------------------------------------------
A0A2K5CWZ4_BCL2L2-      g-------------------------------------------------
A0A2K5CWZ4_BCL2L2-      g-------------------------------------------------
G3TMU7_BCL2L2-01        g-------------------------------------------------
O88996_BCL2L2-01        g-------------------------------------------------
Q7TS60_BCL2L2-01        g-------------------------------------------------
I3ND50_BCL2L2-01        g-------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        g-------------------------------------------------
W5N4F7_BCL2-01          g----------------------------tgtggg---------------
A0A2U9CJ81_MCL1-01      ggctcaggaaattccttgccgcagatcgccgtgggctccgtgatcgactc
G3PJT0_MCL1-01          g-----------cccatgcgacagctcgcaatgggctcggcgaaggactc
W5MMB7_MCL1-01          c----------------------------agcctg---------------
F6YNL8_BCL2-01          g----------------------------agtggg---------------
G3WZW9_BCL2-02          g----------------------------a--------------------
G3WZW9_BCL2-01          g----------------------------agtggg---------------
K7F5Y4_BCL2-02          g----------------------------attggg---------------
K7F5Y4_BCL2-01          g----------------------------attggg---------------
K7F5Y4_BCL2-03          g----------------------------attggg---------------
H0W1T3_BCL2-01          g----------------------------agtggg---------------
F1LNV0_BCL2-01          g----------------------------agtggg---------------
P49950_BCL2-01          g----------------------------agtggg---------------
P10417_BCL2-01          g----------------------------agtggg---------------
Q7TSN8_BCL2-01          g----------------------------agtggg---------------
P10417_BCL2-02          g----------------------------agtggg---------------
Q6R755_BCL2-01          g----------------------------agtggg---------------
Q9JJV8_BCL2-01          g----------------------------agtggg---------------
Q923R6_BCL2-01          g----------------------------agtggg---------------
G3ULB7_BCL2-02          g----------------------------aatggg---------------
G3ULB7_BCL2-01          g----------------------------aatggg---------------
F6R2C4_BCL2-01          g----------------------------agtggg---------------
O02718_BCL2-01          g----------------------------agtggg---------------
A0A076FU27_BCL2-01      g----------------------------agtggg---------------
A0A076FZV9_BCL2-01      g----------------------------agtggg---------------
G1TW27_BCL2-01          g----------------------------agtggg---------------
I3MVK9_BCL2-01          g----------------------------agtggg---------------
M3YYK3_BCL2-01          ----------------------------------a---------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          g----------------------------agtggg---------------
A0A287APJ6_BCL2-03      g----------------------------agtggg---------------
G1LID1_BCL2-02          g----------------------------agtggg---------------
M3X1R9_BCL2-01          g----------------------------agtggg---------------
J9NXG3_BCL2-01          g----------------------------agtggg---------------
J9NXG3_BCL2-02          g----------------------------agtggg---------------
Q75SV7_BCL2-01          g----------------------------agtggg---------------
H0WKI0_BCL2-01          g----------------------------agtggg---------------
A0A2K6G3I7_BCL2-01      g----------------------------agtggg---------------
A0A2K5EB04_BCL2-01      g----------------------------agtggg---------------
A0A1D5QRF2_BCL2-01      g----------------------------agtggg---------------
A0A2K6UEL3_BCL2-01      g----------------------------agtggg---------------
A0A2R8MY14_BCL2-01      g----------------------------agtggg---------------
A0A2K6R2I6_BCL2-02      g----------------------------agtggg---------------
A0A2K5HK49_BCL2-01      g----------------------------agtggg---------------
A0A2K6KHG1_BCL2-01      g----------------------------agtggg---------------
A0A2K6R2I6_BCL2-01      g----------------------------agtggg---------------
A0A2K5XRD4_BCL2-01      g----------------------------agtggg---------------
A0A2K5NZS5_BCL2-01      g----------------------------agtggg---------------
A0A0D9S017_BCL2-01      g----------------------------agtggg---------------
A0A2K5UDI5_BCL2-01      g----------------------------agtggg---------------
A0A2K6CIX3_BCL2-01      g----------------------------agtggg---------------
A0A096MPU7_BCL2-01      g----------------------------agtggg---------------
H2NWH5_BCL2-01          g----------------------------agtggg---------------
P10415_BCL2-04          g----------------------------agtggg---------------
G3QES9_BCL2-01          g----------------------------agtggg---------------
A0A2I3GZF9_BCL2-01      g----------------------------agtggg---------------
A9QXG9_BCL2-01          g----------------------------agtggg---------------
P10415_BCL2-01          g----------------------------agtggg---------------
P10415_BCL2-02          g----------------------------agtggg---------------
H2QEM8_BCL2-01          g----------------------------agtggg---------------
A0A2R9APW6_BCL2-01      g----------------------------agtggg---------------
U3KEW4_BCL2-01          g----------------------------actggg---------------
H0YUX3_BCL2-01          g----------------------------actggg---------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          g----------------------------actggg---------------
Q00709_BCL2-02          g----------------------------actggg---------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          ----------agtggaaatttcaatcttccggggaggatgatgacactat
Q564A4_BCL2-01          ----------tgtggaaatgtcagtcctctgctgaggaagatgacacctt
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          taacaacggggggtcgctgccttgttcccaggaggatgaattagatgagg
F7ETY1_MCL1-01          taacagtggggggagccttactgcctcccaggagggagaattggatgagg
J7H260_MCL1-01          --aggattacatggacgtacagtcggactcccggggctccacc-------
D2ITA0_MCL1-03          --------gcgaaacatggacttccactccgaaggttcacacaccacgac
D2ITA0_MCL1-04          --------gcgaaacatggacttccactccgaaggttcacacaccacgac
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --gctggaagaaacaacgacaacggcttttggccat--------------
F8W4Q8_MCL1-01          --gctggaagaaacaacgacaacggcttttggccat--------------
Q568W5_MCL1-01          --gctggaagaaacaacgacaacggcttttggccat--------------
A0A087YBW4_BCL2L1-      -------------------tcaagctctctgctgag--------------
M4A558_BCL2L1-01        -------------------tcaagctctctgctgag--------------
A0A0F7L1T6_BCL2L1-      -------------------ccatcttctctgctgag--------------
H2U5I3_BCL2L1-01        -------------------ccaacttctctgctgag--------------
H2U5I3_BCL2L1-02        -------------------ccaacttctctgctgag--------------
G3P7B4_BCL2L1-01        -------------------ccaacctctctgttgag--------------
E6ZFR0_BCL2L1-01        -------------------ccaacctctctactgag--------------
A0A0B4KJI5_BCL2L1-      -------------------ccaactgccctgctgag--------------
Q568V1_MCL1-01          --acgggtaca--------ttgaggaggaggaggcg--------------
Q1L8X3_MCL1-01          --acggataca--------ttgaggaggaggaggcg--------------
Q9I9N3_MCL1-01          --acggataca--------ctgaggaggaggaggcg--------------
A0A1X9JZA1_BCL2-01      --agtgggggt--------ttgacgctgtccggaat--------------
Q6GLI5_BCL2L1-01        --gcgggga-----------------------------------------
Q2TAP5_BCL2L1-01        --gcaggaa-----------------------------------------
Q91828_BCL2L1-01        --gcaggaa-----------------------------------------
H3AR18_MCL1-01          --acggggacatgg-----cggagtttcgcaaggag--------------
H3AR18_MCL1-02          --acggggacatgg-----cggagtttcgcaaggag--------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --gctggagccagc-----tggaggaagaggatgag--------------
K7F655_BCL2L1-01        --gctggagctggt-----tcgagggggaggatgag--------------
G1N5N5_BCL2L1-01        --gctggagcgagc-----tggaggaagaggatgag--------------
Q07816_BCL2L1-03        --gctggagcgagc-----tggaggaagaggatgag--------------
Q07816_BCL2L1-01        --gctggagcgagc-----tggaggaagaggatgag--------------
Q07816_BCL2L1-02        --gctggagcgagc-----tggaggaagaggatgag--------------
U3JSL7_BCL2L1-01        --gctggagtcagc-----tggaggaggaggatgag--------------
Q4U2V6_BCL2L1-01        --gctggagtcagc-----tggaagaggaggatgag--------------
H0Z8G3_BCL2L1-01        --gctggagtcagc-----tggaagaggaggatgag--------------
F6WA14_BCL2L1-01        --attggagtcagt-----ttgaagat------gag--------------
G3WKX6_BCL2L1-01        --attggagtcagt-----ttgaagat------gag--------------
W5PSA5_BCL2L1-01        --gctggagtcagt-----ttagtgacatggaagag--------------
G3SPN0_BCL2L1-01        --gttggagtcagt-----ttagtgatgtggaggag--------------
H0X6V2_BCL2L1-01        --gctggagtcagt-----ttagcgatgtggaagag--------------
P53563_BCL2L1-04        --gctggagtcagt-----ttagcgatgtcgaagag--------------
P53563_BCL2L1-02        --gctggagtcagt-----ttagcgatgtcgaagag--------------
P53563_BCL2L1-03        --gctggagtcagt-----ttagcgatgtcgaagag--------------
P53563_BCL2L1-01        --gctggagtcagt-----ttagcgatgtcgaagag--------------
O35843_BCL2L1-01        --gctggagtcagt-----ttagtgatgttgaagag--------------
Q64373_BCL2L1-09        --gctggagtcagt-----ttagtgatgtcgaagag--------------
Q64373_BCL2L1-01        --gctggagtcagt-----ttagtgatgtcgaagag--------------
Q64373_BCL2L1-03        --gctggagtcagt-----ttagtgatgtcgaagag--------------
Q64373_BCL2L1-04        --gctggagtcagt-----ttagtgatgtcgaagag--------------
B2Z3Z4_BCL2L1-01        --gctggagtcagt-----ttagtgatgtcgaagag--------------
A0A1U7QU73_BCL2L1-      --gctggagtcagt-----ttagtgatgtcgaagag--------------
Q9MYW4_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A1S3EPX7_BCL2L1-      --gctggagtcagt-----ttagcgatgtggaagag--------------
O77737_BCL2L1-01        --gctggagtcagt-----ttactgatgtggaagag--------------
A0A286Y5D6_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
G1P9D2_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q05KJ0_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q9MZS7_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A1S2ZQT6_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A1L5BWY3_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A287CZ07_BCL2L1-      --gctggagtcagt-----ttagcgatgtggaagag--------------
I3MUP5_BCL2L1-03        --gctggagtcagt-----ttagcgatgtggaagag--------------
I3MUP5_BCL2L1-02        --gctggagtcagt-----ttagcgatgtggaagag--------------
I3MUP5_BCL2L1-01        --gctggagtcagt-----ttagcgatgtggaagag--------------
F6WQI0_BCL2L1-01        --actggagtcagt-----ttagtgacgtggaagag--------------
E2IV76_BCL2L1-01        --gctggagtcagt-----ttatcgatgcagaagag--------------
A0A2K6G3C5_BCL2L1-      -------------------------atgcagaagag--------------
A0A2K6G3C5_BCL2L1-      --gctggagtcagt-----ttatcgatgcagaagag--------------
G1RER8_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2J8VIH3_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
Q07817_BCL2L1-03        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q07817_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q07817_BCL2L1-02        --gctggagtcagt-----ttagtgatgtggaagag--------------
G3RY91_BCL2L1-02        -------------------------atgtggaagag--------------
G3RY91_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K5H963_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K5H963_BCL2L1-      -------------------------atgtggaagag--------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --gctggagtcaat-----ttagtgatgtggaagag--------------
A0A2K5M8B1_BCL2L1-      -------------------------atgtggaagag--------------
A0A2K6LPM4_BCL2L1-      -------------------------atgtggaagag--------------
A0A2K6QFA2_BCL2L1-      -------------------------atgtggaagag--------------
A0A2K5VPG2_BCL2L1-      -------------------------atgtggaagag--------------
F6UKR4_BCL2L1-02        -------------------------atgtggaagag--------------
A0A2K5YR37_BCL2L1-      -------------------------atgtggaagag--------------
A0A2K5YR37_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K5VPG2_BCL2L1-      --gctggagtcaat-----ttagtgatgtggaagag--------------
F6UKR4_BCL2L1-01        --gctggagtcaat-----ttagtgatgtggaagag--------------
A0A0D9RJZ8_BCL2L1-      --gctggagtcaat-----ttagtgatgtggaagag--------------
I7GKS6_BCL2L1-01        -------------------------atgtggaagag--------------
A0A2K6LPM4_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K6QFA2_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K6QFA2_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K5YR37_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K6UWY8_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
E2IV77_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
A0A2K6UWY8_BCL2L1-      -------------------------atgtggaagag--------------
F7IT34_BCL2L1-02        --gctggagtcagt-----ttagtgatgtggaagag--------------
F7IT34_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
F7IT34_BCL2L1-03        -------------------------atgtggaagag--------------
A0A2K5EBP4_BCL2L1-      -------------------------atgtggaagag--------------
A0A2K5EBP4_BCL2L1-      --gctggagtcagt-----ttagtgatgtggaagag--------------
E2IV75_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
M3Z2H9_BCL2L1-01        --gctggagtcagt-----ttagtgatgcagaagag--------------
M3XA94_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q76LT7_BCL2L1-01        --gctggagtcagt-----ttagtgatgtggaagag--------------
Q8SQ42_BCL2L1-01        --gctggagtcggt-----ttagtgatgtggaagag--------------
H3AAS7_BCL2L2-01        --tttattacaaac------------------------------------
H3AAS7_BCL2L2-02        --tttattacaaac------------------------------------
F6VJQ0_BCL2L10-01       -------tacaagt-------gtgctcttagggaag--------------
H3ANS8_BCL2L1-01        --tatcccagaagctgatgcag-------cggggataccagtggagggag
D2ITA2_BCL2L1-02        --attgacacaagc-----------atgtcgatcag-----taacagaga
C1BLI0_BCL2L1-01        --ttcttcataagc-----tataaactttcacagag--------------
A0A287APJ6_BCL2-01      --gctgttgcaggcaaagaaagaaattgaaaaacactctattaatgataa
A0A286MU87_BCL2L1-      --ttttttataagc-----tatagactgt---------------------
C0HAD8_BCL2L1-01        --ttttttataagc-----tatagactgt---------------------
G1QEX2_BCL2L10-01       --agttgcgcaccc-----gacggctgctgaccgag--------------
W5QIG4_BCL2L10-01       --agttctgcgccc-----gggagcc------------------------
E1B9B3_BCL2L10-01       --agttctgcgccc-----gggagcc------------------------
F1MV39_BCL2L10-01       --agttctgcgccc-----gggagcc------------------------
H9GHK7_BCL2L1-01        --gctggcatgaga-----ttgagatggagagcggggaggaagcgatgga
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --tccgccgcggcc-----cgccgggcgccgccgga--------------
A0A1L1RNM6_MCL1-02      --tccgccgcggcc-----cgccgggcgccgccgga--------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       ----------gaga-----ccctgcttttggccgagg-------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --acggctgcgag--------gaagccgaggaggaggaggccgcgacggt
R4GAJ0_MCL1-01          --acggctgcgag--------gaagccgaggaggaggaggccgcgacggt
H2MBQ3_BCL2L10-01       -----gaccctagc-----tgtggcc------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      ----------gaga-----ccgtggctgttgcagaggattaca-------
M4AUW7_BCL2L10-01       ----------gaga-----ccgtggttgttgcagaggattaca-------
D2IT42_BCL2L10-02       ----------gacc-----ctggccctgtcagagga-----ct-------
F6ZMX1_MCL1-01          --acggttacgagc-----ccgagcctcccgggaag-----cg-------
G3WBC5_MCL1-01          --acggttacgagc-----ccgagctccccgggaag-----cg-------
H0XHA5_MCL1-01          --cctcgtgcgagc-----cggagcctctcaagaag-----ca-------
G1QAV8_MCL1-01          --gcaggtatgagc-----cggagcc------gaag-----ca-------
G1PZ39_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
Q9Z1P3_MCL1-01          --acggctgtgagc-----cggaggtgctcagcaaa-----cg-------
P97287_MCL1-02          --acggctgcgagc-----cggaggccatcggcaag-----cg-------
P97287_MCL1-01          --acggctgcgagc-----cggaggccatcggcaag-----cg-------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --acgggtacgagc-----cggagcccctcgggaag-----cg-------
G1T2Q0_MCL1-02          --acggctacgagc-----cggagccccttgcgaag-----cg-------
G1T2Q0_MCL1-01          --acggctacgagc-----cggagccccttgcgaag-----cg-------
A0A287DCH9_MCL1-01      --acggctacgagc-----ccgagcccctcgggaag-----cg-------
A0A287DCH9_MCL1-02      --acggctacgagc-----ccgagcccctcgggaag-----cg-------
G3T756_MCL1-01          --acgggtacgagc-----cggagccgctcgggaag-----cg-------
W5QI41_MCL1-01          --agtggttcaaga-----tgtttggcttcaagagg-----cg-------
A5PJR2_MCL1-01          --acgggtgcgagc-----cagaccctctcgggaag-----cg-------
F1MQX4_MCL1-01          --acgggtgcaagc-----cagaccctctcgggaag-----cg-------
A0A1S3F3I1_MCL1-01      --acggctacgaac-----ccgagcccctggggaag-----ag-------
J9PBC4_MCL1-01          --acgggtacgagc-----cggaacctttggggaag-----cg-------
J9PBC4_MCL1-02          --acgggtacgagc-----cggaacctttggggaag-----cg-------
Q8HYS5_MCL1-01          --acgggtacgagc-----cggaacctttggggaag-----cg-------
M3XAP4_MCL1-02          --acgggtacgagc-----cagaacctctggggaag-----cg-------
Q7YRZ9_MCL1-01          --acgggtacgagc-----cagaacctctggggaag-----cg-------
M3XAP4_MCL1-01          --acgggtacgagc-----cagaacctctggggaag-----cg-------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
G1L3M8_MCL1-01          --acgggtacgagc-----cggaacctttggggaag-----cg-------
G1L3M8_MCL1-02          --acgggtacgagc-----cggaacctttggggaag-----cg-------
M3XZZ5_MCL1-01          --atgggtacgagc-----cggaacctttggggaag-----ag-------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --acgggtacgagc-----cggagcccctcgggaag-----cg-------
K9IWB2_MCL1-01          --acgggtacgagc-----cggagcccctcgggaag-----cg-------
K9IWB2_MCL1-03          --acgggtacgagc-----cggagcccctcgggaag-----cg-------
A0A2K5C7L5_MCL1-01      --acaggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --acgggtacgagc-----cggagcctttggggaag-----cg-------
A0A2K6GI15_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6GI15_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5I9Q7_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5I9Q7_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6PPL1_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6KRW9_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6PPL1_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2I3GB35_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5XSC7_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5W0W9_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6ECR0_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2I3M3D6_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5LXU8_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
I7G687_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5W0W9_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2R9BYH6_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
K7DE58_MCL1-02          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
Q07820_MCL1-03          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
K7DE58_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2R9BYH6_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
B4DG83_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6V5Y3_MCL1-02      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5CFH3_MCL1-03      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --acgggtacgagc-----cggagcctctcgggaag-----cg-------
F7GTF7_MCL1-01          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
F7GTF7_MCL1-02          --acgggtacgagc-----cggagcctctcgggaag-----cg-------
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        ----------------------------ttccggagcctgcag-------
Q5XGJ4_BCL2L2-01        ----------------------------ttccggagcctgcag-------
B9ZYL7_BCL2-01          --catgggaagagggaaggcagcaggtctctgctgagcaccctcaagctt
F7BXJ7_BCL2-01          --aatgggaagaggggcggcagcaggtctctgctgagcaccctcaagctt
Q90Z98_BCL2L1-01        --------------------cctgcaaccacattggactta---------
Q90Z98_BCL2L1-02        --------------------cctgcaaccacattggactta---------
H2SNZ8_BCL2L1-02        --------------------ctttcaatcacaatggactcata-------
H2SNZ8_BCL2L1-01        --------------------ctttcaatcacaatggactcata-------
H3CH49_BCL2L1-01        --------------------ctttgagtcacattg---------------
A0A059PJI5_BCL2L1-      --------------------cctgcgaccacatcggcctca---------
B5XAY3_BCL2L1-01        --------------------ccttcaaccacatggagctca---------
W5MG74_BCL2L1-01        --------------------cc----------tgggaccag---------
A0A087X9B7_BCL2L1-      --------------------cgatccaacacatattgccca---------
A0A2U9BY16_BCL2L1-      --------------------ctctcaaccatatgggactta---------
A0A0D6DR75_BCL2L1-      --------------------ctctcaaccacttgggactca---------
I3IZK7_BCL2L1-01        --------------------ctctcaaccacatagtactca---------
A0A219P0Y3_BCL2L1-      --------------------ctctcaaccacatgggactca---------
G3NJY1_BCL2L1-01        --------------------ccctcaaccacatagggctgt---------
C3VIT1_BCL2L1-01        --------------------ctctcaaccacatagtgctca---------
H2MLZ3_MCL1-01          ----------------------------tccgcgcgcgtgcct-------
H2MLZ3_MCL1-02          ----------------------------tccgcgcgcgtgcct-------
Q0KFR9_MCL1-01          ----------------------------tccagggggctgggg-------
F1RZB9_BCL2L10-01       ----------------------------cccgggagcccggca-------
H0WZ06_BCL2L10-01       ----------------------------cgcgggatccgactg-------
G1T264_BCL2L10-01       ----------------------------cccgcgagcccggca-------
A0A2K6F2Q2_BCL2L10      ----------------------------caagggagccgggcg-------
A0A2K6TIT7_BCL2L10      ----------------------------cccgggagcccggca-------
A0A2K5F974_BCL2L10      ----------------------------cccaggagcctggca-------
F7CT87_BCL2L10-01       ----------------------------cccgggagcctggca-------
A0A0D9RG38_BCL2L10      ----------------------------cccgggaacccggca-------
A0A2K5TKG9_BCL2L10      ----------------------------cccgggaacccggca-------
F7H6U5_BCL2L10-01       ----------------------------cccgggaacccggca-------
A0A2K6B2D9_BCL2L10      ----------------------------cccgggaacccggca-------
A0A2K5MMZ4_BCL2L10      ----------------------------cccgggaacccggca-------
A0A096NM44_BCL2L10      ----------------------------cccgggaacccggca-------
A0A2K5K3B0_BCL2L10      ----------------------------cccgggaacccggca-------
A0A2K6M5H5_BCL2L10      ----------------------------cccgggaacccggca-------
A0A2K6R5T5_BCL2L10      ----------------------------cccgggaacccggca-------
G1R3W6_BCL2L10-01       ----------------------------cccgggaacccggca-------
H2NN92_BCL2L10-01       ----------------------------cccgggaacccggca-------
Q9HD36_BCL2L10-01       ----------------------------cccgggaacccggca-------
Q9HD36_BCL2L10-02       ----------------------------cccgggaacccggca-------
G3QLU6_BCL2L10-01       ----------------------------cccgggaacccggca-------
A0A2R9BCD9_BCL2L10      ----------------------------cccgggaacccggca-------
H2Q9G4_BCL2L10-01       ----------------------------cccgggaacccggca-------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      ----------------------------cccgggagcccggca-------
G1LKR4_BCL2L10-01       ----------------------------cccgggagcccggca-------
M3Y8D1_BCL2L10-01       ----------------------------cccgcggccccggca-------
A0A087X830_MCL1-01      ---agccactgtagattctcttcattcgcctaaggatccctac-------
I3JHR5_MCL1-01          tagcaacgggattgtgtctaatggtacccccaaacggccgaac-------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      tcaagcagaaaacgattctccaaataatttatttggggacccc-------
H9GPE7_BCL2-01          tggagacagaggaaagtcagcatctctttccccagagcttctc-------
Q4SW32_MCL1-01          ----aacgtcggcgacagcccgaagcggcccagcaagctgacg-------
F7G6M3_BCL2L2-01        ----------------------------cctgcggggccgggc-------
F6U940_BCL2L2-01        ----------------------------cctgtggaactggcc-------
G3WPT2_BCL2L2-02        ----------------------------cctgtggaactggcc-------
G3WPT2_BCL2L2-01        ----------------------------cctgtggaactggcc-------
G1Q051_BCL2L2-01        ----------------------------tttgtggagcgggtc-------
A0A1U7RC37_BCL2L2-      ----------------------------tctgtggagctggcc-------
D3Z5F7_BCL2L2-01        ----------------------------tctgtggagctggcc-------
P70345_BCL2L2-04        ----------------------------tctgtggagctggcc-------
G1TV33_BCL2L2-01        ----------------------------tctgtggggctggcc-------
G1P3J2_BCL2L2-01        ----------------------------tttgtggagcgggtc-------
A0A2K6GWN0_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2R9A7B2_BCL2L2-      ----------------------------tctgtggagctggcc-------
H2Q805_BCL2L2-02        ----------------------------tctgtggagctggcc-------
A0A2I2YPX6_BCL2L2-      ----------------------------tctgtggagctggcc-------
G1RYB4_BCL2L2-01        ----------------------------tctgtggagctggcc-------
F7G4L5_BCL2L2-05        ----------------------------tctgtggagctggcc-------
F7G4L5_BCL2L2-04        ----------------------------tctgtggagctggcc-------
A0A2I3MUE4_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5V0Q3_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6AI30_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5MZX9_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6EA73_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5HEK7_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6MEE6_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6RW46_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2R8M4C0_BCL2L2-      ----------------------------tctgtggaactggcc-------
A0A2K5CWZ4_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6TM77_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A287AW74_BCL2L2-      ----------------------------tctgtggagctggcc-------
F6PH48_BCL2L2-01        ----------------------------tttgtggagctggcc-------
Q45T69_BCL2L2-01        ----------------------------tttgtggagctggcc-------
G1LMC3_BCL2L2-01        ----------------------------tgtgtggagctggcc-------
A0A2I2UAE3_BCL2L2-      ----------------------------tttgtggagcaggcc-------
M3Y5X5_BCL2L2-01        ----------------------------tttgtggagctggcc-------
W5QDH5_BCL2L2-01        ----------------------------tttgtggagctggcc-------
W5QDH5_BCL2L2-02        ----------------------------tttgtggagctggcc-------
Q05KI8_BCL2L2-01        ----------------------------tttgtggagctggcc-------
Q1RMX3_BCL2L2-01        ----------------------------tttgtggagctggcc-------
A0A1U7RC37_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A287AW74_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A286XQQ9_BCL2L2-      ----------------------------tctgtggagctggcc-------
H0XR82_BCL2L2-01        ----------------------------tctgtggagctggcc-------
A0A2K6GWN0_BCL2L2-      ----------------------------tctgtggagctggcc-------
I3ND50_BCL2L2-02        ----------------------------tctgtggagctggcc-------
A0A1S3FYD8_BCL2L2-      ----------------------------tctgtggagcgggcc-------
A0A2R9A7B2_BCL2L2-      ----------------------------tctgtggagctggcc-------
H2Q805_BCL2L2-01        ----------------------------tctgtggagctggcc-------
G1RYB4_BCL2L2-03        ----------------------------tctgtggagctggcc-------
A0A2I2YPX6_BCL2L2-      ----------------------------tctgtggagctggcc-------
Q92843_BCL2L2-02        ----------------------------tctgtggagctggcc-------
A0A2K5MZX9_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6EA73_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5V0Q3_BCL2L2-      ----------------------------tctgtggagctggcc-------
F7G4L5_BCL2L2-02        ----------------------------tctgtggagctggcc-------
F7G4L5_BCL2L2-03        ----------------------------tctgtggagctggcc-------
A0A2K6AI30_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2I3MUE4_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6RW46_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6RW46_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6MEE6_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A0D9RU30_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5HEK7_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2R8M4C0_BCL2L2-      ----------------------------tctgtggaactggcc-------
A0A2K6TM77_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K6TM77_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5CWZ4_BCL2L2-      ----------------------------tctgtggagctggcc-------
A0A2K5CWZ4_BCL2L2-      ----------------------------tctgtggagctggcc-------
G3TMU7_BCL2L2-01        ----------------------------tttgtggagctggcc-------
O88996_BCL2L2-01        ----------------------------tctgtggagctggcc-------
Q7TS60_BCL2L2-01        ----------------------------tctgtggagctggcc-------
I3ND50_BCL2L2-01        ----------------------------tctgtggagctggcc-------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        ----------------------------tctgtggagctggcc-------
W5N4F7_BCL2-01          -aatcccgcgtgtccggcgagaccgatccccccaataacggat-------
A0A2U9CJ81_MCL1-01      ccgcggcgggaacgtcggcgccggggacgccccgaagcggccc-------
G3PJT0_MCL1-01          ccacaacggcaacgcggggacaaacgacaccccgaagcggccca------
W5MMB7_MCL1-01          --gggccctgtccgggcgggt-ccgccgcccgcacggctgtcctggacc-
F6YNL8_BCL2-01          --atgctggagatctgagggcaccagcctctccaagtcttcctcctgttg
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --atgctggaaatctgaggacaccagcctctccaagtcttcctcctgttg
K7F5Y4_BCL2-02          --ctgccaatgaaaacagaggaccagtttcttcaagtctctctcctc---
K7F5Y4_BCL2-01          --ctgccaatgaaaacagaggaccagtttcttcaagtctctctcctc---
K7F5Y4_BCL2-03          --ctgccaatgaaaacagaggaccagtttcttcaagtctctctcctc---
H0W1T3_BCL2-01          --atgccggagacg--ggagcgc---------------------------
F1LNV0_BCL2-01          --atactggagatg--aagactccgcgcccctgagggctgccc-------
P49950_BCL2-01          --atactggagatg--aagactccgcgcccctgagggctgccc-------
P10417_BCL2-01          --atgctggagatg--cggacgcggcgcccctgggggctgccc-------
Q7TSN8_BCL2-01          --atgctggagatg--cggacgcggcgcccctgggggctgccc-------
P10417_BCL2-02          --atgctggagatg--cggacgcggcgcccctgggggctgccc-------
Q6R755_BCL2-01          --atgtgggagatg--tggacgccgcgcccctgggcgccgccc-------
Q9JJV8_BCL2-01          --atgtgggagatg--tggacgccgcgcccctgggcgccgccc-------
Q923R6_BCL2-01          --atgtgggagatg--tggacgccgcgcccctgggcgccgccc-------
G3ULB7_BCL2-02          --aggctggcgaag--ct--------------------------------
G3ULB7_BCL2-01          --aggctggcgaag--ctagcgccgcgccccccggggccgctc-------
F6R2C4_BCL2-01          --atgccggagacg--cgggcgccgcgccccccggggccgctc-------
O02718_BCL2-01          --atgccggagacg--cgggcgccgcgccccccggggccgctc-------
A0A076FU27_BCL2-01      --atgccagagccg--cgggcgccgcgccccccggggccgccc-------
A0A076FZV9_BCL2-01      --atgccggagccg--cgggcgccgcgccccccggggccgctc-------
G1TW27_BCL2-01          --acgctggggacg--cgggc---------------gccgcct-------
I3MVK9_BCL2-01          --atgctggagacg--tgggcgctgcgtccccaggagccgccc-------
M3YYK3_BCL2-01          --agaccagtgatg----aaactcgtgtacttacccaccgccc-------
G1LID1_BCL2-01          ----gcaggtggcg--c---------------------------------
F7CDX6_BCL2-01          --atgccggagacg--cgggcgccgcgcccctgggggccaccc-------
A0A287APJ6_BCL2-03      --atgccggagacg--cgggcgccgcgtccccgggggccgctc-------
G1LID1_BCL2-02          --atgccggagacg--cg--------------------------------
M3X1R9_BCL2-01          --atgccggggacg--cgggcgccgcgcccccgggggccgccc-------
J9NXG3_BCL2-01          --acgcgggagagg--cgggcgccgcgcccccgggggccgccc-------
J9NXG3_BCL2-02          --acgcgggagagg--cgggcgccgcgcccccgggggccgccc-------
Q75SV7_BCL2-01          --acgcgggagagg--cgggcgccgcgcccccgggggccgccc-------
H0WKI0_BCL2-01          --atgctggagacg--tgggcgttgcaccccccggggccgcca-------
A0A2K6G3I7_BCL2-01      --atgccggagacg--cgggcgctgcgcccccgggggccgccc-------
A0A2K5EB04_BCL2-01      --atgccggagatg--tgggcgccgcacccccaggggccgccc-------
A0A1D5QRF2_BCL2-01      --atgcgggggatg--tgggcgcggcgacccctggggccgccc-------
A0A2K6UEL3_BCL2-01      --atgccggagatg--tgggcgccgcgcccccaggcgccgccc-------
A0A2R8MY14_BCL2-01      --atgccggagatg--tgggcgccgcgcccccaggggccgccc-------
A0A2K6R2I6_BCL2-02      --atgcgggagatg--tgggcgccgcgacccctggggccgccc-------
A0A2K5HK49_BCL2-01      --atgcgggggatg--tgggagccgcgacccctggggccgccc-------
A0A2K6KHG1_BCL2-01      --atgcgggagatg--tgggcgccgcgacccctggggccgccc-------
A0A2K6R2I6_BCL2-01      --atgcgggagatg--tgggcgccgcgacccctggggccgccc-------
A0A2K5XRD4_BCL2-01      --atgcgggggatg--tgggcgcggcgacccctggggtcgccc-------
A0A2K5NZS5_BCL2-01      --atgcgggggatg--tgggcgcggcgacccctggggtcgccc-------
A0A0D9S017_BCL2-01      --atgcgggggatg--tgggcgccgcgacccctggggccgccc-------
A0A2K5UDI5_BCL2-01      --atgcgggggatg--tgggcgcggcgacccctggggccgccc-------
A0A2K6CIX3_BCL2-01      --atgcgggggatg--tgggcgcggcgacccctggggccgccc-------
A0A096MPU7_BCL2-01      --atgcgggggat-----ggcgcggcgacccctggggccgccc-------
H2NWH5_BCL2-01          --atgcgggagatg--tgggcgccgcgcccccgggggccgcca-------
P10415_BCL2-04          --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
G3QES9_BCL2-01          --atgcgggagatg--tgggcgccgtgcccccgggggccgccc-------
A0A2I3GZF9_BCL2-01      --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
A9QXG9_BCL2-01          --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
P10415_BCL2-01          --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
P10415_BCL2-02          --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
H2QEM8_BCL2-01          --atgcgggagatg--tgggcgccgcgcccccgggggccgccc-------
A0A2R9APW6_BCL2-01      --atgcgggagatg--tgggcgccgcgccc--------------------
U3KEW4_BCL2-01          --ctgccggcgagcacagggcacccctgcctccaggtctctctgctcctg
H0YUX3_BCL2-01          --ctgccggcgaggacagggcatccctgcctccagatcactccgcttctg
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --ccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctg
Q00709_BCL2-02          --ccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctg
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          caatacgggagtggaggactcctctccgagctctgacaggaggctccagg
Q564A4_BCL2-01          caataaagcagtggaggaatcctctccaaactctgacaggaggcttcagg
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          atatggataacggatcccagggttccacgtctcccccggacagccccgtg
F7ETY1_MCL1-01          atattgatggcggctcccagggttctagctcccccccggacagccctgtg
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          agagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgta
D2ITA0_MCL1-04          agagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgta
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ---------------------------gcactggattacaaagcaaacca
F8W4Q8_MCL1-01          ---------------------------gcactggattacaaagcaaacca
Q568W5_MCL1-01          ---------------------------gcactggattacaaagcaaacca
A0A087YBW4_BCL2L1-      ------------------------------------gtccgaggccgacg
M4A558_BCL2L1-01        ------------------------------------gtccgaggttgccg
A0A0F7L1T6_BCL2L1-      ------------------------------------accagaggatactg
H2U5I3_BCL2L1-01        ------------------------------------accagaggatactg
H2U5I3_BCL2L1-02        ------------------------------------accagaggatactg
G3P7B4_BCL2L1-01        ------------------------------------gccggaggatgccg
E6ZFR0_BCL2L1-01        ------------------------------------gccggagaatgccg
A0A0B4KJI5_BCL2L1-      ------------------------------------gccagatgatgctg
Q568V1_MCL1-01          ------------cctctgaagcggcttagacctggtacaaacggcctgaa
Q1L8X3_MCL1-01          ------------cctctgaagcggcttagaccgggtacaaacggcctgaa
Q9I9N3_MCL1-01          ------------cctctgaagcggcttagaccgggtacaaacggcctgaa
A0A1X9JZA1_BCL2-01      -------------------------------------gcagatgccggta
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          -----------------------------------acgctgaagctgttg
H3AR18_MCL1-02          -----------------------------------acgctgaagctgttg
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        -----------------------------aacaggactgagttggcttcc
K7F655_BCL2L1-01        -----------------------------atcaggactgaggctgcagaa
G1N5N5_BCL2L1-01        -----------------------------aacaggactgacactgcagca
Q07816_BCL2L1-03        -----------------------------aacaggactgacactgcagct
Q07816_BCL2L1-01        -----------------------------aacaggactgacactgcagct
Q07816_BCL2L1-02        -----------------------------aacaggactgacactgcagct
U3JSL7_BCL2L1-01        -----------------------------aacaggactgactttgcaggg
Q4U2V6_BCL2L1-01        -----------------------------aacaggactgactttgcaggg
H0Z8G3_BCL2L1-01        -----------------------------aacaggactgactttgcaggg
F6WA14_BCL2L1-01        -----------------------------aacaggactgaggttctagaa
G3WKX6_BCL2L1-01        -----------------------------aacaggactgaggcctcagaa
W5PSA5_BCL2L1-01        -----------------------------aacagaactgagaccctagaa
G3SPN0_BCL2L1-01        -----------------------------aataggactggggcctcggaa
H0X6V2_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
P53563_BCL2L1-04        -----------------------------aacaggactgaagccccagaa
P53563_BCL2L1-02        -----------------------------aacaggactgaagccccagaa
P53563_BCL2L1-03        -----------------------------aacaggactgaagccccagaa
P53563_BCL2L1-01        -----------------------------aacaggactgaagccccagaa
O35843_BCL2L1-01        -----------------------------aataggactgaggccccagaa
Q64373_BCL2L1-09        -----------------------------aataggactgaggccccagaa
Q64373_BCL2L1-01        -----------------------------aataggactgaggccccagaa
Q64373_BCL2L1-03        -----------------------------aataggactgaggccccagaa
Q64373_BCL2L1-04        -----------------------------aataggactgaggccccagaa
B2Z3Z4_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A1U7QU73_BCL2L1-      -----------------------------aacaggactgaggccccagaa
Q9MYW4_BCL2L1-01        -----------------------------aacaggactgaggccccggaa
A0A1S3EPX7_BCL2L1-      -----------------------------agcaggactgaggacccagaa
O77737_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
A0A286Y5D6_BCL2L1-      -----------------------------aacaggactgaaggcccagaa
G1P9D2_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
Q05KJ0_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
Q9MZS7_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
A0A1S2ZQT6_BCL2L1-      -----------------------------aacagaactgaggcctcagaa
A0A1L5BWY3_BCL2L1-      -----------------------------aataggactgaggccccagaa
A0A287CZ07_BCL2L1-      -----------------------------aacaggactgaagccccagaa
I3MUP5_BCL2L1-03        -----------------------------aacaggactgaagccccagaa
I3MUP5_BCL2L1-02        -----------------------------aacaggactgaagccccagaa
I3MUP5_BCL2L1-01        -----------------------------aacaggactgaagccccagaa
F6WQI0_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
E2IV76_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A2K6G3C5_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6G3C5_BCL2L1-      -----------------------------aacaggactgaggccccagaa
G1RER8_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A2J8VIH3_BCL2L1-      -----------------------------aacaggactgaggccccagaa
Q07817_BCL2L1-03        -----------------------------aacaggactgaggccccagaa
Q07817_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
Q07817_BCL2L1-02        -----------------------------aacaggactgaggccccagaa
G3RY91_BCL2L1-02        -----------------------------aacaggactgaggccccagaa
G3RY91_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A2K5H963_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5H963_BCL2L1-      -----------------------------aacaggactgaggccccagaa
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5M8B1_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6LPM4_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6QFA2_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5VPG2_BCL2L1-      -----------------------------aacaggactgaggccccagaa
F6UKR4_BCL2L1-02        -----------------------------aacaggactgaggccccagaa
A0A2K5YR37_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5YR37_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5VPG2_BCL2L1-      -----------------------------aacaggactgaggccccagaa
F6UKR4_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A0D9RJZ8_BCL2L1-      -----------------------------aacaggactgaggccccagaa
I7GKS6_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A2K6LPM4_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6QFA2_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6QFA2_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5YR37_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K6UWY8_BCL2L1-      -----------------------------aacaggactgaggccccagaa
E2IV77_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
A0A2K6UWY8_BCL2L1-      -----------------------------aacaggactgaggccccagaa
F7IT34_BCL2L1-02        -----------------------------aacaggactgaggccccagaa
F7IT34_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
F7IT34_BCL2L1-03        -----------------------------aacaggactgaggccccagaa
A0A2K5EBP4_BCL2L1-      -----------------------------aacaggactgaggccccagaa
A0A2K5EBP4_BCL2L1-      -----------------------------aacaggactgaggccccagaa
E2IV75_BCL2L1-01        -----------------------------aacaggactgaggccccagaa
M3Z2H9_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
M3XA94_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
Q76LT7_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
Q8SQ42_BCL2L1-01        -----------------------------aacagaactgaggccccagaa
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       ---------------------------------agacggcgcggctggta
H3ANS8_BCL2L1-01        gttggtgagcaggaccacggtg------------gtggaggagaccgcgc
D2ITA2_BCL2L1-02        actggtgttcttcttcct-----------------------aagccataa
C1BLI0_BCL2L1-01        --gaattatcctatttct----------cagttgggactggaagatgcca
A0A287APJ6_BCL2-01      acaggtggtgctttgtatatca----------------------------
A0A286MU87_BCL2L1-      cccagaggaattattcatgttgt-----caattggggctggagggtgcaa
C0HAD8_BCL2L1-01        cccagaggaattattcatgttgt-----caattggggctggagggtgcaa
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        gccagc----------------------aaacgagacgggga--------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ctccacgtcgcggcccgtcgctctgtggagccccgaggaggagttggacg
A0A1L1RNM6_MCL1-02      ctccacgtcgcggcccgtcgctctgtggagccccgaggaggagttggacg
A0A286XUI2_BCL2A1-      gctggcagtctcgatct---------------------------------
I3J363_BCL2L10-01       actacctgtccttttgctgcac----------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          gccgtcttccaccccctcgccggacaaagagatggcggaggaggaaggag
R4GAJ0_MCL1-01          gccgtcttccaccccctcgccggacaaagagatggcggaggaggaaggag
H2MBQ3_BCL2L10-01       -ctggattacctgtccctg-------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      tccacctgcgctgctca---------------------------------
M4AUW7_BCL2L10-01       tccgcctgcgctgctca---------------------------------
D2IT42_BCL2L10-02       acctgttgtcctgcact---------------------------------
F6ZMX1_MCL1-01          gccctcccgcctggctgtgctg------gaaatagcccgggaaggtgggg
G3WBC5_MCL1-01          gcccgctcgcctggccatgctg------cccttggccagagagggtgggg
H0XHA5_MCL1-01          accggagggcctgcctttgctg------gagtttgttggtgaggccggta
G1QAV8_MCL1-01          gccggctgtcctgcccttgctc------cagctggtcggggaggccagcg
G1PZ39_MCL1-01          gccggccgtcctgcccttggtg------cagctggtcggggaggccagcg
Q9Z1P3_MCL1-01          cccggcggtgctgcccctactg------gagcgcgtgagcgaggcggcta
P97287_MCL1-02          cccggccgtgctgcccctcctg------gagcgcgtgagcgaggcggcca
P97287_MCL1-01          cccggccgtgctgcccctcctg------gagcgcgtgagcgaggcggcca
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      gccggccgtgctgcccttgctg------gggctggtgggggaggccggga
G1T2Q0_MCL1-02          gccggccgtcctgcccctgctg------gacttggtgggggaggccagta
G1T2Q0_MCL1-01          gccggccgtcctgcccctgctg------gacttggtgggggaggccagta
A0A287DCH9_MCL1-01      gccggcggtcctgcccttgctg------gagctcgttggagaggccgcca
A0A287DCH9_MCL1-02      gccggcggtcctgcccttgctg------gagctcgttggagaggccgcca
G3T756_MCL1-01          gccggctgtttttccccggctg------gggctggtcggggaggccagta
W5QI41_MCL1-01          ccctgccgtccggcctttacct------ttgatggtcggagaagccagta
A5PJR2_MCL1-01          gcctgccgtccggcctttacct------ttgttggtcggagaagccagta
F1MQX4_MCL1-01          gcctgccgtccggcctttacct------ttgttggtcagagaagccagta
A0A1S3F3I1_MCL1-01      gccggccgtcctgcccctgctg------gagctggtcggggaagccagta
J9PBC4_MCL1-01          gccggcggtcctgcctctgctg------gagttggtgggggaggccagca
J9PBC4_MCL1-02          gccggcggtcctgcctctgctg------gagttggtgggggaggccagca
Q8HYS5_MCL1-01          gccggcggtcctgcctctgctg------gagctggtgggggaggccagca
M3XAP4_MCL1-02          gccggctgtcctgcctttgctg------gagttggtcggggaggccagca
Q7YRZ9_MCL1-01          gccggctgtcctgcctttgctg------gagttggtcggggaggccagca
M3XAP4_MCL1-01          gccggctgtcctgcctttgctg------gagttggtcggggaggccagca
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          gccggctgtcctgcccttgctg------gagtttgtccgggaggccagca
G1L3M8_MCL1-01          gccggctgtcctgcctttgctg------gagttggtcggggaggccagcg
G1L3M8_MCL1-02          gccggctgtcctgcctttgctg------gagttggtcggggaggccagcg
M3XZZ5_MCL1-01          gcctgctgtcctgcctttgctg------gagttggtgggggaggccagca
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gccggccgtcctgcccttgctg------gggttagtcgaggaggccagta
K9IWB2_MCL1-01          gccggccgtcctgcccttgctg------gggttagtcgaggaggccagta
K9IWB2_MCL1-03          gccggccgtcctgcccttgctg------gggttagtcgaggaggccagta
A0A2K5C7L5_MCL1-01      gccggctgtcctgcccctgctg------gagttggtggaggagcctggta
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          gccggcggtcctgcctttgctg------gagttggtcggggaggccagta
A0A2K6GI15_MCL1-01      gccggctgtcctgcctttgctg------gagttggtcggggaggccagta
A0A2K6GI15_MCL1-02      gccggctgtcctgcctttgctg------gagttggtcggggaggccagta
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          gccggctgtcctgcctctgctg------gagttggtcggggaatctggta
A0A2K5I9Q7_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatc---ta
A0A2K5I9Q7_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatc---ta
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K6PPL1_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K6KRW9_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K6PPL1_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2I3GB35_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5XSC7_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5W0W9_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K6ECR0_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2I3M3D6_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5LXU8_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
I7G687_MCL1-01          gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5W0W9_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggaatctggta
A0A2R9BYH6_MCL1-02      gccggctgtcctgcctctgctg------gagttggtcggggaatctggta
K7DE58_MCL1-02          gccggctgtcctgcctctgctg------gagttggtcggggaatctggta
Q07820_MCL1-03          gccggctgtcctgccgctgctg------gagttggtcggggaatctggta
K7DE58_MCL1-01          gccggctgtcctgcctctgctg------gagttggtcggggaatctggta
A0A2R9BYH6_MCL1-01      gccggctgtcctgcctctgctg------gagttggtcggggaatctggta
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          gccggctgtcctgccgctgctg------gagttggtcggggaatctggta
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          gccggctgtcctgccgctgctg------gagttggtcggggaatctggta
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          gccggctgtcctgccgctgctg------gagttggtcggggaatctggta
B4DG83_MCL1-01          gccggctgtcctgccgctgctg------gagttggtcggggaatctggta
A0A2K6V5Y3_MCL1-02      gccggctgtcctgcccctgctg------gagctggtcggggagcctggtc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gccggctgtcctgcccctgctg------gagctggtcggggagcctggtc
A0A2K5CFH3_MCL1-03      gccggctgtcctgcccctgctg------gagttggtcggggagcctggta
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gccggctgtcctgcccctgctg------gagttggtcggggagcctggta
F7GTF7_MCL1-01          gccggctgtcctgcctctgctg------gagttggtcggggagcctgcta
F7GTF7_MCL1-02          gccggctgtcctgcctctgctg------gagttggtcggggagcctgcta
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          ctgctgctattagtaattattctgatgatggagaaatgcctgctgcttcc
F7BXJ7_BCL2-01          ctgctgctattagtaattattctgatgatggagaaatgcctgctgcttcc
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          ---------------------------ctgccgtccacattagcctctca
H2MLZ3_MCL1-02          ---------------------------ctgccgtccacattagcctctca
Q0KFR9_MCL1-01          ---------------------------------ccatatgtgctggggcg
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      ---------------------------aagaaacgcccgacgaatctcgc
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      -----------------------------tctacacccaacacccccgaa
H9GPE7_BCL2-01          ------------------------------------------aattctga
Q4SW32_MCL1-01          --------------------gtggtcaaacccaaggtctgcctgtcgaag
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          ---------------------------------tggtgggcccctcc---
A0A2U9CJ81_MCL1-01      -------------------------------------aagaacctccagg
G3PJT0_MCL1-01          ------------------------------gcgccctcggggtgaac---
W5MMB7_MCL1-01          ------------------------------ccatgctcaaggcggac---
F6YNL8_BCL2-01          ttgcttctgccc------------------ctgctgttggaatcttc---
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          ttgcttctgccc------------------ctgctgttggaatcttc---
K7F5Y4_BCL2-02          ------------------------------ctgctgctgggacccca---
K7F5Y4_BCL2-01          ------------------------------ctgctgctgggacccca---
K7F5Y4_BCL2-03          ------------------------------ctgctg--------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          ------------------------------ccacccctggcatcttc---
P49950_BCL2-01          ------------------------------ccacccctggcatcttc---
P10417_BCL2-01          ------------------------------ccacccctggcatcttc---
Q7TSN8_BCL2-01          ------------------------------ccacccctggcatcttc---
P10417_BCL2-02          ------------------------------ccacccctggcatcttc---
Q6R755_BCL2-01          ------------------------------ccacccctggcatcttc---
Q9JJV8_BCL2-01          ------------------------------ccacccctggcatcttc---
Q923R6_BCL2-01          ------------------------------ccacccctggcatcttc---
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          ------------------------------ccgcgccgggcgtcctc---
F6R2C4_BCL2-01          ------------------------------ccgcgccgggcatcctg---
O02718_BCL2-01          ------------------------------ccgcgccgggcatcctg---
A0A076FU27_BCL2-01      ------------------------------ccgcgccgggcatcctg---
A0A076FZV9_BCL2-01      ------------------------------ccgcgccgggcatcctg---
G1TW27_BCL2-01          ------------------------------ccgcgccgggcgtcttc---
I3MVK9_BCL2-01          ------------------------------ccgggccgggcatcttc---
M3YYK3_BCL2-01          ------------------------------cccccccaccccccctc---
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          ------------------------------ccgtgccgggcatcttc---
A0A287APJ6_BCL2-03      ------------------------------ccgcaccgggcatcttc---
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          ------------------------------ccgcgccgggcatcttc---
J9NXG3_BCL2-01          ------------------------------ccgcgccgggcatctcc---
J9NXG3_BCL2-02          ------------------------------ccgcgccgggcatctcc---
Q75SV7_BCL2-01          ------------------------------ccgcgccgggcatcttc---
H0WKI0_BCL2-01          ------------------------------ctgcgccgggcgtcttc---
A0A2K6G3I7_BCL2-01      ------------------------------ccacgccgggcatcttc---
A0A2K5EB04_BCL2-01      ------------------------------ccgcgccgggcatcttc---
A0A1D5QRF2_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K6UEL3_BCL2-01      ------------------------------ccgcgccgggcatcttc---
A0A2R8MY14_BCL2-01      ------------------------------ccgcggagggcatcttc---
A0A2K6R2I6_BCL2-02      ------------------------------ccgcaccgggcatcttc---
A0A2K5HK49_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K6KHG1_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K6R2I6_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K5XRD4_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K5NZS5_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A0D9S017_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K5UDI5_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A2K6CIX3_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A0A096MPU7_BCL2-01      ------------------------------ccgcaccgggcatcttc---
H2NWH5_BCL2-01          ------------------------------ccgcacccggcatcttc---
P10415_BCL2-04          ------------------------------ccgcaccgggcatcttc---
G3QES9_BCL2-01          ------------------------------ccgcaccgggcatcttc---
A0A2I3GZF9_BCL2-01      ------------------------------ccgcaccgggcatcttc---
A9QXG9_BCL2-01          ------------------------------ccgcaccgggcatcttc---
P10415_BCL2-01          ------------------------------ccgcaccgggcatcttc---
P10415_BCL2-02          ------------------------------ccgcaccgggcatcttc---
H2QEM8_BCL2-01          ------------------------------ccgcaccgggcatcttc---
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          ctgctgctgcggttgc------------tgctgctgctgggacttcc---
H0YUX3_BCL2-01          ctgctgctgcgattgctgctgctgcgattgctgctgctgggact------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ctgctcccgctgcggt------------ggctgctgctggagcctcc---
Q00709_BCL2-02          ctgctcccgctgcggt------------ggctgctgctggagcctcc---
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          ctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgg
Q564A4_BCL2-01          ctccctcagccggcggagggaacaactctgaatgcctgatagc---ccgg
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          tgccctaaggatggattatatatggacacccagcagctcattctcgcttt
F7ETY1_MCL1-01          tgcccgaaggatggattatatatggacacccagcagctcatcctggcttt
J7H260_MCL1-01          ----------------------tcccctccgctcacccccacctgctccc
D2ITA0_MCL1-03          aaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaa
D2ITA0_MCL1-04          aaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaa
F8W4Q8_MCL1-02          ------------------------------------------gattctct
Q8UWD6_MCL1-01          ctggttattccagaactgaaagcgcataaccagtttgcggtggactctct
F8W4Q8_MCL1-01          ctggttattccagaactgaaagcgcataaccagtttgcggtggactctct
Q568W5_MCL1-01          ctggttattccagaactgaaagcgcataaccagtttgcggtggactctct
A0A087YBW4_BCL2L1-      gggccaggaccaattgggatggggacagccggggccctagcaatggtccg
M4A558_BCL2L1-01        ggggcaggaccaattgggaaggggacagccgggtccctagcaatggccgg
A0A0F7L1T6_BCL2L1-      atggaaggacagagggagaaaagaggagccccgctgcttccaatggcctg
H2U5I3_BCL2L1-01        atggaaggacagagggagaaaagaggagccccggtgcttccaatggcctg
H2U5I3_BCL2L1-02        atggaaggacagagggagaaaagaggagccccggtgcttccaatggcctg
G3P7B4_BCL2L1-01        gcggaaggacggagggagacaaggccaactcggcgtccg--------ttc
E6ZFR0_BCL2L1-01        gtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttg
A0A0B4KJI5_BCL2L1-      gtggaaggactgaggcagacaaagccaactcagctgccacaaatggcctg
Q568V1_MCL1-01          ggggctgcagctggacggtcgatttgtttctacgacagacggatctctac
Q1L8X3_MCL1-01          ggggctgcagctggacggtcgatttgtttctgcgacagacggatctctac
Q9I9N3_MCL1-01          ggggctgcagctggacggtcgatttgtttctgcgacagacggatctctac
A0A1X9JZA1_BCL2-01      ataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgt
Q6GLI5_BCL2L1-01        ------------------------------gttctccagcaactcccagc
Q2TAP5_BCL2L1-01        ------------------------------gttctccaataatccccaac
Q91828_BCL2L1-01        ------------------------------gttctccaataat-cccaac
H3AR18_MCL1-01          cggagttacttgtgcgaggtggcgggctgcgagagcacggagacggcctt
H3AR18_MCL1-02          cggagttacttgtgcgaggtggcgggctgcgagagcacggagacggcctt
F6S8G3_BCL2A1-01        -----------------gacggtgtattctggtccgtccgagccctggct
U3IS71_BCL2L1-01        gaggccgc---------cgcggtg---------ctcaacgggagcccctc
K7F655_BCL2L1-01        gaggcg------------gagatggcaagcgtccctaatgggagtccatc
G1N5N5_BCL2L1-01        gaggca------------gagatggacagcgtcctcaatgggagcccatc
Q07816_BCL2L1-03        gaggca------------gagatggacagcgtcctcaatgggagcccatc
Q07816_BCL2L1-01        gaggca------------gagatggacagcgtcctcaatgggagcccatc
Q07816_BCL2L1-02        gaggca------------gagatggacagcgtcctcaatgggagcccatc
U3JSL7_BCL2L1-01        gaggagga---------cgagatggacggcgtgctcaacggaagcccctc
Q4U2V6_BCL2L1-01        gaggagga---------cgagatggacggggtcctcaacgggagcccctc
H0Z8G3_BCL2L1-01        gaggagga---------cgagatggacggggtcctcaacgggagcccctc
F6WA14_BCL2L1-01        ggggc------------agagatacctagtactgtgaatggcagtccctc
G3WKX6_BCL2L1-01        gggac------------agagatacctagtactgtgaatggcagcccctc
W5PSA5_BCL2L1-01        gggacagaatcagatatggaaacccccagtgccatcagtggcaacccatc
G3SPN0_BCL2L1-01        ggcactgaatccgagatggagatccccagtgccatcaatggcaacccatc
H0X6V2_BCL2L1-01        gggaatgaatcagagctggagacccccagtgccattaatggcaacccatc
P53563_BCL2L1-04        gaaactgaaccagaaagggagacccccagtgccatcaatggcaacccatc
P53563_BCL2L1-02        gaaactgaaccagaaagggagacccccagtgccatcaatggcaacccatc
P53563_BCL2L1-03        gaaactgaaccagaaagggagacccccagtgccatcaatggcaacccatc
P53563_BCL2L1-01        gaaactgaaccagaaagggagacccccagtgccatcaatggcaacccatc
O35843_BCL2L1-01        gaaactgaagcagagagggagacccccagtgccatcaatggcaacccatc
Q64373_BCL2L1-09        gaaactgaagcagagagggagacccccagtgccatcaatggcaacccatc
Q64373_BCL2L1-01        gaaactgaagcagagagggagacccccagtgccatcaatggcaacccatc
Q64373_BCL2L1-03        gaaactgaagcagagagggagacccccagtgccatcaatggcaacccatc
Q64373_BCL2L1-04        gaaactgaagcagagagggagacccccagtgccatcaatggcaacccatc
B2Z3Z4_BCL2L1-01        ggaactgaatcagagagggagacccccagtgccatcaatggcaacccatc
A0A1U7QU73_BCL2L1-      ggagccgaatcagagagggagacccccagtgccatcaatggcaacccatc
Q9MYW4_BCL2L1-01        gggactggaccagagatggagacccccagtgccatcaatggcaacccagc
A0A1S3EPX7_BCL2L1-      ggaactgaatcggagatggagacccccagtgctatcaatggcaacccatc
O77737_BCL2L1-01        gggactgaatcagaagcggaaacccctagtgccatcaatggcaacccatc
A0A286Y5D6_BCL2L1-      gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
G1P9D2_BCL2L1-01        gggactgaatcagaggtggagacccccagtgccatcaatggcaacccatc
Q05KJ0_BCL2L1-01        gggacagaatcagatatggaaacccccagtgccatcaatggcaacgcatc
Q9MZS7_BCL2L1-01        gggacagaatcagatatggaaacccccagtgccatcaatggcaacccatc
A0A1S2ZQT6_BCL2L1-      ggaactgaatcagagatggaaacacccagtgccatcaatggcaacccatc
A0A1L5BWY3_BCL2L1-      gggattgaatcagaggtggagacccccagtgccatcaatggcaacccatc
A0A287CZ07_BCL2L1-      gggactgaatcagaggtggagacccccagtgccatcaatggcaacccatc
I3MUP5_BCL2L1-03        gggactgaatcagaggtggagacccccagtgccatcaatggcaacccatc
I3MUP5_BCL2L1-02        gggactgaatcagaggtggagacccccagtgccatcaatggcaacccatc
I3MUP5_BCL2L1-01        gggactgaatcagaggtggagacccccagtgccatcaatggcaacccatc
F6WQI0_BCL2L1-01        gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
E2IV76_BCL2L1-01        gggactgaatcggagatggaaacccccagtgccattaatggcaacccatc
A0A2K6G3C5_BCL2L1-      gcgactgaatcggagatggagacccccagtgccattaatggcaacccatc
A0A2K6G3C5_BCL2L1-      gcgactgaatcggagatggagacccccagtgccattaatggcaacccatc
G1RER8_BCL2L1-01        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2J8VIH3_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
Q07817_BCL2L1-03        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
Q07817_BCL2L1-01        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
Q07817_BCL2L1-02        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
G3RY91_BCL2L1-02        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
G3RY91_BCL2L1-01        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5H963_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5H963_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
Q2PFS6_BCL2L1-01        ---------------atggagacccccagtgccatcaatggcaacccatc
A0A2K5M8B1_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5M8B1_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6LPM4_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6QFA2_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5VPG2_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
F6UKR4_BCL2L1-02        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5YR37_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5YR37_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5VPG2_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
F6UKR4_BCL2L1-01        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A0D9RJZ8_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
I7GKS6_BCL2L1-01        gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6LPM4_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6QFA2_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6QFA2_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5YR37_BCL2L1-      gggactgaatcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K6UWY8_BCL2L1-      gggactgattcggagatggagacccccagtgccatcaatggcaacccagc
E2IV77_BCL2L1-01        gggactgattcggagatggagacccccagtgccatcaatggcaacccagc
A0A2K6UWY8_BCL2L1-      gggactgattcggagatggagacccccagtgccatcaat-----------
F7IT34_BCL2L1-02        gggactgattcggagatggagacccccagtgccatcaatggcaacccatc
F7IT34_BCL2L1-01        gggactgattcggagatggagacccccagtgccatcaatggcaacccatc
F7IT34_BCL2L1-03        gggactgattcggagatggagacccccagtgccatcaatggcaacccatc
A0A2K5EBP4_BCL2L1-      gggactgattcggagatggagacccccagtgccatcaat-----------
A0A2K5EBP4_BCL2L1-      gggactgattcggagatggagacccccagtgccatcaatggcaacccatc
E2IV75_BCL2L1-01        gggactgattcggagatggagacccccagtgccatcaatggcaacccatc
M3Z2H9_BCL2L1-01        gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
M3XA94_BCL2L1-01        gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
Q76LT7_BCL2L1-01        gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
Q8SQ42_BCL2L1-01        gggactgaatcagagatggagacccccagtgccatcaatggcaacccatc
H3AAS7_BCL2L2-01        ----------tcggccagaaggggtactctcagcagggtg----ccccaa
H3AAS7_BCL2L2-02        ----------tcggccagaaggggtactctcagcagggtg----ccccaa
F6VJQ0_BCL2L10-01       a---------------------ctgactacctggaatattgt--tgccgg
H3ANS8_BCL2L1-01        gagggaagcacagactcccgaggagggggccattccaggcatggacccac
D2ITA2_BCL2L1-02        actgtctcagaggaattacaggcctattcccttccagcccgagggggcag
C1BLI0_BCL2L1-01        gtgaa--------------cggactaatgttgacaagaccaa--tgtctc
A0A287APJ6_BCL2-01      ---------------------gttgatgtgtctcaagactat--agccaa
A0A286MU87_BCL2L1-      gtgga-----------------------------------------cgga
C0HAD8_BCL2L1-01        gtgga-----------------------------------------cgga
G1QEX2_BCL2L10-01       ---------------------------ttcctggaacaccgc--acccga
W5QIG4_BCL2L10-01       -------------------cggcactccagctcctgcgccgt--ccacgc
E1B9B3_BCL2L10-01       -------------------gggcactccagctcctgcgccgt--ccacgc
F1MV39_BCL2L10-01       -------------------gggcactccagctcctgcgccgt--ccacgc
H9GHK7_BCL2L1-01        --------acaccctcaatgggagcccttcttggcatcccag--ccccag
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gctgcgagcccgagtccgaacgcggccccggaggcgattcgt--tgcccg
A0A1L1RNM6_MCL1-02      gctgcgagcccgagtccgaacgcggccccggaggcgattcgt--tgcccg
A0A286XUI2_BCL2A1-      --------gcgcgagccagcagcaggctgctgtc--tgccgc--cc----
I3J363_BCL2L10-01       -------------------gagtccacatcaagcccctccac--ctccca
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          agaaa-----gggaaaggagggccccctctcttcccgg--ac--cacctg
R4GAJ0_MCL1-01          agaaa-----gggaaaggagggccccctctcttcccgg--ac--cacctg
H2MBQ3_BCL2L10-01       -----------agctgcaggagcccactccaggcccccccac--ctccca
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------agcccacacccagcccctccac--ctccca
M4AUW7_BCL2L10-01       --------------------agcccacacccagcccctccac--ctccca
D2IT42_BCL2L10-02       --------gcaagcacagg-----cacagccc----cgccgc--ctccca
F6ZMX1_MCL1-01          acagcccga---------acggctctttgccttcgacgccgc--ccccag
G3WBC5_MCL1-01          acacatcgagcaatgcccgcggctcactgccctcaacgccgc--ccccgg
H0XHA5_MCL1-01          acggc---cccagcactgaca---cacttccttccacacctc--ccccag
G1QAV8_MCL1-01          aaggc---cccg---caggtggctcactgccctcgaccccgc--cccctg
G1PZ39_MCL1-01          gcggc---cccggcgcggggggctcgctgccctccacgccgc--cccccg
Q9Z1P3_MCL1-01          agagc---tccggagctgacggctcgctgccctccacgccgc--cgccgc
P97287_MCL1-02          agagc---tccggggccgacggctctctgccctccacgccgc--cgccgc
P97287_MCL1-01          agagc---tccggggccgacggctctctgccctccacgccgc--cgccgc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      agagc---cccagcgccgacggttcgctgccctcgacgccgc--ccccgg
G1T2Q0_MCL1-02          aggtc---cctagcacggacgggtcgctgccctcgacgccgc--cgcccg
G1T2Q0_MCL1-01          aggtc---cctagcacggacgggtcgctgccctcgacgccgc--cgcccg
A0A287DCH9_MCL1-01      agagt---cccggcgcggacgggtcgctgccctcgacgccgc--cgcccg
A0A287DCH9_MCL1-02      agagt---cccggcgcggacgggtcgctgccctcgacgccgc--cgcccg
G3T756_MCL1-01          atggc---cccggtaccgacgggtcactaccctcgacgccgc--ccctag
W5QI41_MCL1-01          acaacagtccaggctcggacggctcgctgccctcgacgccgc--ccccat
A5PJR2_MCL1-01          acaacagtccaggctcggacggctcgctgccctcgacgccgc--ccccag
F1MQX4_MCL1-01          acaacagtccaggctcggacggctcgctgccctcgacgccgc--ccccag
A0A1S3F3I1_MCL1-01      agagc---tcgcgcacggacggctcgctcccttccacgccgc--ctccag
J9PBC4_MCL1-01          gtggc---cccggcatggacggctcgctaccctcgacgccac--ccccgg
J9PBC4_MCL1-02          gtggc---cccggcatggacggctcgctaccctcgacgccac--ccccgg
Q8HYS5_MCL1-01          gtggc---cccggcatggacggctcgctaccctcgacgccac--ccccgg
M3XAP4_MCL1-02          gtggc---cccggcacagacggctcactgccctcgacgccac--ccccag
Q7YRZ9_MCL1-01          gtggc---cccggcacagacggctcactgccctcgacgccac--ccccag
M3XAP4_MCL1-01          gtggc---cccggcacagacggctcactgccctcgacgccac--ccccag
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          gtggc---ccctgcacggacggctcgctcccctcgacgccgc--ccccag
G1L3M8_MCL1-01          gtggc---ccttgtacggacggctcactgccctcgacgccac--ccccag
G1L3M8_MCL1-02          gtggc---ccttgtacggacggctcactgccctcgacgccac--ccccag
M3XZZ5_MCL1-01          gtggc---ccctgcacggacggctcactgccctcgacgccac--ccccag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gtggc---cccggcacggacggctcgctcccctcgacgccgc--ccccgg
K9IWB2_MCL1-01          gtggc---cccggcacggacggctcgctcccctcgacgccgc--ccccgg
K9IWB2_MCL1-03          gtggc---cccggcacggacggctcgctcccctcgacgccgc--ccccgg
A0A2K5C7L5_MCL1-01      atgac---tccagtacggatgggtcactaccctcgacgccgc--cgaca-
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          acggc---cccagcactgatgggtcacttccttcgacaccgc--ccccag
A0A2K6GI15_MCL1-01      atggc---tccagcacggacgggtcactaccctcgacgccgc--ccccag
A0A2K6GI15_MCL1-02      atggc---tccagcacggacgggtcactaccctcgacgccgc--ccccag
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2K5I9Q7_MCL1-02      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5I9Q7_MCL1-01      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K6PPL1_MCL1-02      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K6KRW9_MCL1-01      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K6PPL1_MCL1-01      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2I3GB35_MCL1-02      ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5XSC7_MCL1-02      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5W0W9_MCL1-01      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K6ECR0_MCL1-02      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2I3M3D6_MCL1-01      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5LXU8_MCL1-01      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      atagc---tccagtacggatgggtcactaccctcgacgccgc--cgccag
I7G687_MCL1-01          atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5W0W9_MCL1-02      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      atagc---cccagtacggatgggtcactaccctcgacgccgc--cgccag
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      atgac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      atgac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2R9BYH6_MCL1-02      ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
K7DE58_MCL1-02          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
Q07820_MCL1-03          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
K7DE58_MCL1-01          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2R9BYH6_MCL1-01      ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          ataac---accagtacggacgggtcactacccttgacgccgc--cgccag
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
B4DLY8_MCL1-01          -------------------------------------gccgc--cgc---
Q07820_MCL1-01          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
B4DG83_MCL1-01          ataac---accagtacggacgggtcactaccctcgacgccgc--cgccag
A0A2K6V5Y3_MCL1-02      atggc---tccagtacggacgggtcactcccctcgacgccgc--cgcccg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      atggc---tccagtacggacgggtcactcccctcgacgccgc--cgcccg
A0A2K5CFH3_MCL1-03      atggc---tccagtacggacgggtcactaccctcgacgccgc--ctccag
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      atggc---tccagtacggacgggtcactaccctcgacgccgc--ctccag
F7GTF7_MCL1-01          atggc---tccagtacggacgggtcactaccgtcgacgccgc--cgccag
F7GTF7_MCL1-02          atggc---tccagtacggacgggtcactaccgtcgacgccgc--cgccag
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          gcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctc
F7BXJ7_BCL2-01          gcagattcacgtggaccacctcaatcttcactcgcatctgctgctgcttc
Q90Z98_BCL2L1-01        ----------------------------------------cagaagac-a
Q90Z98_BCL2L1-02        ----------------------------------------cagaagac-a
H2SNZ8_BCL2L1-02        ---------------------------------------ttagagcct-c
H2SNZ8_BCL2L1-01        ---------------------------------------ttagagcct-c
H3CH49_BCL2L1-01        ----------------------------------------tagagcct-t
A0A059PJI5_BCL2L1-      ----------------------------------------cggaagag-g
B5XAY3_BCL2L1-01        ----------------------------------------cggaagcc-c
W5MG74_BCL2L1-01        ----------------------------------------ttcagcctgg
A0A087X9B7_BCL2L1-      ----------------------------------------atgagccc-c
A0A2U9BY16_BCL2L1-      ----------------------------------------atgagcct-c
A0A0D6DR75_BCL2L1-      ----------------------------------------gtgagcct-c
I3IZK7_BCL2L1-01        ----------------------------------------acgagcct-t
A0A219P0Y3_BCL2L1-      ----------------------------------------tagagcct-c
G3NJY1_BCL2L1-01        ----------------------------------------ccgagcct-c
C3VIT1_BCL2L1-01        ----------------------------------------atgagcct-c
H2MLZ3_MCL1-01          cgtggcaaaccccgacccgtccgatcagctcaaaagaccgcaggacct-c
H2MLZ3_MCL1-02          cgtggcaaaccccgacccgtccgatcagctcaaaagaccgcaggacct-c
Q0KFR9_MCL1-01          tcaccgaagtctaaagtggacttgggaaatgggactggcgatactcca-c
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      agtgtccgcatcgaatggatatgttgcaaaaagcctccagaagagcag-c
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      gtttttgcacggaggt------------cccagcccaccgccgcggtc-g
H9GPE7_BCL2-01          tcctgtgagtaccaat----------------------------------
Q4SW32_MCL1-01          accattcaggaggaca----------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          gcctcgggtccggggc---------------------tgcaggcgcgg-c
A0A2U9CJ81_MCL1-01      tctccgcaacgaaggc---------gtacgcggccaagagctgccggg-a
G3PJT0_MCL1-01          tccgc--------------------gaacggctacccatcaaaaccgc-a
W5MMB7_MCL1-01          tacgccgaggacgaactggacaactactcggcggagcccgtggcgacc-a
F6YNL8_BCL2-01          tctacccagccacgaa---------acacaccattgcctgctgaaccc-c
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          tctaaccagccaagac---------atacacctctgcctgctgcaccc-c
K7F5Y4_BCL2-02          tctgaccatgctgggc---------tggtgtctttgccgcctgaaccc-c
K7F5Y4_BCL2-01          tctgaccatgctgggc---------tggtgtctttgccgcctgaaccc-c
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------actgggtc---------gcaactccccgcttggtgtgccc-c
F1LNV0_BCL2-01          tccttccagcctgaga---------gcaaccggacgcccgctgtgcac-c
P49950_BCL2-01          tccttccagcctgaga---------gcaaccgaacgcccgctgtgcac-c
P10417_BCL2-01          tccttccagcctgaga---------gcaacccaatgcccgctgtgcac-c
Q7TSN8_BCL2-01          tccttccagcctgaga---------gcaacccaatgcccgctgtgcac-c
P10417_BCL2-02          tccttccagcctgaga---------gcaacccaatgcccgctgtgcac-c
Q6R755_BCL2-01          tccttccagcctgaga---------gcaacccaacgcccgctgtgcac-c
Q9JJV8_BCL2-01          tccttccagcctgaga---------gcaacccaacgcccgctgtgcac-c
Q923R6_BCL2-01          tccttccagcctgaga---------gcaacccaacgcccgctgtgcac-c
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          tcttctccgcc---------------------------cgcggcgccc-c
F6R2C4_BCL2-01          tcctcccagccgggcc---------gcacacccgcgccct----------
O02718_BCL2-01          tcctcccagccgggcc---------gcacacccgccccct----------
A0A076FU27_BCL2-01      tcctcccagccgggcc---------gcacacccgcgccct----------
A0A076FZV9_BCL2-01      tcctcccagccgggcc---------gcacacccgcgccct----------
G1TW27_BCL2-01          tcctcccagcccgcg---------------------cccgctgcgccc-c
I3MVK9_BCL2-01          tcttcccaaccgggga---------gc----------------------c
M3YYK3_BCL2-01          tcccgccaccgc--------------------------cg----------
G1LID1_BCL2-01          --------------------------------------cg----------
F7CDX6_BCL2-01          tcctcccagcccgggc---------gcacccccgcgcccg----------
A0A287APJ6_BCL2-03      tcctcccagcccgggc---------gaacccccgctcccg----------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          tcctcccagcccgggc---------gcacccctgcgcccg----------
J9NXG3_BCL2-01          gcctcgcagnnnnnnn---------nnnnnnnnnnnnnnnnnnnnnnn-n
J9NXG3_BCL2-02          gcct----------------------------------------------
Q75SV7_BCL2-01          tcctcgcagcccggcc---------gcgcccccgcgcccgccaggacc-t
H0WKI0_BCL2-01          tcctcccagcccgggc---------gcacccctactcccgctgcgccc-c
A0A2K6G3I7_BCL2-01      tcctcccagcccgggc---------gcaacccccctcccgctgcgcct-c
A0A2K5EB04_BCL2-01      tcctcccagcctggac---------acacgcccggtcccgccgcgccc-c
A0A1D5QRF2_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K6UEL3_BCL2-01      tcctcccagcccgggc---------acacgcccggtcccgctgcgccc-c
A0A2R8MY14_BCL2-01      tcttcccagcccgggc---------acacgcccggtcccgccgcgccc-c
A0A2K6R2I6_BCL2-02      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K5HK49_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K6KHG1_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K6R2I6_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K5XRD4_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K5NZS5_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A0D9S017_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K5UDI5_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A2K6CIX3_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
A0A096MPU7_BCL2-01      tcctcccagcccgggc---------acacgccccatcccgccgcgtcc-c
H2NWH5_BCL2-01          tcctcccagcccgggc---------acacgcctcatccagccgcatcc-c
P10415_BCL2-04          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
G3QES9_BCL2-01          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
A0A2I3GZF9_BCL2-01      tcctcccagccggggc---------acacgccccatccagctgcatcc-c
A9QXG9_BCL2-01          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
P10415_BCL2-01          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
P10415_BCL2-02          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
H2QEM8_BCL2-01          tcctcccagcccgggc---------acacgccccatccagccgcatcc-c
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          tctgatcacactgggc---------cggtgtctccgcaccccgagccc-c
H0YUX3_BCL2-01          tctgatcacactgggc---------tggtgtctccgcaccccgagccc-c
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          tcccaccac---------------------------cgccccgagccc-c
Q00709_BCL2-02          tcccaccac---------------------------cg-cccgagccc-c
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          gtca----------------------------------------------
Q564A4_BCL2-01          gtca----------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          c-------------------------------------------------
F7ETY1_MCL1-01          c-------------------------------------------------
J7H260_MCL1-01          cgga----------------------------------------------
D2ITA0_MCL1-03          gacg----------------------------------------------
D2ITA0_MCL1-04          gacg----------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ccag----------------------------------------------
F8W4Q8_MCL1-01          ccag----------------------------------------------
Q568W5_MCL1-01          ccag----------------------------------------------
A0A087YBW4_BCL2L1-      ctgg----------------------------------------------
M4A558_BCL2L1-01        ctgg----------------------------------------------
A0A0F7L1T6_BCL2L1-      ctgg----------------------------------------------
H2U5I3_BCL2L1-01        ctgg----------------------------------------------
H2U5I3_BCL2L1-02        ctgg----------------------------------------------
G3P7B4_BCL2L1-01        ctgg----------------------------------------------
E6ZFR0_BCL2L1-01        ctgg----------------------------------------------
A0A0B4KJI5_BCL2L1-      ctgg----------------------------------------------
Q568V1_MCL1-01          cgac----------------------------------------------
Q1L8X3_MCL1-01          cgac----------------------------------------------
Q9I9N3_MCL1-01          cgac----------------------------------------------
A0A1X9JZA1_BCL2-01      ggag----------------------------------------------
Q6GLI5_BCL2L1-01        ccaa----------------------------------------------
Q2TAP5_BCL2L1-01        ccaa----------------------------------------------
Q91828_BCL2L1-01        ccaa----------------------------------------------
H3AR18_MCL1-01          cagg----------------------------------------------
H3AR18_MCL1-02          cagg----------------------------------------------
F6S8G3_BCL2A1-01        ctgg----------------------------------------------
U3IS71_BCL2L1-01        ctgg----------------------------------------------
K7F655_BCL2L1-01        ctgg----------------------------------------------
G1N5N5_BCL2L1-01        ctgg----------------------------------------------
Q07816_BCL2L1-03        ctgg----------------------------------------------
Q07816_BCL2L1-01        ctgg----------------------------------------------
Q07816_BCL2L1-02        ctgg----------------------------------------------
U3JSL7_BCL2L1-01        ctgg----------------------------------------------
Q4U2V6_BCL2L1-01        ctgg----------------------------------------------
H0Z8G3_BCL2L1-01        ctgg----------------------------------------------
F6WA14_BCL2L1-01        ttgg----------------------------------------------
G3WKX6_BCL2L1-01        ttgg----------------------------------------------
W5PSA5_BCL2L1-01        ctgg----------------------------------------------
G3SPN0_BCL2L1-01        ccgg----------------------------------------------
H0X6V2_BCL2L1-01        ctgg----------------------------------------------
P53563_BCL2L1-04        ctgg----------------------------------------------
P53563_BCL2L1-02        ctgg----------------------------------------------
P53563_BCL2L1-03        ctgg----------------------------------------------
P53563_BCL2L1-01        ctgg----------------------------------------------
O35843_BCL2L1-01        ctgg----------------------------------------------
Q64373_BCL2L1-09        ctgg----------------------------------------------
Q64373_BCL2L1-01        ctgg----------------------------------------------
Q64373_BCL2L1-03        ctgg----------------------------------------------
Q64373_BCL2L1-04        ctgg----------------------------------------------
B2Z3Z4_BCL2L1-01        ctgg----------------------------------------------
A0A1U7QU73_BCL2L1-      ctgg----------------------------------------------
Q9MYW4_BCL2L1-01        ctgg----------------------------------------------
A0A1S3EPX7_BCL2L1-      ctgg----------------------------------------------
O77737_BCL2L1-01        ctgg----------------------------------------------
A0A286Y5D6_BCL2L1-      ctgg----------------------------------------------
G1P9D2_BCL2L1-01        ctgg----------------------------------------------
Q05KJ0_BCL2L1-01        ctgg----------------------------------------------
Q9MZS7_BCL2L1-01        ttgg----------------------------------------------
A0A1S2ZQT6_BCL2L1-      ctgg----------------------------------------------
A0A1L5BWY3_BCL2L1-      ctgg----------------------------------------------
A0A287CZ07_BCL2L1-      ctgg----------------------------------------------
I3MUP5_BCL2L1-03        ctgg----------------------------------------------
I3MUP5_BCL2L1-02        ctgg----------------------------------------------
I3MUP5_BCL2L1-01        ctgg----------------------------------------------
F6WQI0_BCL2L1-01        ctgg----------------------------------------------
E2IV76_BCL2L1-01        ctgg----------------------------------------------
A0A2K6G3C5_BCL2L1-      ct------------------------------------------------
A0A2K6G3C5_BCL2L1-      ctgg----------------------------------------------
G1RER8_BCL2L1-01        ctgg----------------------------------------------
A0A2J8VIH3_BCL2L1-      ctgg----------------------------------------------
Q07817_BCL2L1-03        ctgg----------------------------------------------
Q07817_BCL2L1-01        ctgg----------------------------------------------
Q07817_BCL2L1-02        ctgg----------------------------------------------
G3RY91_BCL2L1-02        ct------------------------------------------------
G3RY91_BCL2L1-01        ctgg----------------------------------------------
A0A2K5H963_BCL2L1-      ctgg----------------------------------------------
A0A2K5H963_BCL2L1-      ct------------------------------------------------
Q2PFS6_BCL2L1-01        ctgg----------------------------------------------
A0A2K5M8B1_BCL2L1-      ctgg----------------------------------------------
A0A2K5M8B1_BCL2L1-      ct------------------------------------------------
A0A2K6LPM4_BCL2L1-      ctgg----------------------------------------------
A0A2K6QFA2_BCL2L1-      ctgg----------------------------------------------
A0A2K5VPG2_BCL2L1-      ctgg----------------------------------------------
F6UKR4_BCL2L1-02        ctgg----------------------------------------------
A0A2K5YR37_BCL2L1-      ctgg----------------------------------------------
A0A2K5YR37_BCL2L1-      ctgg----------------------------------------------
A0A2K5VPG2_BCL2L1-      ctgg----------------------------------------------
F6UKR4_BCL2L1-01        ctgg----------------------------------------------
A0A0D9RJZ8_BCL2L1-      ctgg----------------------------------------------
I7GKS6_BCL2L1-01        ctgg----------------------------------------------
A0A2K6LPM4_BCL2L1-      ctgg----------------------------------------------
A0A2K6QFA2_BCL2L1-      ctgg----------------------------------------------
A0A2K6QFA2_BCL2L1-      ctgg----------------------------------------------
A0A2K5YR37_BCL2L1-      ctgg----------------------------------------------
A0A2K6UWY8_BCL2L1-      ctgg----------------------------------------------
E2IV77_BCL2L1-01        ctgg----------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        ctgg----------------------------------------------
F7IT34_BCL2L1-01        ctgg----------------------------------------------
F7IT34_BCL2L1-03        ctgg----------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ctgg----------------------------------------------
E2IV75_BCL2L1-01        ctgg----------------------------------------------
M3Z2H9_BCL2L1-01        ctgg----------------------------------------------
M3XA94_BCL2L1-01        ctgg----------------------------------------------
Q76LT7_BCL2L1-01        ctgg----------------------------------------------
Q8SQ42_BCL2L1-01        ctgg----------------------------------------------
H3AAS7_BCL2L2-01        cgga----------------------------------------------
H3AAS7_BCL2L2-02        cgga----------------------------------------------
F6VJQ0_BCL2L10-01       aggg----------------------------------------------
H3ANS8_BCL2L1-01        ccaa----------------------------------------------
D2ITA2_BCL2L1-02        gtga--------ggggactgat----------------------------
C1BLI0_BCL2L1-01        ccca--------gttaatggat----------------------------
A0A287APJ6_BCL2-01      gtagagaatgtcataaaacaag----------------------------
A0A286MU87_BCL2L1-      ctga--------cggagatgag----------------------------
C0HAD8_BCL2L1-01        ctga--------gggagatgac----------------------------
G1QEX2_BCL2L10-01       aggc--------g-------------------------------------
W5QIG4_BCL2L10-01       ccga--------ggctgctgtg----------------------------
E1B9B3_BCL2L10-01       ctga--------ggctgccgtg----------------------------
F1MV39_BCL2L10-01       ctga--------ggctgccgtg----------------------------
H9GHK7_BCL2L1-01        ccat--------gtcatcaatg----------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gcac--------gccgcccgag----------------------------
A0A1L1RNM6_MCL1-02      gcac--------gccgcccgag----------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       gcga--------atcagccgct----------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          cgga--------a-------------------------------------
R4GAJ0_MCL1-01          cgga--------a-------------------------------------
H2MBQ3_BCL2L10-01       gcga--------gtcagctgct----------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      gcga--------gccggctgcc----------------------------
M4AUW7_BCL2L10-01       gcga--------gccggccgcc----------------------------
D2IT42_BCL2L10-02       gcga--------gtcagccgcg----------------------------
F6ZMX1_MCL1-01          ctga--------g------gag----------------------------
G3WBC5_MCL1-01          ccga--------ggaggacgag----------------------------
H0XHA5_MCL1-01          caga--------g------gag----------------------------
G1QAV8_MCL1-01          ctga--------g------gag----------------------------
G1PZ39_MCL1-01          cgga--------g------gag----------------------------
Q9Z1P3_MCL1-01          ctga--------g------gag----------------------------
P97287_MCL1-02          ccga--------g------gag----------------------------
P97287_MCL1-01          ccga--------g------gag----------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      cgga--------g------gag----------------------------
G1T2Q0_MCL1-02          caga--------g------gag----------------------------
G1T2Q0_MCL1-01          caga--------g------gag----------------------------
A0A287DCH9_MCL1-01      cgga--------g------gag----------------------------
A0A287DCH9_MCL1-02      cgga--------g------gag----------------------------
G3T756_MCL1-01          caga--------g------gag----------------------------
W5QI41_MCL1-01          caga--------g------gag----------------------------
A5PJR2_MCL1-01          caga--------g------gag----------------------------
F1MQX4_MCL1-01          caga--------g------gag----------------------------
A0A1S3F3I1_MCL1-01      cgga--------g------gag----------------------------
J9PBC4_MCL1-01          cgga--------g------gag----------------------------
J9PBC4_MCL1-02          cgga--------g------gag----------------------------
Q8HYS5_MCL1-01          cgga--------g------gag----------------------------
M3XAP4_MCL1-02          caga--------g------gag----------------------------
Q7YRZ9_MCL1-01          caga--------g------gag----------------------------
M3XAP4_MCL1-01          caga--------g------gag----------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          caga--------g------gag----------------------------
G1L3M8_MCL1-01          caga--------g------gag----------------------------
G1L3M8_MCL1-02          caga--------g------gag----------------------------
M3XZZ5_MCL1-01          caga--------g------gag----------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          caga--------g------gag----------------------------
K9IWB2_MCL1-01          caga--------g------gag----------------------------
K9IWB2_MCL1-03          caga--------g------gag----------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          caga--------g------gag----------------------------
A0A2K6GI15_MCL1-01      caga--------g------gag----------------------------
A0A2K6GI15_MCL1-02      caga--------g------gag----------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          caga--------g------gag----------------------------
A0A2K5I9Q7_MCL1-02      caga--------g------gag----------------------------
A0A2K5I9Q7_MCL1-01      caga--------g------gag----------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      caga--------g------gag----------------------------
A0A2K6PPL1_MCL1-02      caga--------g------gag----------------------------
A0A2K6KRW9_MCL1-01      caga--------g------gag----------------------------
A0A2K6PPL1_MCL1-01      caga--------g------gag----------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      caga--------g------gag----------------------------
A0A2I3GB35_MCL1-02      caga--------g------gag----------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      caga--------g------gag----------------------------
A0A2K5XSC7_MCL1-02      caga--------g------gag----------------------------
A0A2K5W0W9_MCL1-01      caga--------g------gag----------------------------
A0A2K6ECR0_MCL1-02      caga--------g------gag----------------------------
A0A2I3M3D6_MCL1-01      caga--------g------gag----------------------------
A0A2K5LXU8_MCL1-01      caga--------g------gag----------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      caga--------g------gag----------------------------
I7G687_MCL1-01          caga--------g------gag----------------------------
A0A2K5W0W9_MCL1-02      caga--------g------gag----------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      caga--------g------gag----------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          caga--------g------gag----------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      caga--------g------gag----------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      caga--------g------gag----------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      caga--------g------gag----------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      caga--------g------gag----------------------------
A0A2R9BYH6_MCL1-02      caga--------g------gag----------------------------
K7DE58_MCL1-02          caga--------g------gag----------------------------
Q07820_MCL1-03          caga--------g------gag----------------------------
K7DE58_MCL1-01          caga--------g------gag----------------------------
A0A2R9BYH6_MCL1-01      caga--------g------gag----------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          caga--------g------gag----------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          caga--------g------gag----------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          caga--------g------gag----------------------------
B4DG83_MCL1-01          caga--------g------gag----------------------------
A0A2K6V5Y3_MCL1-02      caga--------g------gag----------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      caga--------g------gag----------------------------
A0A2K5CFH3_MCL1-03      cgga--------g------gag----------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgga--------g------gag----------------------------
F7GTF7_MCL1-01          caga--------g------gag----------------------------
F7GTF7_MCL1-02          caga--------g------gag----------------------------
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          agatgaggaaaccccaagtaatactccaataacctttgtgggcaatgcac
F7BXJ7_BCL2-01          -----------------------ctc------------------------
Q90Z98_BCL2L1-01        caaatcggactgatg-----------------------------------
Q90Z98_BCL2L1-02        caaatcggactgatg-----------------------------------
H2SNZ8_BCL2L1-02        caagtaggactgatg-----------------------------------
H2SNZ8_BCL2L1-01        caagtaggactgatg-----------------------------------
H3CH49_BCL2L1-01        caagtaggactgaag-----------------------------------
A0A059PJI5_BCL2L1-      tgaac-ggccaggtggcggaa-----------------------------
B5XAY3_BCL2L1-01        agaatcggactga-------------------------------------
W5MG74_BCL2L1-01        agggcaggaccggag----gc-----------------------------
A0A087X9B7_BCL2L1-      cggacagcaccgctgctggggacgcg------------------------
A0A2U9BY16_BCL2L1-      cgaacaggactgatc----gg-----------------------------
A0A0D6DR75_BCL2L1-      caaacaggactgatg----ga-----------------------------
I3IZK7_BCL2L1-01        tgaacaggactgatg----gg-----------------------------
A0A219P0Y3_BCL2L1-      caaacaggactgatg----gg-----------------------------
G3NJY1_BCL2L1-01        ccaacaggactggcg-ggggg-----------------------------
C3VIT1_BCL2L1-01        cgaacaggactggtgccgggg-----------------------------
H2MLZ3_MCL1-01          gagtatt-------------------------------------------
H2MLZ3_MCL1-02          gagtatt-------------------------------------------
Q0KFR9_MCL1-01          cacgacccacgacgttaggagtgaat------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      g-------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      aggacaccgac---------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          ggctccaggct---------------------------------------
A0A2U9CJ81_MCL1-01      ggacggcggcg---------------------------------------
G3PJT0_MCL1-01          gcgggaggaca---------------------------------------
W5MMB7_MCL1-01          gcgcctggatc---------------------------------------
F6YNL8_BCL2-01          aggactcggccacttctactactgct------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          aggacttggccacttctactactgct------------------------
K7F5Y4_BCL2-02          ctggttcggct---------------------------------------
K7F5Y4_BCL2-01          ctggttcggct---------------------------------------
K7F5Y4_BCL2-03          ctggttcggct---------------------------------------
H0W1T3_BCL2-01          gggacccggcc---------------------------------------
F1LNV0_BCL2-01          gagacacggct---------------------------------------
P49950_BCL2-01          gagacacggct---------------------------------------
P10417_BCL2-01          gggacatggct---------------------------------------
Q7TSN8_BCL2-01          gggacatggct---------------------------------------
P10417_BCL2-02          gggacatggct---------------------------------------
Q6R755_BCL2-01          gggacatggct---------------------------------------
Q9JJV8_BCL2-01          gggacatggct---------------------------------------
Q923R6_BCL2-01          gggacatggct---------------------------------------
G3ULB7_BCL2-02          --------gac---------------------------------------
G3ULB7_BCL2-01          ggggcccggac---------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          gggacccggcc---------------------------------------
I3MVK9_BCL2-01          ataccccggcc---------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          nnnnnnnnnnn---------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          cgccgcccccg---------------------------------------
H0WKI0_BCL2-01          gggacccggcc---------------------------------------
A0A2K6G3I7_BCL2-01      gggacccggcc---------------------------------------
A0A2K5EB04_BCL2-01      gggacccggtc---------------------------------------
A0A1D5QRF2_BCL2-01      gggacccggtc---------------------------------------
A0A2K6UEL3_BCL2-01      gggaccctgtc---------------------------------------
A0A2R8MY14_BCL2-01      gggacccggtc---------------------------------------
A0A2K6R2I6_BCL2-02      gggacccggtc---------------------------------------
A0A2K5HK49_BCL2-01      gggacccggtc---------------------------------------
A0A2K6KHG1_BCL2-01      gggacccggtc---------------------------------------
A0A2K6R2I6_BCL2-01      gggacccggtc---------------------------------------
A0A2K5XRD4_BCL2-01      gggacccggtc---------------------------------------
A0A2K5NZS5_BCL2-01      gggacccggtc---------------------------------------
A0A0D9S017_BCL2-01      gggacccggtc---------------------------------------
A0A2K5UDI5_BCL2-01      gggacccggtc---------------------------------------
A0A2K6CIX3_BCL2-01      gggacccggtc---------------------------------------
A0A096MPU7_BCL2-01      gggacccggtc---------------------------------------
H2NWH5_BCL2-01          gggacccg------------------------------------------
P10415_BCL2-04          gggacccggtc---------------------------------------
G3QES9_BCL2-01          gggaccgggtc---------------------------------------
A0A2I3GZF9_BCL2-01      gggacccggtc---------------------------------------
A9QXG9_BCL2-01          gggacccggtc---------------------------------------
P10415_BCL2-01          gggacccggtc---------------------------------------
P10415_BCL2-02          gggacccggtc---------------------------------------
H2QEM8_BCL2-01          gggacccggtc---------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          ccggctcggct---------------------------------------
H0YUX3_BCL2-01          ccggctcggct---------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ccggctcggct---------------------------------------
Q00709_BCL2-02          ccggctcggct---------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
F7ETY1_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
F8W4Q8_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
R4GAJ0_MCL1-02          --------------------------------------------------
R4GAJ0_MCL1-01          --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
P97287_MCL1-02          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
J9PBC4_MCL1-01          --------------------------------------------------
J9PBC4_MCL1-02          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-01          --------------------------------------------------
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-01          --------------------------------------------------
G1L3M8_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          ctgctgttcccaggaggtctgcatctgctgtttcacccttagctgaattg
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-01          --------------------------------------------------
P10415_BCL2-02          --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          -----------------------taccgcgtgtacagcggcgaggagagc
F7ETY1_MCL1-01          -----------------------ttccggggatactgcggggaggaaacc
J7H260_MCL1-01          --------------------------------------ccccctgcacac
D2ITA0_MCL1-03          ---------accaagaaggaaacggttcgctgcctagcactccggaactc
D2ITA0_MCL1-04          ---------accaagaaggaaacggttcgctgcctagcactccggaactc
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ------------------------ggctcggtaccgtcctcgccttcgga
F8W4Q8_MCL1-01          ------------------------ggctcggtaccgtcctcgccttcgga
Q568W5_MCL1-01          ------------------------ggctcggtaccgtcctcgccttcgga
A0A087YBW4_BCL2L1-      --------------------------------------------tcaaca
M4A558_BCL2L1-01        --------------------------------------------tcaaca
A0A0F7L1T6_BCL2L1-      --------------------------------------------tccgca
H2U5I3_BCL2L1-01        --------------------------------------------tccgca
H2U5I3_BCL2L1-02        --------------------------------------------tccgca
G3P7B4_BCL2L1-01        --------------------------------------------ac-gcg
E6ZFR0_BCL2L1-01        --------------------------------------------ccagca
A0A0B4KJI5_BCL2L1-      --------------------------------------------ccaaca
Q568V1_MCL1-01          -----------------------caccccagatccagaggagctcgacta
Q1L8X3_MCL1-01          -----------------------caccccagatccggaggagctcgacta
Q9I9N3_MCL1-01          -----------------------caccccagatccggaggagctcgacta
A0A1X9JZA1_BCL2-01      --------------------------ccagcaccgggcccgac---agcg
Q6GLI5_BCL2L1-01        ----------------------------------------gggcgtgtct
Q2TAP5_BCL2L1-01        ----------------------------------------tgccatatct
Q91828_BCL2L1-01        ----------------------------------------tgccatatct
H3AR18_MCL1-01          -------------------------------------ttcggtctagatc
H3AR18_MCL1-02          -------------------------------------ttcggtctagatc
F6S8G3_BCL2A1-01        ----------------------------------------------acta
U3IS71_BCL2L1-01        -----------------------caccccccagctggccaggt---agtg
K7F655_BCL2L1-01        -----------------------catccaggtgccagccacgt---agtg
G1N5N5_BCL2L1-01        -----------------------cacccgcctgccggccacgt---agtg
Q07816_BCL2L1-03        -----------------------cacccccctgccggccacgt---agtg
Q07816_BCL2L1-01        -----------------------cacccccctgccggccacgt---agtg
Q07816_BCL2L1-02        -----------------------cacccccctgccggccacgt---agtg
U3JSL7_BCL2L1-01        -----------------------cacgcacccaccagccacat---agtg
Q4U2V6_BCL2L1-01        -----------------------cacgcggccaccagccacat---agtg
H0Z8G3_BCL2L1-01        -----------------------cacgcggccaccagccacat---agtg
F6WA14_BCL2L1-01        -----------------------caccctgctgacagccgtgc---tgtg
G3WKX6_BCL2L1-01        -----------------------caccctgctgacagccgtgc---agtg
W5PSA5_BCL2L1-01        -----------------------cacctggcagatagccctgt---ggtg
G3SPN0_BCL2L1-01        -----------------------cacctggcagacagccctgc---ggtg
H0X6V2_BCL2L1-01        -----------------------cacctggctgacagccccac---ggtg
P53563_BCL2L1-04        -----------------------cacctggcggatagccccgc---ggtg
P53563_BCL2L1-02        -----------------------cacctggcggatagccccgc---ggtg
P53563_BCL2L1-03        -----------------------cacctggcggatagccccgc---ggtg
P53563_BCL2L1-01        -----------------------cacctggcggatagccccgc---ggtg
O35843_BCL2L1-01        -----------------------cacctggcggatagcccggc---cgtg
Q64373_BCL2L1-09        -----------------------cacctggcggatagcccggc---cgtg
Q64373_BCL2L1-01        -----------------------cacctggcggatagcccggc---cgtg
Q64373_BCL2L1-03        -----------------------cacctggcggatagcccggc---cgtg
Q64373_BCL2L1-04        -----------------------cacctggcggatagcccggc---cgtg
B2Z3Z4_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggta
A0A1U7QU73_BCL2L1-      -----------------------cacctggcggacagccccgc---ggtg
Q9MYW4_BCL2L1-01        -----------------------cacccggcggacagccccgc---ggtg
A0A1S3EPX7_BCL2L1-      -----------------------cacctggcggacagccccgcggtggtg
O77737_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggtg
A0A286Y5D6_BCL2L1-      -----------------------cacctaactgatagtcccac---ggtg
G1P9D2_BCL2L1-01        -----------------------cacctggtggacagccctgc---ggtg
Q05KJ0_BCL2L1-01        -----------------------cacctggcggatagccctgc---tgtg
Q9MZS7_BCL2L1-01        -----------------------cacctggcggatagccctgc---ggtg
A0A1S2ZQT6_BCL2L1-      -----------------------cacctggcggacagccctgc---attg
A0A1L5BWY3_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A287CZ07_BCL2L1-      -----------------------catctggccgacagccccgc---gata
I3MUP5_BCL2L1-03        -----------------------catctggccgacagccccgc---ggta
I3MUP5_BCL2L1-02        -----------------------catctggccgacagccccgc---ggta
I3MUP5_BCL2L1-01        -----------------------catctggccgacagccccgc---ggta
F6WQI0_BCL2L1-01        -----------------------cacctggcggacagccccac---gggg
E2IV76_BCL2L1-01        -----------------------cacctggcagacagccctcc---agcg
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------------------cacctggcggacagcccccc---agcg
G1RER8_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggtg
A0A2J8VIH3_BCL2L1-      -----------------------cacctggcggacagccccgc---ggtg
Q07817_BCL2L1-03        -----------------------cacctggcagacagccccgc---ggtg
Q07817_BCL2L1-01        -----------------------cacctggcagacagccccgc---ggtg
Q07817_BCL2L1-02        -----------------------cacctggcagacagccccgc---ggtg
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggtg
A0A2K5H963_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        -----------------------cacctggtggacagccccgc---ggtg
A0A2K5M8B1_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K5VPG2_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
F6UKR4_BCL2L1-01        -----------------------cacctggtggacagccccgc---ggtg
A0A0D9RJZ8_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K6QFA2_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K6QFA2_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K5YR37_BCL2L1-      -----------------------cacctggtggacagccccgc---ggtg
A0A2K6UWY8_BCL2L1-      -----------------------cacctggcggacagccccgc---ggtg
E2IV77_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggtg
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        -----------------------cacctggcggacagcccagt---ggtg
F7IT34_BCL2L1-01        -----------------------cacctggcggacagcccagt---ggtg
F7IT34_BCL2L1-03        -----------------------cacctggcggacagcccagt-------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------------------cacctggcggacagccccgc---ggtg
E2IV75_BCL2L1-01        -----------------------cacctggcggacagccccgc---ggtg
M3Z2H9_BCL2L1-01        -----------------------cacctggcggacagccctgc---ggtg
M3XA94_BCL2L1-01        -----------------------cacttggcggacagccctgc---ggtg
Q76LT7_BCL2L1-01        -----------------------cacttggcagacagccctgc---ggtg
Q8SQ42_BCL2L1-01        -----------------------cacttggcagacagccctgc---ggtg
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
H3ANS8_BCL2L1-01        ---------------------------------------cggc---agcc
D2ITA2_BCL2L1-02        ---------g--aggacaagtc--------caacaggattggt---aata
C1BLI0_BCL2L1-01        ---------ctgttgaaaatgaccg-----aaattgcataggc---agt-
A0A287APJ6_BCL2-01      ---------cacaggagaaactgggcccagtggacatgcttgt---aaac
A0A286MU87_BCL2L1-      ---------gccattgcaaatgggtctgtggggaactaccgga---a---
C0HAD8_BCL2L1-01        ---------gccattgcaaatgggtctgtgg---------gga---a---
G1QEX2_BCL2L10-01       ---------------------------------------cggc---actg
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H9GHK7_BCL2L1-01        ---------g----------------------------------------
U3IRH3_MCL1-01          --------------------------------------------------
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ---------ctgcccgacttgatccccgacgagctgcggcagg---aatc
A0A1L1RNM6_MCL1-02      ---------ctgcccgacttgatccccgacgagctgcggcagg---aatc
A0A286XUI2_BCL2A1-      ------------aggatgatt---------gacctggagttca---ggta
I3J363_BCL2L10-01       ---------gccatgaggcgtctgggctgggacatcgaaagac---agca
U3KKY6_MCL1-01          ------------aaaaaaa-------------------------------
R4GAJ0_MCL1-02          --------------gacga------------------------------c
R4GAJ0_MCL1-01          --------------gacga------------------------------c
H2MBQ3_BCL2L10-01       ---------gccatgaggcgcctggcccaggacatggaggcgc---agta
K7FPN7_MCL1-01          --------------------------------------------------
A0A096ME02_BCL2L10      ---------gccatgaggcgcctggcccaggacgtggaggccc---agca
M4AUW7_BCL2L10-01       ---------gccatgaggcgcctggcccaggacgtggaggcca---agca
D2IT42_BCL2L10-02       ---------gccatgaggggactggcccaggacatggagcggc---ag--
F6ZMX1_MCL1-01          ---------g--atgaagaagaggat----gaactatacgggc---agtc
G3WBC5_MCL1-01          ---------g--acgaggaggaggat----gagttgtacgggc---agtc
H0XHA5_MCL1-01          ---------g--agga---------t----gagttatactggc---agtc
G1QAV8_MCL1-01          ---------g--aggagga------------------attgtc---act-
G1PZ39_MCL1-01          ---------g--aggagga------c----gagctgttccggc---agtc
Q9Z1P3_MCL1-01          ---------g--aagacga------c----gagctgtaccacc---agtc
P97287_MCL1-02          ---------g--aagagga------c----gacctataccgcc---agtc
P97287_MCL1-01          ---------g--aagagga------c----gacctataccgcc---agtc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ---------g--aggaggaggaggac----gcgctgtaccgac---agtc
G1T2Q0_MCL1-02          ---------g--aggagga------c----gagttgtaccggc---agtc
G1T2Q0_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A287DCH9_MCL1-01      ---------g--aggacga------c----gagctgtaccggc---agtc
A0A287DCH9_MCL1-02      ---------g--aggacga------c----gagctgtaccggc---agtc
G3T756_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
W5QI41_MCL1-01          ---------g--aggagga------c----gagttatatcggc---agtc
A5PJR2_MCL1-01          ---------g--aggagga------c----gagttatatcggc---agtc
F1MQX4_MCL1-01          ---------g--aggagga------c----aagttatattggc---agtc
A0A1S3F3I1_MCL1-01      ---------g--aggacga------c----gagttgtaccggc---agtc
J9PBC4_MCL1-01          ---------g--aggaaga------t----gagttgtaccggc---agtc
J9PBC4_MCL1-02          ---------g--aggaaga------t----gagttgtaccggc---agtc
Q8HYS5_MCL1-01          ---------g--aggaaga------t----gagttgtaccggc---agtc
M3XAP4_MCL1-02          ---------g--aggagga------c----gagttgttccggc---agtc
Q7YRZ9_MCL1-01          ---------g--aggagga------c----gagttgttccggc---agtc
M3XAP4_MCL1-01          ---------g--aggagga------c----gagttgttccggc---agtc
M3XAP4_MCL1-03          --------------------------------------------------
F7AVA6_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---aatc
G1L3M8_MCL1-01          ---------g--aggaaga------c----gagttgtaccggc---agtc
G1L3M8_MCL1-02          ---------g--aggaaga------c----gagttgtaccggc---agtc
M3XZZ5_MCL1-01          ---------g--aggaaga------c----gagttgtaccggc---agtc
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ---------g--aggagga------c----gagttataccggc---agtc
K9IWB2_MCL1-01          ---------g--aggagga------c----gagttataccggc---agtc
K9IWB2_MCL1-03          ---------g--aggagga------c----gagttataccggc---agtc
A0A2K5C7L5_MCL1-01      ------------------------------------------------tc
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
H0XFB7_MCL1-01          ---------g--aggagga------t----gagttataccggc---agtc
A0A2K6GI15_MCL1-01      ---------g--aggacga------c----gagttgtaccggc---agtc
A0A2K6GI15_MCL1-02      ---------g--aggacga------c----gagttgtaccggc---agtc
A0A2K6GI15_MCL1-03      --------------------------------------------------
H2N5Y9_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5I9Q7_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5I9Q7_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6PPL1_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6KRW9_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6PPL1_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2I3GB35_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5XSC7_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5W0W9_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6ECR0_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2I3M3D6_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5LXU8_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
I7G687_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5W0W9_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
F7HUE9_MCL1-02          --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
F7HUE9_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5XSC7_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3M3D6_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
A0A2I2YQH7_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2R9BYH6_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
K7DE58_MCL1-02          ---------g--aggagga------c----gagttgtaccggc---agtc
Q07820_MCL1-03          ---------g--aggagga------c----gagttgtaccggc---agtc
K7DE58_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2R9BYH6_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2R9BYH6_MCL1-03      --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
B4DU51_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
Q07820_MCL1-04          --------------------------------------------------
B4E3L8_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
B4DLY8_MCL1-01          --------------------------------------------------
Q07820_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
B4DG83_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6V5Y3_MCL1-02      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5CFH3_MCL1-03      ---------g--aggagga------c----gagttgtaccggc---agtc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ---------g--aggagga------c----gagttgtaccggc---agtc
F7GTF7_MCL1-01          ---------g--aggagga------c----gagttgtaccggc---agtc
F7GTF7_MCL1-02          ---------g--aggagga------c----gagttgtaccggc---agtc
F7GTF7_MCL1-03          --------------------------------------------------
F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
B9ZYL7_BCL2-01          aatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgc
F7BXJ7_BCL2-01          --------------------------------------------------
Q90Z98_BCL2L1-01        ---------gggctgaagagaatggcgagggggcagcagg-agcgacaac
Q90Z98_BCL2L1-02        ---------gggctgaagagaatggcgagggggcagcagg-agcgacaac
H2SNZ8_BCL2L1-02        -------------------------------ggcagtttgtaactac-tc
H2SNZ8_BCL2L1-01        -------------------------------ggcagtttgtaactac-tc
H3CH49_BCL2L1-01        -------------------------------ggcagtttggaaccac-cc
A0A059PJI5_BCL2L1-      ---------gagaacgcggtgggagcgggagagtcggagacgccgacagc
B5XAY3_BCL2L1-01        ---------ggtgggacagg--tggaagggggtgcggcagtcctaac-at
W5MG74_BCL2L1-01        ---------gctgaggcggtgggttcggggagcccgaacgcagagga-gc
A0A087X9B7_BCL2L1-      ------gccggggacgcggggatggacgacgagcagacgttggagac-gc
A0A2U9BY16_BCL2L1-      ---------ggggaggcaggtttgggggaggaacagcagacagcgcc-gc
A0A0D6DR75_BCL2L1-      ---------ggggaggttgagtccgctgaggaacagcggatagcgac-gc
I3IZK7_BCL2L1-01        ---------ggggcggcggggttggatgaggaacagcgaatagacac-ac
A0A219P0Y3_BCL2L1-      ---------ggggaggcagggttaggtgaggagcagcgggtagcgac-ac
G3NJY1_BCL2L1-01        ---------gtagaggcaggggcggctggtgggcagcggggagcgac-gc
C3VIT1_BCL2L1-01        ---------acgggggtctgggc----gaggagcagagcacagagac-gc
H2MLZ3_MCL1-01          --------------------------------------------------
H2MLZ3_MCL1-02          --------------------------------------------------
Q0KFR9_MCL1-01          ------gtcgtgaaaagcaacggccttgataatcatttgtctgaccgaag
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
I3JHR5_MCL1-01          --------aacctcggggtaacctcaacaaacgggtatacaacaaaagct
I3KXG5_MCL1-01          --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
Q4SW32_MCL1-01          ---------gcgaggacggctc----------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
W5N4F7_BCL2-01          ---------gccggggccgagcgcggagctgtccc---------------
A0A2U9CJ81_MCL1-01      ---------gcggcggcgacgt-cggcggcggctctc-------------
G3PJT0_MCL1-01          ---------gcgaggacaccga-caacgac--------------------
W5MMB7_MCL1-01          ---------cccaagtcgccgc-ggtcgctgcccgcggggctgaagctgg
F6YNL8_BCL2-01          ------gctgctagaaactcac-ctttgcctcttc---------------
G3WZW9_BCL2-02          --------------------------------------------------
G3WZW9_BCL2-01          ------gctgctagaaactcac-ctttgcctcctc---------------
K7F5Y4_BCL2-02          ---------gctgcta----------------------------------
K7F5Y4_BCL2-01          ---------gctgcta----------------------------------
K7F5Y4_BCL2-03          ---------gctgcta----------------------------------
H0W1T3_BCL2-01          ---------gccaggacctcgc-caccgccacccc---------------
F1LNV0_BCL2-01          ---------gccaggacgtcgc-ctctacggcccc---------------
P49950_BCL2-01          ---------gccaggacgtcgc-ctctacggcccc---------------
P10417_BCL2-01          ---------gccaggacgtctc-ctctcaggcccc---------------
Q7TSN8_BCL2-01          ---------gccaggacgtctc-ctctcaggcccc---------------
P10417_BCL2-02          ---------gccaggacgtctc-ctctcaggcccc---------------
Q6R755_BCL2-01          ---------gccaggacatcgc-cactaaggccca---------------
Q9JJV8_BCL2-01          ---------gccaggacatcgc-cactaaggccca---------------
Q923R6_BCL2-01          ---------gccaggacatcgc-cactaaggccca---------------
G3ULB7_BCL2-02          ---------accaggacctcgc-cgctccagg------------------
G3ULB7_BCL2-01          ---------accaggacctcgc-cgctccagg------------------
F6R2C4_BCL2-01          ----------ccaggacctccc-cgccgccgcccc---------------
O02718_BCL2-01          ----------ccaggacctccc-cgccgccgcccc---------------
A0A076FU27_BCL2-01      ----------ccaggacctccc-cgccgccgcccc---------------
A0A076FZV9_BCL2-01      ----------ccaggacctccc-cgccgccgcccc---------------
G1TW27_BCL2-01          ---------gccaggacctcgc-cgccg----------------------
I3MVK9_BCL2-01          ---------gccaggacctcgc-caccgccacccc---------------
M3YYK3_BCL2-01          ----------cccgcagctcac-ctccccggccaccg-------------
G1LID1_BCL2-01          ----------ccaag-----------------------------------
F7CDX6_BCL2-01          ----------ccaggacctccc-cgctgctacccc---------------
A0A287APJ6_BCL2-03      ----------ccaggacctcgc-cgccgccgaccccgaccgcccccgccg
G1LID1_BCL2-02          -------------------------------------------------g
M3X1R9_BCL2-01          ----------ccaggacctccc-cgccgccgcccccggtcgcccccgccg
J9NXG3_BCL2-01          ---------nnnnnnnnnnnnn-nnnnnnnnnnnn---------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          ---------ccccccgccgccc-ccgctgccgccg---------------
H0WKI0_BCL2-01          ---------gccaggacctcgc-ccccggccgccc---------------
A0A2K6G3I7_BCL2-01      ---------gccaggacctcgc-ccccgc---------------------
A0A2K5EB04_BCL2-01      ---------tccaggacctcgc-cgccgccgcccc---------------
A0A1D5QRF2_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K6UEL3_BCL2-01      ---------gccaggaccnnnn-nnnnnnnnnnnn---------------
A0A2R8MY14_BCL2-01      ---------gccaggacctcgc-cgccgccgcccc---------------
A0A2K6R2I6_BCL2-02      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K5HK49_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K6KHG1_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K6R2I6_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K5XRD4_BCL2-01      ---------gccaggacctcgc-cactgccgaccc---------------
A0A2K5NZS5_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A0D9S017_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K5UDI5_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A2K6CIX3_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A0A096MPU7_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
H2NWH5_BCL2-01          ---------gccaggacctcgc-cgctgccgaccc---------------
P10415_BCL2-04          ---------gccaggacctcgc-cgctgcagaccc---------------
G3QES9_BCL2-01          ---------gccaggacctcgc-cgctgcagaccc---------------
A0A2I3GZF9_BCL2-01      ---------gccaggacctcgc-cgctgccgaccc---------------
A9QXG9_BCL2-01          ---------gccaggacctcgc-cgctgcagaccc---------------
P10415_BCL2-01          ---------gccaggacctcgc-cgctgcagaccc---------------
P10415_BCL2-02          ---------gccaggacctcgc-cgctgcagaccc---------------
H2QEM8_BCL2-01          ---------gccaggacctcgc-cgctgcagaccc---------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          ---------gctgctagcccc-----------------------------
H0YUX3_BCL2-01          ---------actgctagccac-----------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ---------gctgctagtgag-----------------------------
Q00709_BCL2-02          ---------gctgctagtgag-----------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        ---------------------------------------ggacaactgtc
K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
X4ZGI8_BCL2-01          -----------------------------------------------cac
Q564A4_BCL2-01          -----------------------------------------------ctc
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
B6V6J0_MCL1-01          ggcgaattagaggcttcctgtctcctccaaca------------------
F7ETY1_MCL1-01          agcggcttaaaggcctccttcctcctccatca------------------
J7H260_MCL1-01          ggaaacccgcgccctgctgcacaccttcttcagggaatg--------ggc
D2ITA0_MCL1-03          cagtcagaagtagacacggacagccaggcgggggaagaagtgttggataa
D2ITA0_MCL1-04          cagtcagaagtagacacggacagccaggcgggggaagaagtgttggataa
F8W4Q8_MCL1-02          --------------------------------------------------
Q8UWD6_M