Dataset for CDS BCL2L2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

75 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6TEC3_BCL2L2-01        cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagca
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctca
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        ------------------------------------------catagctc
G1Q051_BCL2L2-01        atgaatgaattttctctagacaactttatgctctatagttttgattctgt
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ---------------------ctgagcctctgtctacatattcccgatat
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-04        ---------------------atgccccttctgattctctctccatatat
F7G4L5_BCL2L2-05        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        ------------cctgaaatgctccattctgtgtctctgactaaatatac
W5QDH5_BCL2L2-01        atgggctggccaaacctgaaatacctccttctgggcctctcaccatatat
W5QDH5_BCL2L2-02        atgggctggccaaacctgaaatacctccttctgggcctctcaccatatat
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        ------------------------------------------ccatatat
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        ------------aagcctgaagcaccccttctggctttccaaccatatat
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ---------------------------cttctggttctctgtccatatat
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      ---------------------atgccccttctggttctctgtccatatat
G3TMU7_BCL2L2-01        ---------------------------------------------tatat
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        ------------atgtccctttttggtctctgtcaatatttttcatatat
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        tgcgacgggaaatatcatcttccgggggagccccgataagtacctgacgg
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        gccctgctgtcttgccccctgcccctccaggccccccggcagccctcctg
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        aagccccattttcttctctctgcc--------------------------
G1Q051_BCL2L2-01        tgatattaggcccaaagtgctggg--------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        tcatgccggtctttcatccttgcc--------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-04        tcatgccagtgtttcatccttgcc--------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        tcatgccagtcttttatccttgac--------------------------
W5QDH5_BCL2L2-01        tcatgccagtcttttatgtttgac--------------------------
W5QDH5_BCL2L2-02        tcatgccagtcttttatgtttgac--------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        tcatgccagtctttcatccttgac--------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        tcacgccagcctttcatccttgac--------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      taatgccagtctttcatccttgcc--------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      -------catctttcatccttgcc--------------------------
A0A2K5CWZ4_BCL2L2-      -------catctttcatccttgcc--------------------------
A0A2K5CWZ4_BCL2L2-      tcatgccagtctttcatccttgcc--------------------------
G3TMU7_BCL2L2-01        tcatgttagtctttcatccctgac--------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        ttatgtcagtctgtcatccttgcc--------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        agcaaggctgg------------------------------------atg
Q5XGJ4_BCL2L2-01        -----------------------------------------------atg
H3AAS7_BCL2L2-01        -----------------------------------------------atg
H3AAS7_BCL2L2-02        -----------------------------------------------atg
F7G6M3_BCL2L2-01        acgcccctccacggcctccccctccccgctgtcctgcagccccccggatg
F6U940_BCL2L2-01        -----------------------------------------------atg
G3WPT2_BCL2L2-02        -----------------------------------------------atg
G3WPT2_BCL2L2-01        -------------------------------ttttatagccagccagatg
G1Q051_BCL2L2-01        -------------------------------tccta-------------a
D3Z5F7_BCL2L2-01        -----------------------------------------------atg
P70345_BCL2L2-04        -----------------------------------------------atg
G1TV33_BCL2L2-01        -------------------------------tcttacagccgcccggatg
A0A2K6GWN0_BCL2L2-      -----------------------------------------------atg
A0A2R9A7B2_BCL2L2-      -----------------------------------------------atg
H2Q805_BCL2L2-02        -----------------------------------------------atg
A0A2I2YPX6_BCL2L2-      -----------------------------------------------atg
G1RYB4_BCL2L2-01        -----------------------------------------------atg
F7G4L5_BCL2L2-04        -------------------------------tcttatagctgcccggatg
F7G4L5_BCL2L2-05        -----------------------------------------------atg
A0A2I3MUE4_BCL2L2-      -----------------------------------------------atg
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------atg
A0A2K6AI30_BCL2L2-      -----------------------------------------------atg
A0A2K5MZX9_BCL2L2-      -----------------------------------------------atg
A0A2K6EA73_BCL2L2-      -----------------------------------------------atg
A0A2K5HEK7_BCL2L2-      -----------------------------------------------atg
A0A2K6MEE6_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2R8M4C0_BCL2L2-      -----------------------------------------------atg
A0A2K5CWZ4_BCL2L2-      -----------------------------------------------atg
A0A2K6TM77_BCL2L2-      -----------------------------------------------atg
A0A287AW74_BCL2L2-      -----------------------------------------------atg
G1P3J2_BCL2L2-01        -------------------------------ctttacagccgcccggatg
W5QDH5_BCL2L2-01        -------------------------------tccaacagccgcccggatg
W5QDH5_BCL2L2-02        -------------------------------tccaacagccgcccggatg
A0A2U4CFE3_BCL2L2-      -----------------------------------------------atg
Q05KI8_BCL2L2-01        -----------------------------------------------atg
Q1RMX3_BCL2L2-01        -----------------------------------------------atg
F6PH48_BCL2L2-01        -----------------------------------------------atg
Q45T69_BCL2L2-01        -----------------------------------------------atg
G1LMC3_BCL2L2-01        -------------------------------tcttacagccgcccggatg
A0A2I2UAE3_BCL2L2-      -----------------------------------------------atg
M3Y5X5_BCL2L2-01        -------------------------------tcttacagccgcccggatg
A0A287AW74_BCL2L2-      -----------------------------------------------atg
A0A286XQQ9_BCL2L2-      -----------------------------------------------atg
H0XR82_BCL2L2-01        -----------------------------------------------atg
A0A2K6GWN0_BCL2L2-      -----------------------------------------------atg
I3ND50_BCL2L2-02        -----------------------------------------------atg
A0A2R9A7B2_BCL2L2-      -----------------------------------------------atg
H2Q805_BCL2L2-01        -----------------------------------------------atg
G1RYB4_BCL2L2-03        -----------------------------------------------atg
A0A2I2YPX6_BCL2L2-      -----------------------------------------------atg
Q92843_BCL2L2-02        -----------------------------------------------atg
A0A2K5MZX9_BCL2L2-      -----------------------------------------------atg
A0A2K6EA73_BCL2L2-      -----------------------------------------------atg
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------atg
F7G4L5_BCL2L2-03        -----------------------------------------------atg
F7G4L5_BCL2L2-02        -----------------------------------------------atg
A0A2K6AI30_BCL2L2-      -----------------------------------------------atg
A0A2I3MUE4_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2K6MEE6_BCL2L2-      -----------------------------------------------atg
A0A0D9RU30_BCL2L2-      -----------------------------------------------atg
A0A2K5HEK7_BCL2L2-      -----------------------------------------------atg
A0A2R8M4C0_BCL2L2-      -------------------------------tcttatagctgcccggatg
A0A2K6TM77_BCL2L2-      -----------------------------------------------atg
A0A2K6TM77_BCL2L2-      -------------------------------tcttatagccgcccggatg
A0A2K5CWZ4_BCL2L2-      -------------------------------tcttatagccgcccggatg
A0A2K5CWZ4_BCL2L2-      -------------------------------tcttatagccgcccggatg
G3TMU7_BCL2L2-01        -------------------------------tcttgcagccgcccgcatg
O88996_BCL2L2-01        -----------------------------------------------atg
Q7TS60_BCL2L2-01        -------------------------------cctttcagccgcccggatg
I3ND50_BCL2L2-01        -----------------------------------------------atg
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        -----------------------------------------------atg

F6TEC3_BCL2L2-01        gcg----caatctga---------actaggatcccgggctttggtagagg
Q5XGJ4_BCL2L2-01        gcg----caatctga---------actaggatcccgggctttggtagagg
H3AAS7_BCL2L2-01        gattc----gcttta---------cagtaacagaggag---tggtggagg
H3AAS7_BCL2L2-02        gattc----gcttta---------cagtaacagaggag---tggtggagg
F7G6M3_BCL2L2-01        gcgaccccggccccg-gcctcggtctcagacacccgggccctggtggcgg
F6U940_BCL2L2-01        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G3WPT2_BCL2L2-02        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G3WPT2_BCL2L2-01        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G1Q051_BCL2L2-01        gagctcccagcctcaggc------cccagacacacaggctctggtggcag
D3Z5F7_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
P70345_BCL2L2-04        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
G1TV33_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggccg
A0A2K6GWN0_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2R9A7B2_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
H2Q805_BCL2L2-02        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2I2YPX6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
G1RYB4_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-04        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-05        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I3MUE4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5V0Q3_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6AI30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5MZX9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6EA73_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5HEK7_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6MEE6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2R8M4C0_BCL2L2-      gcgaccccagcctcc-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A287AW74_BCL2L2-      gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
G1P3J2_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
W5QDH5_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
W5QDH5_BCL2L2-02        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
A0A2U4CFE3_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctagtggcag
Q05KI8_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctagtggcag
Q1RMX3_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctagtggcag
F6PH48_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
Q45T69_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
G1LMC3_BCL2L2-01        gcgaccccagcttca-gc------cccagacacacgggctctagtggcag
A0A2I2UAE3_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
M3Y5X5_BCL2L2-01        gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
A0A287AW74_BCL2L2-      gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
A0A286XQQ9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggctg
H0XR82_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K6GWN0_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
I3ND50_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggccg
A0A2R9A7B2_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
H2Q805_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
G1RYB4_BCL2L2-03        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I2YPX6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
Q92843_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5MZX9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6EA73_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5V0Q3_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-03        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6AI30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I3MUE4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6MEE6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A0D9RU30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5HEK7_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2R8M4C0_BCL2L2-      gcgaccccagcctcc-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
G3TMU7_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
O88996_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
Q7TS60_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
I3ND50_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggccg
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg

F6TEC3_BCL2L2-01        attttgtgcgatacaagttatgccagcgtagtctagttc-cggagcctgc
Q5XGJ4_BCL2L2-01        attttgtgcgatacaagttatgccagcgtagtctagttc-cggagcctgc
H3AAS7_BCL2L2-01        acttcatttattacaaactcggccagaaggggtactctcagcagggtgcc
H3AAS7_BCL2L2-02        acttcatttattacaaactcggccagaaggggtactctcagcagggtgcc
F7G6M3_BCL2L2-01        actttgtgggctacaagctgcggcagaagggcttcgcctgcggggccggg
F6U940_BCL2L2-01        attttgtgggttacaagctgaggcagaagggctatgcctgtggaactggc
G3WPT2_BCL2L2-02        attttgtgggttataagctaaggcagaagggctatgcctgtggaactggc
G3WPT2_BCL2L2-01        attttgtgggttataagctaaggcagaagggctatgcctgtggaactggc
G1Q051_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtttgtggagcgggt
D3Z5F7_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
P70345_BCL2L2-04        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
G1TV33_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtctgtggggctggc
A0A2K6GWN0_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
A0A2R9A7B2_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2Q805_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I2YPX6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G1RYB4_BCL2L2-01        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-04        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-05        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I3MUE4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5V0Q3_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6AI30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5MZX9_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6EA73_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5HEK7_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6MEE6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2R8M4C0_BCL2L2-      actttgtaggttataagctgaggcagaaaggttatgtctgtggaactggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A287AW74_BCL2L2-      actttgtgggctataagctgaggcagaagggttatgtctgtggagctggc
G1P3J2_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtttgtggagcgggt
W5QDH5_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
W5QDH5_BCL2L2-02        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
A0A2U4CFE3_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
Q05KI8_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
Q1RMX3_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
F6PH48_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
Q45T69_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
G1LMC3_BCL2L2-01        actttgtaggctataagctgaggcagaaaggttatgtgtgtggagctggc
A0A2I2UAE3_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtttgtggagcaggc
M3Y5X5_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
A0A287AW74_BCL2L2-      actttgtgggctataagctgaggcagaagggttatgtctgtggagctggc
A0A286XQQ9_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
H0XR82_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6GWN0_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
I3ND50_BCL2L2-02        actttgtaggctataagctgaggcagaagggttacgtctgtggagctggc
A0A2R9A7B2_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2Q805_BCL2L2-01        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G1RYB4_BCL2L2-03        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I2YPX6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
Q92843_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5MZX9_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6EA73_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5V0Q3_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-03        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6AI30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I3MUE4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6MEE6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A0D9RU30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5HEK7_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2R8M4C0_BCL2L2-      actttgtaggttataagctgaggcagaaaggttatgtctgtggaactggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G3TMU7_BCL2L2-01        actttgtgggctacaagctgaggcagaagggttatgtttgtggagctggc
O88996_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
Q7TS60_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
I3ND50_BCL2L2-01        actttgtaggctataagctgaggcagaagggttacgtctgtggagctggc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc

F6TEC3_BCL2L2-01        --------aggagcagcatcctgttctttgcattcagccatgcgtgctgc
Q5XGJ4_BCL2L2-01        --------aggagcagcatcctgttctttgcattcagccatgcgtgctgc
H3AAS7_BCL2L2-01        ccaacgga---tccccccgccaacccactctaccgtgccatgcgggaggc
H3AAS7_BCL2L2-02        ccaacgga---tccccccgccaacccactctaccgtgccatgcgggaggc
F7G6M3_BCL2L2-01        cccggggagggccccccggcccagcccctgcaccgggccatgcgggccgc
F6U940_BCL2L2-01        ccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgc
G3WPT2_BCL2L2-02        ccaggagagggccctacaaatgagcctctgcaccgggccatgcgagccgc
G3WPT2_BCL2L2-01        ccaggagagggccctacaaatgagcctctgcaccgggccatgcgagccgc
G1Q051_BCL2L2-01        cccggagagggcccagcagctgacccactgcaccaagccatgcgggcagc
D3Z5F7_BCL2L2-01        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc
P70345_BCL2L2-04        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc
G1TV33_BCL2L2-01        cctggagagggcccggcagctaacccgctgcaccaagccatgcgggcagc
A0A2K6GWN0_BCL2L2-      ccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R9A7B2_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H2Q805_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
G1RYB4_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-04        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-05        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I3MUE4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5V0Q3_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6AI30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6EA73_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5HEK7_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6MEE6_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R8M4C0_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A287AW74_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
G1P3J2_BCL2L2-01        cccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagc
W5QDH5_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
W5QDH5_BCL2L2-02        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
A0A2U4CFE3_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
Q05KI8_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
Q1RMX3_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
F6PH48_BCL2L2-01        cccggggagggcccagccgctgacccactgcaccaagccatgcgggcagc
Q45T69_BCL2L2-01        cctggagagggcccagcagctgatccactgcaccaagccatgcgggcagc
G1LMC3_BCL2L2-01        cctggggagggcccagcagctgacccactgcaccaagccatgcgggcagc
A0A2I2UAE3_BCL2L2-      cctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagc
M3Y5X5_BCL2L2-01        cctggggagggcccagcagctgacccactgcaccaagccatgcgggcagc
A0A287AW74_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A286XQQ9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H0XR82_BCL2L2-01        ccaggggagggcccagcaactgacccgttgcaccaagccatgcgggcagc
A0A2K6GWN0_BCL2L2-      ccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
I3ND50_BCL2L2-02        cctggggagggcccagcagctgatccactgcaccaagccatgcgggcagc
A0A2R9A7B2_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H2Q805_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
G1RYB4_BCL2L2-03        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
Q92843_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6EA73_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5V0Q3_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-03        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6AI30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I3MUE4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6MEE6_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A0D9RU30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5HEK7_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R8M4C0_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
G3TMU7_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
O88996_BCL2L2-01        cctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagc
Q7TS60_BCL2L2-01        cctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagc
I3ND50_BCL2L2-01        cctggggagggcccagcagctgatccactgcaccaagccatgcgggcagc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc

F6TEC3_BCL2L2-01        aggggatgaatttgaagagagattcagacaagcattcagtgagatctcca
Q5XGJ4_BCL2L2-01        aggggatgaatttgaagagagattcagacaagcattcagtgagatctcca
H3AAS7_BCL2L2-01        gggggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgt
H3AAS7_BCL2L2-02        gggggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgt
F7G6M3_BCL2L2-01        cggggacgagttcgagtcacgcttccggcgggccttctcggacttggcgt
F6U940_BCL2L2-01        tggagacgagtttgagtcccgctttcgacgcacattttctgatctggccg
G3WPT2_BCL2L2-02        tggagatgagtttgagtcccgtttccgacgcacattttctgatctggctg
G3WPT2_BCL2L2-01        tggagatgagtttgagtcccgtttccgacgcacattttctgatctggctg
G1Q051_BCL2L2-01        tggagatgagtttgagacccatttccgatgcaccttctctgatctggtgg
D3Z5F7_BCL2L2-01        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg
P70345_BCL2L2-04        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg
G1TV33_BCL2L2-01        cggagatgagttcgagacccgcttccggcaaaacttctccgacctggccg
A0A2K6GWN0_BCL2L2-      tggagatgagtttgagacccgcttccggcgtaccttctctgatctggcgg
A0A2R9A7B2_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
H2Q805_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I2YPX6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G1RYB4_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-04        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-05        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I3MUE4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5V0Q3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6AI30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5MZX9_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6EA73_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5HEK7_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6MEE6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2R8M4C0_BCL2L2-      tggagatgaattcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A287AW74_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctcagatttggcag
G1P3J2_BCL2L2-01        tggagatgagttcgagacccgtttccgtcgcaccttctctgatctggcgg
W5QDH5_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctccgatttggcag
W5QDH5_BCL2L2-02        tggagatgagtttgagacccgcttccggcgcaccttctccgatttggcag
A0A2U4CFE3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctcggatctggcag
Q05KI8_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctccgatctggcag
Q1RMX3_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctccgatctggcag
F6PH48_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatctggcgg
Q45T69_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
G1LMC3_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
A0A2I2UAE3_BCL2L2-      tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
M3Y5X5_BCL2L2-01        tggagatgagtttgagacccgcttccggcgtaccttctctgatttggcag
A0A287AW74_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctcagatttggcag
A0A286XQQ9_BCL2L2-      tggggatgagttcgagacccgattccggcgcaccttctctgatctggctg
H0XR82_BCL2L2-01        tggagatgagttcgagacccgcttccggcgtaccttctctgatctggcag
A0A2K6GWN0_BCL2L2-      tggagatgagtttgagacccgcttccggcgtaccttctctgatctggcgg
I3ND50_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
A0A2R9A7B2_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
H2Q805_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G1RYB4_BCL2L2-03        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I2YPX6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
Q92843_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5MZX9_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6EA73_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5V0Q3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-03        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6AI30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I3MUE4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6MEE6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A0D9RU30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5HEK7_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2R8M4C0_BCL2L2-      tggagatgaattcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G3TMU7_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
O88996_BCL2L2-01        tggagacgagtttgagacccgcttccggcgcaccttctctgacctggccg
Q7TS60_BCL2L2-01        tggagacgagtttgagacccgcttccggcgcaccttctctgacctggccg
I3ND50_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg

F6TEC3_BCL2L2-01        cacagatccatgtgacccctggcacagcatatgcacgctttgcagaagta
Q5XGJ4_BCL2L2-01        cacagatccatgtgacccctggcacagcatatgcacgctttgcagaagta
H3AAS7_BCL2L2-01        cacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacg
H3AAS7_BCL2L2-02        cacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacg
F7G6M3_BCL2L2-01        cccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggtg
F6U940_BCL2L2-01        ctcagttgcatgtgactcctggctcggctcagcagcgctttacccaggtc
G3WPT2_BCL2L2-02        ctcagttgcatgtgactcctggctcagcccagcagcgctttacccaggtc
G3WPT2_BCL2L2-01        ctcagttgcatgtgactcctggctcagcccagcagcgctttacccaggtc
G1Q051_BCL2L2-01        ctcagctgcatgtgaccccaggttcagcccagcaatgtttcacccaggtc
D3Z5F7_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
P70345_BCL2L2-04        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
G1TV33_BCL2L2-01        ctcagttgcatgtgaccccaggctcagcacagcagagcttcacccaggtc
A0A2K6GWN0_BCL2L2-      ctcagctgcatgtgacccccggctcagcccagcagcgcttcacccaggtc
A0A2R9A7B2_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
H2Q805_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2I2YPX6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G1RYB4_BCL2L2-01        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
F7G4L5_BCL2L2-04        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-05        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2I3MUE4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5V0Q3_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6AI30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5MZX9_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6EA73_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5HEK7_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6MEE6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2R8M4C0_BCL2L2-      ctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A287AW74_BCL2L2-      ctcagttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtc
G1P3J2_BCL2L2-01        ctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccaggtc
W5QDH5_BCL2L2-01        ctcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtc
W5QDH5_BCL2L2-02        ctcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtc
A0A2U4CFE3_BCL2L2-      ctcagctgcatgtgaccccaggctcggcccagcaacgcttcacccaggtc
Q05KI8_BCL2L2-01        ctcagctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtc
Q1RMX3_BCL2L2-01        ctcagctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtc
F6PH48_BCL2L2-01        ctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccaggtc
Q45T69_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
G1LMC3_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
A0A2I2UAE3_BCL2L2-      cccagttgcatgtgacccctgggtcagcccagcaacgcttcacccaggtc
M3Y5X5_BCL2L2-01        cccagctgcatgtgaccccaggctcggcccagcagcgcttcacccaggtc
A0A287AW74_BCL2L2-      ctcagttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtc
A0A286XQQ9_BCL2L2-      ctcagctgcatgtgacccctggctcagcccagcaacgcttcacccaggtc
H0XR82_BCL2L2-01        ctcagctacatgtgaccccaggctcagcccagcaacgcttcacccaggtc
A0A2K6GWN0_BCL2L2-      ctcagctgcatgtgacccccggctcagcccagcagcgcttcacccaggtc
I3ND50_BCL2L2-02        ctcagctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtc
A0A2R9A7B2_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
H2Q805_BCL2L2-01        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G1RYB4_BCL2L2-03        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2I2YPX6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
Q92843_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5MZX9_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6EA73_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5V0Q3_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-03        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6AI30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2I3MUE4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6MEE6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A0D9RU30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K5HEK7_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2R8M4C0_BCL2L2-      ctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G3TMU7_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
O88996_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
Q7TS60_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
I3ND50_BCL2L2-01        ctcagctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt

F6TEC3_BCL2L2-01        gcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcatt
Q5XGJ4_BCL2L2-01        gcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcatt
H3AAS7_BCL2L2-01        gcagacagcctcttccaggatggggtgaactggggccgggtggtggcgct
H3AAS7_BCL2L2-02        gcagacagcctcttccaggatggggtgaactggggccgggtggtggcgct
F7G6M3_BCL2L2-01        tcggacgagctcttccagggggggcccaactggggccggctggtggcctt
F6U940_BCL2L2-01        tcagatgagctcttccaaggggggcccaactggggccgtcttgtggcatt
G3WPT2_BCL2L2-02        tcagatgagctcttccaggggggggccaactggggccgtcttgtggcatt
G3WPT2_BCL2L2-01        tcagatgagctcttccaggggggggccaactggggccgtcttgtggcatt
G1Q051_BCL2L2-01        tctgatgaactcttccaggggggccccaactggggttaccttgtggcctt
D3Z5F7_BCL2L2-01        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt
P70345_BCL2L2-04        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt
G1TV33_BCL2L2-01        tgcgatgaacttttccaaaggggtcccaactggggccgcgtggtggcctt
A0A2K6GWN0_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtggcctt
A0A2R9A7B2_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
H2Q805_BCL2L2-02        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2I2YPX6_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
G1RYB4_BCL2L2-01        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-04        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-05        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2I3MUE4_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5V0Q3_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6AI30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5MZX9_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6EA73_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5HEK7_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6MEE6_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2R8M4C0_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A287AW74_BCL2L2-      tctgatgaactcttccaaggaggccccaactggggccgccttgtggcctt
G1P3J2_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
W5QDH5_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
W5QDH5_BCL2L2-02        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
A0A2U4CFE3_BCL2L2-      tctgatgaactcttccaaggggggcccaactggggccgccttgtggcttt
Q05KI8_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
Q1RMX3_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
F6PH48_BCL2L2-01        tctgacgaactcttccaaggtggccccaactggggccgccttgtggcctt
Q45T69_BCL2L2-01        tctgacgaactcttccaagggggccccaactggggccgtcttgtggcctt
G1LMC3_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgcctggtggcctt
A0A2I2UAE3_BCL2L2-      tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
M3Y5X5_BCL2L2-01        tctgacgaactcttccaagggggccccaactggggccgccttgtggcctt
A0A287AW74_BCL2L2-      tctgatgaactcttccaaggaggccccaactggggccgccttgtggcctt
A0A286XQQ9_BCL2L2-      tccgacgaacttttccaaggtggccccaactggggccgtcttgtggcctt
H0XR82_BCL2L2-01        tctgatgaacttttccaagggggccccaactggggccgccttgtggcctt
A0A2K6GWN0_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtggcctt
I3ND50_BCL2L2-02        tctgacgaacttttccaagggggtcccaactggggtcgtcttgtggcctt
A0A2R9A7B2_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
H2Q805_BCL2L2-01        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
G1RYB4_BCL2L2-03        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2I2YPX6_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
Q92843_BCL2L2-02        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2K5MZX9_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6EA73_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5V0Q3_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-03        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-02        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6AI30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2I3MUE4_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6MEE6_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A0D9RU30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5HEK7_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2R8M4C0_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
G3TMU7_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
O88996_BCL2L2-01        tccgacgaacttttccaagggggccccaactggggccgtcttgtggcatt
Q7TS60_BCL2L2-01        tccgacgaacttttccaagggggccccaactggggccgtcttgtggcatt
I3ND50_BCL2L2-01        tctgacgaacttttccaagggggtcccaactggggtcgtcttgtggcctt
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt

F6TEC3_BCL2L2-01        ttttgtttttggtgccgcactgtgtgctgagagtgtcaacaaggagatgt
Q5XGJ4_BCL2L2-01        ttttgtttttggtgccgcactgtgtgctgagagtgtcaacaaggagatgt
H3AAS7_BCL2L2-01        gttcgtcttcagcgcagcactctgtgtggagagcgtggataaggaaatgg
H3AAS7_BCL2L2-02        gttcgtcttcagcgcagcactctgtgtggagagcgtggataaggaaatgg
F7G6M3_BCL2L2-01        cttcgtgttcggggccgcgctctgcgccgagagcgtcaacaaggagatgg
F6U940_BCL2L2-01        cttcgtctttggggcagcgctctgtgcagagagtgtcaacaaagagatgg
G3WPT2_BCL2L2-02        cttcgtctttggggcagcgctctgtgcagagagcgtcaacaaagagatgg
G3WPT2_BCL2L2-01        cttcgtctttggggcagcgctctgtgcagagagcgtcaacaaagagatgg
G1Q051_BCL2L2-01        ctttgtctttggagctgctctgtgtgttgagagtgtcaacaaggagatgg
D3Z5F7_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
P70345_BCL2L2-04        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
G1TV33_BCL2L2-01        ctttgcctttggggccgcactgtgtgctgagagcgtcaacaaggagatgg
A0A2K6GWN0_BCL2L2-      cttcgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R9A7B2_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
H2Q805_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I2YPX6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G1RYB4_BCL2L2-01        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-04        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-05        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I3MUE4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5V0Q3_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6AI30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5MZX9_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6EA73_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5HEK7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6MEE6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R8M4C0_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A287AW74_BCL2L2-      ctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatgg
G1P3J2_BCL2L2-01        ctttgtctttggagctgctctgtgtgctgagagtgtcaacaaggagatgg
W5QDH5_BCL2L2-01        ctttgtctttggagccgcattgtgtgctgagagtgtcaacaaggagatgg
W5QDH5_BCL2L2-02        ctttgtctttggagccgcattgtgtgctgagagtgtcaacaaggagatgg
A0A2U4CFE3_BCL2L2-      ctttgtctttggagccgcgctgtgtgctgagagtgtcaacaaggagatgg
Q05KI8_BCL2L2-01        ctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatgg
Q1RMX3_BCL2L2-01        ctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatgg
F6PH48_BCL2L2-01        ctttgtctttggagccgcgctgtgtgctgagagtgtcaacaaggagatgg
Q45T69_BCL2L2-01        ctttgtctttggagctgcactgtgtgctgagagtgtcaacaaagagatgg
G1LMC3_BCL2L2-01        ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatgg
A0A2I2UAE3_BCL2L2-      ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgg
M3Y5X5_BCL2L2-01        ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatgg
A0A287AW74_BCL2L2-      ctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatgg
A0A286XQQ9_BCL2L2-      ctttgtctttggcgctgccctgtgtgctgagagtgtcaacaaagagatgc
H0XR82_BCL2L2-01        cttcgtctttggggccgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6GWN0_BCL2L2-      cttcgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
I3ND50_BCL2L2-02        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagagatgg
A0A2R9A7B2_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
H2Q805_BCL2L2-01        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G1RYB4_BCL2L2-03        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I2YPX6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
Q92843_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5MZX9_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6EA73_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5V0Q3_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-03        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6AI30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I3MUE4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6MEE6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A0D9RU30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5HEK7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R8M4C0_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G3TMU7_BCL2L2-01        ctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatgg
O88996_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
Q7TS60_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
I3ND50_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagagatgg
P70345_BCL2L2-03        ----------------------------------------------atgg
P70345_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg

F6TEC3_BCL2L2-01        cccctcttctgccacggattcaggactggatggtgacatatctggagaca
Q5XGJ4_BCL2L2-01        cccctcttctgccacggattcaggactggatggtgacatatctggagaca
H3AAS7_BCL2L2-01        cttcgctggtgggacggattattgactggacagtaacttatgtagagagc
H3AAS7_BCL2L2-02        cttcgctggtgggacggattattgactggacagtaacttatgtagagagc
F7G6M3_BCL2L2-01        agcccctggtggggcaggtgcaggactggatggtggcctacctggacacc
F6U940_BCL2L2-01        agccactggtgggacaggtgcaggactggatggtgacctacctagagaca
G3WPT2_BCL2L2-02        agccactggtgggacaggttcaggattggatggtgacctacctagagaca
G3WPT2_BCL2L2-01        agccactggtgggacaagaaaaaagatatggggtgcacttgaagcaggga
G1Q051_BCL2L2-01        agccacttgtgggacaagtacaggagtggacggtggcctacctggagatg
D3Z5F7_BCL2L2-01        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
P70345_BCL2L2-04        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
G1TV33_BCL2L2-01        agcccctggtgggacaagtgcaggagtggatggtgacctacctggagacg
A0A2K6GWN0_BCL2L2-      agccactggtgggacaagtgcaggagtggatggtggcctacctggagaca
A0A2R9A7B2_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
H2Q805_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I2YPX6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G1RYB4_BCL2L2-01        aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
F7G4L5_BCL2L2-04        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-05        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I3MUE4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5V0Q3_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6AI30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5MZX9_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6EA73_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5HEK7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6MEE6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R8M4C0_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A287AW74_BCL2L2-      agccactcgtgggacaagtgcaggagtggatggtgacctacctggagaca
G1P3J2_BCL2L2-01        agccacttgtgggacaagtacaggagtggatggtggcctacctggagacg
W5QDH5_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
W5QDH5_BCL2L2-02        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2U4CFE3_BCL2L2-      agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
Q05KI8_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
Q1RMX3_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
F6PH48_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagact
Q45T69_BCL2L2-01        agccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
G1LMC3_BCL2L2-01        aaccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
A0A2I2UAE3_BCL2L2-      agccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
M3Y5X5_BCL2L2-01        agccacttgtgggccaagtgcaagagtggatggtggcctacctggagacg
A0A287AW74_BCL2L2-      agccactcgtgggacaagtgcaggagtggatggtgacctacctggagaca
A0A286XQQ9_BCL2L2-      aaccactggtgggccaagtgcaggagtggatggtggcctacctggagacg
H0XR82_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtagcctacctggagaca
A0A2K6GWN0_BCL2L2-      agccactggtgggacaagtgcaggagtggatggtggcctacctggagaca
I3ND50_BCL2L2-02        agccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R9A7B2_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
H2Q805_BCL2L2-01        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G1RYB4_BCL2L2-03        aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
A0A2I2YPX6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
Q92843_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5MZX9_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6EA73_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5V0Q3_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-03        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6AI30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I3MUE4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6MEE6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A0D9RU30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5HEK7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R8M4C0_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G3TMU7_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtggtctacctggagacg
O88996_BCL2L2-01        agccattggtgggacaagtgcaggattggatggtgacctacctggagaca
Q7TS60_BCL2L2-01        agccattggtgggacaagtgcaggattggatggtgacctacctggagaca
I3ND50_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
P70345_BCL2L2-03        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
P70345_BCL2L2-01        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
                           *  *  **   *           *     **    *      *    

F6TEC3_BCL2L2-01        aacctgagagactggattcagagca--atggaggctg-------------
Q5XGJ4_BCL2L2-01        aacctgagagactggattcagagca--atggaggctg-------------
H3AAS7_BCL2L2-01        agccttcaggattggatcaaccaca--gtggaggatg-------------
H3AAS7_BCL2L2-02        agccttcaggattggatcaaccaca--gtggaggatg-------------
F7G6M3_BCL2L2-01        cagctggccgactggatccgcagca--gcgggggctg-------------
F6U940_BCL2L2-01        cagctggcagactggatccacagca--gtgggggctg-------------
G3WPT2_BCL2L2-02        cagctggcagactggatccacagca--gcgggggctg-------------
G3WPT2_BCL2L2-01        attttagcaaggtatttaccaagcaaggctggagct--------------
G1Q051_BCL2L2-01        cggctggctgactggatccacagta--ttgggggctg-------------
D3Z5F7_BCL2L2-01        cgtctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-04        cgtctggctgactggatccacagca--gtgggggctg-------------
G1TV33_BCL2L2-01        cagctggccggctggatccacagca--ccgggggctg-------------
A0A2K6GWN0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2R9A7B2_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
H2Q805_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2YPX6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
G1RYB4_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-04        cggctggctgactggatccacagca--gtgggggctggttatcccagatc
F7G4L5_BCL2L2-05        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I3MUE4_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5V0Q3_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6AI30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5MZX9_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6EA73_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5HEK7_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6MEE6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2R8M4C0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A287AW74_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
G1P3J2_BCL2L2-01        cggctggccgactggatccacagta--gtgggggctg-------------
W5QDH5_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
W5QDH5_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2U4CFE3_BCL2L2-      cggctggccgactggatccacagca--gcgggggctg-------------
Q05KI8_BCL2L2-01        aggctggctgactggatccacagca--gtgggggctg-------------
Q1RMX3_BCL2L2-01        aggctggctgactggatccacagca--gtgggggctg-------------
F6PH48_BCL2L2-01        cggctggccgactggatccacagca--gtggaggctg-------------
Q45T69_BCL2L2-01        cggctggccgactggatccacagca--gtgggggctg-------------
G1LMC3_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2UAE3_BCL2L2-      cggctggccgactggattcacagca--gtgggggctg-------------
M3Y5X5_BCL2L2-01        cggctggccgactggatccacagca--gtgggggctg-------------
A0A287AW74_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A286XQQ9_BCL2L2-      cgcctggccgactggatccacagca--gtgggggctg-------------
H0XR82_BCL2L2-01        cggctggctgactggatccatagca--gtggtggctg-------------
A0A2K6GWN0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
I3ND50_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2R9A7B2_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
H2Q805_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
G1RYB4_BCL2L2-03        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2YPX6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
Q92843_BCL2L2-02        cagctggctgactggatccacagca--gtgggggctg-------------
A0A2K5MZX9_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6EA73_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5V0Q3_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-03        cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6AI30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I3MUE4_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6MEE6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A0D9RU30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5HEK7_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2R8M4C0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
G3TMU7_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
O88996_BCL2L2-01        cgcttggctgactggatccacagca--gtgggggctg-------------
Q7TS60_BCL2L2-01        cgcttggctgactggatccacagca--gtgggggctg-------------
I3ND50_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-03        cgtctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-01        cgtctggctgactggatccacagca--gtgggggctg-------------
                            *       *   *       *     *  * *              

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-04        actgaagctgagatggctgatgaagtaatttgcagtgaaattttaagcga
F7G4L5_BCL2L2-05        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        ---------------------------------gaat------ggatttc
Q5XGJ4_BCL2L2-01        ---------------------------------gaat------ggatttc
H3AAS7_BCL2L2-01        ---------------------------------gagt------gctttcg
H3AAS7_BCL2L2-02        ---------------------------------gagt------gctttcg
F7G6M3_BCL2L2-01        ---------------------------------ggcg------gagttca
F6U940_BCL2L2-01        ---------------------------------ggcg------gaattca
G3WPT2_BCL2L2-02        ---------------------------------ggcg------gaattca
G3WPT2_BCL2L2-01        ----------------------------------gcg------gaattca
G1Q051_BCL2L2-01        ---------------------------------ggca------gagttca
D3Z5F7_BCL2L2-01        ---------------------------------ggagctagaagcgatca
P70345_BCL2L2-04        ---------------------------------gg---------------
G1TV33_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2K6GWN0_BCL2L2-      ---------------------------------ggagctggaagccatca
A0A2R9A7B2_BCL2L2-      ---------------------------------ggagctggaagctatca
H2Q805_BCL2L2-02        ---------------------------------ggagctggaagctatca
A0A2I2YPX6_BCL2L2-      ---------------------------------ggagctggaagctatca
G1RYB4_BCL2L2-01        ---------------------------------ggagctggaagctatca
F7G4L5_BCL2L2-04        ctgtgactctgctccaagttccccagatctcgaggagctggaagctatca
F7G4L5_BCL2L2-05        ---------------------------------ggagctggaagctatca
A0A2I3MUE4_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5V0Q3_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6AI30_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5MZX9_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6EA73_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5HEK7_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6MEE6_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6RW46_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2R8M4C0_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6TM77_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A287AW74_BCL2L2-      ---------------------------------ggagctggaagcgatca
G1P3J2_BCL2L2-01        ---------------------------------ggcg------gagttca
W5QDH5_BCL2L2-01        ---------------------------------ggagctggaagcgatca
W5QDH5_BCL2L2-02        ---------------------------------ggcg------gagttca
A0A2U4CFE3_BCL2L2-      ---------------------------------ggcg------gagttca
Q05KI8_BCL2L2-01        ---------------------------------ggcg------gagttca
Q1RMX3_BCL2L2-01        ---------------------------------ggcg------gagttca
F6PH48_BCL2L2-01        ---------------------------------ggcg------gagttca
Q45T69_BCL2L2-01        ---------------------------------ggcg------gagttca
G1LMC3_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2I2UAE3_BCL2L2-      ---------------------------------ggcg------gagttca
M3Y5X5_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A287AW74_BCL2L2-      ---------------------------------ggcg------gagttca
A0A286XQQ9_BCL2L2-      ---------------------------------ggcg------gagttca
H0XR82_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2K6GWN0_BCL2L2-      ---------------------------------ggcg------gagttca
I3ND50_BCL2L2-02        ---------------------------------g----------------
A0A2R9A7B2_BCL2L2-      ---------------------------------ggcg------gagttca
H2Q805_BCL2L2-01        ---------------------------------ggcg------gagttca
G1RYB4_BCL2L2-03        ---------------------------------ggcg------gagttca
A0A2I2YPX6_BCL2L2-      ---------------------------------ggcg------gagttca
Q92843_BCL2L2-02        ---------------------------------ggcg------gagttca
A0A2K5MZX9_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6EA73_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5V0Q3_BCL2L2-      ---------------------------------ggcg------gagttca
F7G4L5_BCL2L2-03        ---------------------------------ggcg------gagttca
F7G4L5_BCL2L2-02        ---------------------------------ggcg------gagttca
A0A2K6AI30_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2I3MUE4_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6RW46_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6RW46_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6MEE6_BCL2L2-      ---------------------------------ggcg------gagttca
A0A0D9RU30_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5HEK7_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2R8M4C0_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6TM77_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6TM77_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggcg------gagttca
G3TMU7_BCL2L2-01        ---------------------------------ggcg------gagttca
O88996_BCL2L2-01        ---------------------------------ggcg------gagttca
Q7TS60_BCL2L2-01        ---------------------------------ggcg------gagttca
I3ND50_BCL2L2-01        ---------------------------------ggcg------gagttca
P70345_BCL2L2-03        ---------------------------------ggcg------gagttca
P70345_BCL2L2-01        ---------------------------------ggcg------gagttca

F6TEC3_BCL2L2-01        taactcta--tatggggat----ggtgccatagaagaggccaggaggcag
Q5XGJ4_BCL2L2-01        taactcta--tatggggat----ggtgccatagaagaggccaggaggcag
H3AAS7_BCL2L2-01        tgtgtctg--tatgggaat----ggtgcagtgggcggagccaggaggttt
H3AAS7_BCL2L2-02        tgtgtctg--tatgggaat----ggtgcagtgggcggagccaggaggttt
F7G6M3_BCL2L2-01        cggccctg--tacggggac----ggggccctggaggacgcccggcgcctg
F6U940_BCL2L2-01        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G3WPT2_BCL2L2-02        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G3WPT2_BCL2L2-01        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G1Q051_BCL2L2-01        cagctcta--tac-------------------------------------
D3Z5F7_BCL2L2-01        aagctcgagtcagggagat----gga-----ggaagaggctgagaagcta
P70345_BCL2L2-04        ----------------------------------------taagaag---
G1TV33_BCL2L2-01        cagctctg--tacggggat----cgggccctggaggaggcgcggcgtctg
A0A2K6GWN0_BCL2L2-      aagctcgggtcagggagat----gga-----ggaagaagctgagaagtta
A0A2R9A7B2_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
H2Q805_BCL2L2-02        aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2I2YPX6_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
G1RYB4_BCL2L2-01        aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
F7G4L5_BCL2L2-04        aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
F7G4L5_BCL2L2-05        aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2I3MUE4_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K5V0Q3_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K6AI30_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K5MZX9_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K6EA73_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K5HEK7_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K6MEE6_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K6RW46_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2R8M4C0_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K5CWZ4_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A2K6TM77_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
A0A287AW74_BCL2L2-      aagctcgagtcagggagat----gga-----ggaagaagctgagaagcta
G1P3J2_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggctcgacgcctg
W5QDH5_BCL2L2-01        aagctcgagttagggagat----gga-----ggaagaagctgagaagcta
W5QDH5_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2U4CFE3_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q05KI8_BCL2L2-01        cagctcta--tacggggtc----ggggccctggaggaggcgcggcgtctg
Q1RMX3_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
F6PH48_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q45T69_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G1LMC3_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I2UAE3_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
M3Y5X5_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A287AW74_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A286XQQ9_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
H0XR82_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggctcggcgtctg
A0A2K6GWN0_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
I3ND50_BCL2L2-02        ctgttctc--cagggggaatatgggggctctg-----------------a
A0A2R9A7B2_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
H2Q805_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G1RYB4_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I2YPX6_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q92843_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5MZX9_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6EA73_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5V0Q3_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
F7G4L5_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
F7G4L5_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6AI30_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I3MUE4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6RW46_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6RW46_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6MEE6_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A0D9RU30_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5HEK7_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2R8M4C0_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6TM77_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6TM77_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5CWZ4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5CWZ4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G3TMU7_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
O88996_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
Q7TS60_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
I3ND50_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
P70345_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
P70345_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg

F6TEC3_BCL2L2-01        cgtgag---------------gggaattgggcatcactga----------
Q5XGJ4_BCL2L2-01        cgtgag---------------gggaattgggcatcactga----------
H3AAS7_BCL2L2-01        caggaa---------------ggctactggtcatccatga----------
H3AAS7_BCL2L2-02        caggaa---------------ggctactggtcatccatga----------
F7G6M3_BCL2L2-01        cgggag---------------ggcaactgggcctccgtcc----------
F6U940_BCL2L2-01        cgggag---------------gggaactgggcctcagtgc----------
G3WPT2_BCL2L2-02        cgggag---------------gggaactgggcctcagtgc----------
G3WPT2_BCL2L2-01        cgggag---------------gggaactgggcctcagtgc----------
G1Q051_BCL2L2-01        ---------------------gggaactgggcctcagtga----------
D3Z5F7_BCL2L2-01        aaggagctacaaaacgaggtagagaagcagatgaatatgagtccaccccc
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        cgggag---------------gggacctgggcgtcagtga----------
A0A2K6GWN0_BCL2L2-      aaagagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2R9A7B2_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccaccacc
H2Q805_BCL2L2-02        aaggagctacagaacgaggtagagaagcagatgaatatgagtccaccacc
A0A2I2YPX6_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
G1RYB4_BCL2L2-01        aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
F7G4L5_BCL2L2-04        aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
F7G4L5_BCL2L2-05        aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2I3MUE4_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K5V0Q3_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6AI30_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K5MZX9_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6EA73_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K5HEK7_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6MEE6_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6RW46_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2R8M4C0_BCL2L2-      aaggaactacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K5CWZ4_BCL2L2-      aaagaactacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6TM77_BCL2L2-      aaggaactacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A287AW74_BCL2L2-      aaggagctacagaacgaagtagagaagcagatgaatatgagtccaccacc
G1P3J2_BCL2L2-01        cgggag---------------gggaactgggcctcagtga----------
W5QDH5_BCL2L2-01        aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
W5QDH5_BCL2L2-02        cgggag---------------gggaactgggcttcagtga----------
A0A2U4CFE3_BCL2L2-      cgggag---------------gggaactgggcctcagtga----------
Q05KI8_BCL2L2-01        cgggag---------------gggaactgggcttcagtga----------
Q1RMX3_BCL2L2-01        cgggag---------------gggaactgggcttcagtga----------
F6PH48_BCL2L2-01        cgggag---------------gggaactgggcctcagtga----------
Q45T69_BCL2L2-01        cgggag---------------gggaactgggcctcagtga----------
G1LMC3_BCL2L2-01        cgggag---------------gggaactgggcctcagtga----------
A0A2I2UAE3_BCL2L2-      cgggag---------------gggaactgggcctcagtga----------
M3Y5X5_BCL2L2-01        cgggag---------------gggaactgggcctcagtga----------
A0A287AW74_BCL2L2-      cgggag---------------gggaactgggcctcagtga----------
A0A286XQQ9_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
H0XR82_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
A0A2K6GWN0_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
I3ND50_BCL2L2-02        ttggag---------------g----ctgg--------ga----------
A0A2R9A7B2_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
H2Q805_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
G1RYB4_BCL2L2-03        cgggag---------------gggaactgggcatcagtga----------
A0A2I2YPX6_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
Q92843_BCL2L2-02        cgggag---------------gggaactgggcatcagtga----------
A0A2K5MZX9_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6EA73_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K5V0Q3_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
F7G4L5_BCL2L2-03        cgggag---------------gggaactgggcatcagtga----------
F7G4L5_BCL2L2-02        cgggag---------------gggaactgggcatcagtga----------
A0A2K6AI30_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2I3MUE4_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6RW46_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6RW46_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6MEE6_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A0D9RU30_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K5HEK7_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2R8M4C0_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6TM77_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K6TM77_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K5CWZ4_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
A0A2K5CWZ4_BCL2L2-      cgggag---------------gggaactgggcatcagtga----------
G3TMU7_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
O88996_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
Q7TS60_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
I3ND50_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------
P70345_BCL2L2-03        cgggag---------------gggaactgggcatcagtga----------
P70345_BCL2L2-01        cgggag---------------gggaactgggcatcagtga----------

F6TEC3_BCL2L2-01        agactgtcttaac-----------------------------tggagcag
Q5XGJ4_BCL2L2-01        agactgtcttaac-----------------------------tggagcag
H3AAS7_BCL2L2-01        agacggttgtgac-----------------------------gggggctg
H3AAS7_BCL2L2-02        agacggttgtgac-----------------------------gggggctg
F7G6M3_BCL2L2-01        ggaccgtgctgac-----------------------------gggggccg
F6U940_BCL2L2-01        gaacagtgctaac-----------------------------aggggctg
G3WPT2_BCL2L2-02        gtacagtgctaac-----------------------------aggggctg
G3WPT2_BCL2L2-01        gtacagtgctaac-----------------------------aggggctg
G1Q051_BCL2L2-01        ggacagtgctgac-----------------------------gggggccc
D3Z5F7_BCL2L2-01        aggcaatgctggcccagtgatcatgtctcttgaggagaagatggaggctg
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg
A0A2K6GWN0_BCL2L2-      aggcaatgctggtccagtgatcatgtccattgaagagaaaatggaggctg
A0A2R9A7B2_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
H2Q805_BCL2L2-02        aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2I2YPX6_BCL2L2-      aggcaatgctggaccagtgatcatgtccattgaggagaagatggaggctg
G1RYB4_BCL2L2-01        aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
F7G4L5_BCL2L2-04        aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
F7G4L5_BCL2L2-05        aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2I3MUE4_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K5V0Q3_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6AI30_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K5MZX9_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6EA73_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K5HEK7_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6MEE6_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6RW46_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2R8M4C0_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K5CWZ4_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6TM77_BCL2L2-      aggcaatgctggaccagtgatcatgtccattgaggagaagatggaggctg
A0A287AW74_BCL2L2-      aggcaatgctggcccagttatcatgtccattgaggagaagatggaggcag
G1P3J2_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg
W5QDH5_BCL2L2-01        gggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
W5QDH5_BCL2L2-02        ggacagtgctgac-----------------------------gggggccg
A0A2U4CFE3_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
Q05KI8_BCL2L2-01        ggacagtgctgac-----------------------------gggggctg
Q1RMX3_BCL2L2-01        ggacagtgctgac-----------------------------gggggctg
F6PH48_BCL2L2-01        ggacagtgctgac-----------------------------aggggccg
Q45T69_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg
G1LMC3_BCL2L2-01        ggacagtgctgac-----------------------------aggggccg
A0A2I2UAE3_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
M3Y5X5_BCL2L2-01        ggacagtgctgac-----------------------------aggggccg
A0A287AW74_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A286XQQ9_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
H0XR82_BCL2L2-01        ggacagtgctgac-----------------------------aggggccg
A0A2K6GWN0_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
I3ND50_BCL2L2-02        cagctgtgctggg-----------------------------aagga---
A0A2R9A7B2_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
H2Q805_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg
G1RYB4_BCL2L2-03        ggacagtgctgac-----------------------------gggggccg
A0A2I2YPX6_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
Q92843_BCL2L2-02        ggacagtgctgac-----------------------------gggggccg
A0A2K5MZX9_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K6EA73_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K5V0Q3_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
F7G4L5_BCL2L2-03        ggacagtgctgac-----------------------------gggggccg
F7G4L5_BCL2L2-02        ggacagtgctgac-----------------------------gggggccg
A0A2K6AI30_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2I3MUE4_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K6RW46_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K6RW46_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K6MEE6_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A0D9RU30_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2K5HEK7_BCL2L2-      ggacagtgctgac-----------------------------gggggccg
A0A2R8M4C0_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
A0A2K6TM77_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
A0A2K6TM77_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
A0A2K5CWZ4_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
A0A2K5CWZ4_BCL2L2-      ggacagtgctgac-----------------------------aggggccg
G3TMU7_BCL2L2-01        ggacagtgctgac-----------------------------gggggctg
O88996_BCL2L2-01        ggacagtgctgac-----------------------------gggggctg
Q7TS60_BCL2L2-01        ggacagtgctgac-----------------------------gggggctg
I3ND50_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg
P70345_BCL2L2-03        ggacagtgctgac-----------------------------gggggccg
P70345_BCL2L2-01        ggacagtgctgac-----------------------------gggggccg

F6TEC3_BCL2L2-01        -------------------tagct----------ctgggtgctttaat--
Q5XGJ4_BCL2L2-01        -------------------tagct----------ctgggtgctttaat--
H3AAS7_BCL2L2-01        -------------------tggcg----------ctaggggcggtgat--
H3AAS7_BCL2L2-02        -------------------tggcg----------ctaggggcggtgat--
F7G6M3_BCL2L2-01        -------------------tggcg----------ctgggagccctggt--
F6U940_BCL2L2-01        -------------------tagca----------ctgggggctctggt--
G3WPT2_BCL2L2-02        -------------------tggca----------ctgggggctctggt--
G3WPT2_BCL2L2-01        -------------------tggca----------ctgggggctctggt--
G1Q051_BCL2L2-01        -------------------tggca----------ctaagggccttgtt--
D3Z5F7_BCL2L2-01        atgcccgctctatctacgttggca----------atgtggactatggtgc
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
A0A2K6GWN0_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2R9A7B2_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
H2Q805_BCL2L2-02        atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2I2YPX6_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
G1RYB4_BCL2L2-01        atgcccgttccatctatgttggca----------atgtggactatggtgc
F7G4L5_BCL2L2-04        atgcccgttccatctatgttggca----------atgtggactatggtgc
F7G4L5_BCL2L2-05        atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2I3MUE4_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K5V0Q3_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K6AI30_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K5MZX9_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K6EA73_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K5HEK7_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K6MEE6_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K6RW46_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2R8M4C0_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K5CWZ4_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A2K6TM77_BCL2L2-      atgcccgttccatctatgttggca----------atgtggactatggtgc
A0A287AW74_BCL2L2-      atgcccgatctatctatgttggca----------atgtggactatggtgc
G1P3J2_BCL2L2-01        -------------------tggca----------ctaggggccttggt--
W5QDH5_BCL2L2-01        atgcccgttccatctatgttggca----------atgtggactatggtgc
W5QDH5_BCL2L2-02        -------------------tggcactttcgctagctgagggctctggc--
A0A2U4CFE3_BCL2L2-      -------------------tggca----------ctgggggccctggt--
Q05KI8_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
Q1RMX3_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
F6PH48_BCL2L2-01        -------------------tggca----------ttgggggccctggt--
Q45T69_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
G1LMC3_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
A0A2I2UAE3_BCL2L2-      -------------------tggca----------ctgggggccctggt--
M3Y5X5_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
A0A287AW74_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A286XQQ9_BCL2L2-      -------------------tggca----------ctgggggccctggt--
H0XR82_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
A0A2K6GWN0_BCL2L2-      -------------------tggca----------ctgggggccctggt--
I3ND50_BCL2L2-02        --------------------ggca----------t---------------
A0A2R9A7B2_BCL2L2-      -------------------tggca----------ctgggggccctggt--
H2Q805_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
G1RYB4_BCL2L2-03        -------------------tggca----------ctgggggccctggt--
A0A2I2YPX6_BCL2L2-      -------------------tggca----------ctgggggccctggt--
Q92843_BCL2L2-02        -------------------tggca----------ctgggggccctggt--
A0A2K5MZX9_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6EA73_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K5V0Q3_BCL2L2-      -------------------tggca----------ctgggggccctggt--
F7G4L5_BCL2L2-03        -------------------tggca----------ctgggggccctggt--
F7G4L5_BCL2L2-02        -------------------tggca----------ctgggggccctggt--
A0A2K6AI30_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2I3MUE4_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6RW46_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6RW46_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6MEE6_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A0D9RU30_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K5HEK7_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2R8M4C0_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6TM77_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K6TM77_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K5CWZ4_BCL2L2-      -------------------tggca----------ctgggggccctggt--
A0A2K5CWZ4_BCL2L2-      -------------------tggca----------ctgggggccctggt--
G3TMU7_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
O88996_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
Q7TS60_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
I3ND50_BCL2L2-01        -------------------tggca----------ctgggggccctggt--
P70345_BCL2L2-03        -------------------tggca----------ctgggggccctggt--
P70345_BCL2L2-01        -------------------tggca----------ctgggggccctggt--

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        aacagcagaagagctggaagcccattttcatggctgtggttcagtcaacc
P70345_BCL2L2-04        ------------------------ttctca--------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      aacagcagaagagctggaagctcactttcatggttgtggttcagtcaacc
A0A2R9A7B2_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
H2Q805_BCL2L2-02        aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A2I2YPX6_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
G1RYB4_BCL2L2-01        aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
F7G4L5_BCL2L2-04        aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
F7G4L5_BCL2L2-05        aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2I3MUE4_BCL2L2-      aacagcagaagagttggaagctcactttcatggctgtggatcagtcaacc
A0A2K5V0Q3_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K6AI30_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K5MZX9_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K6EA73_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K5HEK7_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K6MEE6_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2K6RW46_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggatcagtcaacc
A0A2R8M4C0_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A2K5CWZ4_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A2K6TM77_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A287AW74_BCL2L2-      aacagcagaagagctggaagcacactttcatggctgtggttcagtcaacc
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        aacagcagaagagctagaagcacacttccatggctgtggttcagtcaacc
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        --------------------gacagtaggagcctt---------------
Q5XGJ4_BCL2L2-01        --------------------gacagtaggagcctt---------------
H3AAS7_BCL2L2-01        --------------------gacggtcggagcgct---------------
H3AAS7_BCL2L2-02        --------------------gacggtcggagcgct---------------
F7G6M3_BCL2L2-01        --------------------gaccgtcggggcctt---------------
F6U940_BCL2L2-01        --------------------gactgtgggggcctt---------------
G3WPT2_BCL2L2-02        --------------------gactgtgggggcctt---------------
G3WPT2_BCL2L2-01        --------------------gactgtgggggcctt---------------
G1Q051_BCL2L2-01        --------------------aactgtaggagcatt---------------
D3Z5F7_BCL2L2-01        gtgttactatactctgtgacaaatttagtggccatcccaaagggtttgca
P70345_BCL2L2-04        --attgctgctctccg----------------catccc------tctaca
G1TV33_BCL2L2-01        --------------------aactgtaggggcctt---------------
A0A2K6GWN0_BCL2L2-      gtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgca
A0A2R9A7B2_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcg
H2Q805_BCL2L2-02        gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcg
A0A2I2YPX6_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
G1RYB4_BCL2L2-01        gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
F7G4L5_BCL2L2-04        gtgttaccatactctgtgacaaatttagtggccatcctaaaggatttgcg
F7G4L5_BCL2L2-05        gtgttaccatactctgtgacaaatttagtggccatcctaaaggatttgcg
A0A2I3MUE4_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcg
A0A2K5V0Q3_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcg
A0A2K6AI30_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcg
A0A2K5MZX9_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcg
A0A2K6EA73_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcg
A0A2K5HEK7_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcg
A0A2K6MEE6_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcg
A0A2K6RW46_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcg
A0A2R8M4C0_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
A0A2K5CWZ4_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
A0A2K6TM77_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
A0A287AW74_BCL2L2-      gcgttactatactctgtgacaaatttagtggccatcccaaagggtttgca
G1P3J2_BCL2L2-01        --------------------aactgtaggagcatt---------------
W5QDH5_BCL2L2-01        gcgttactatactctgtgacaaatttagtggccatcccaaagggtttgcg
W5QDH5_BCL2L2-02        --------------------cg----------ctt---------------
A0A2U4CFE3_BCL2L2-      --------------------aactgtaggggcctt---------------
Q05KI8_BCL2L2-01        --------------------aactgtaggggcctt---------------
Q1RMX3_BCL2L2-01        --------------------aactgtaggggcctt---------------
F6PH48_BCL2L2-01        --------------------aactgtaggggcctt---------------
Q45T69_BCL2L2-01        --------------------caccgtaggggcctt---------------
G1LMC3_BCL2L2-01        --------------------aactgtaggggcctt---------------
A0A2I2UAE3_BCL2L2-      --------------------aactgtaggggcctt---------------
M3Y5X5_BCL2L2-01        --------------------aactgtaggggcctt---------------
A0A287AW74_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A286XQQ9_BCL2L2-      --------------------aactgtaggggcctt---------------
H0XR82_BCL2L2-01        --------------------aactgtaggggcctt---------------
A0A2K6GWN0_BCL2L2-      --------------------aactgtaggggcctt---------------
I3ND50_BCL2L2-02        ---------------------------ggggc------------------
A0A2R9A7B2_BCL2L2-      --------------------aactgtaggggcctt---------------
H2Q805_BCL2L2-01        --------------------aactgtaggggcctt---------------
G1RYB4_BCL2L2-03        --------------------aactgtaggggcctt---------------
A0A2I2YPX6_BCL2L2-      --------------------aactgtaggggcctt---------------
Q92843_BCL2L2-02        --------------------aactgtaggggcctt---------------
A0A2K5MZX9_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6EA73_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K5V0Q3_BCL2L2-      --------------------aactgtaggggcctt---------------
F7G4L5_BCL2L2-03        --------------------aactgtaggggcctt---------------
F7G4L5_BCL2L2-02        --------------------aactgtaggggcctt---------------
A0A2K6AI30_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2I3MUE4_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6RW46_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6RW46_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6MEE6_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A0D9RU30_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K5HEK7_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2R8M4C0_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6TM77_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K6TM77_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K5CWZ4_BCL2L2-      --------------------aactgtaggggcctt---------------
A0A2K5CWZ4_BCL2L2-      --------------------aactgtaggggcctt---------------
G3TMU7_BCL2L2-01        --------------------aactgtaggggcctt---------------
O88996_BCL2L2-01        --------------------aactgtaggggcctt---------------
Q7TS60_BCL2L2-01        --------------------aactgtaggggcctt---------------
I3ND50_BCL2L2-01        --------------------aactgtaggggcctt---------------
P70345_BCL2L2-03        --------------------aactgtaggggcctt---------------
P70345_BCL2L2-01        --------------------aactgtaggggcctt---------------

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        tatatagagttctcggacaaagagtcagtgaggacgtccctggccttaga
P70345_BCL2L2-04        aagttggtcttcatgggaaaatag-----------------ggcctctga
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
A0A2R9A7B2_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
H2Q805_BCL2L2-02        tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2I2YPX6_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
G1RYB4_BCL2L2-01        tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
F7G4L5_BCL2L2-04        tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
F7G4L5_BCL2L2-05        tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2I3MUE4_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5V0Q3_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K6AI30_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5MZX9_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K6EA73_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5HEK7_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacgtccttggccttaga
A0A2K6MEE6_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K6RW46_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2R8M4C0_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5CWZ4_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K6TM77_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A287AW74_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        tgagtccctgttcagaggaagacaaatca---------------------
P70345_BCL2L2-04        tggg----------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      tgagtccctgtttagaggaagacaaatcaaggtaagcctgtgctttccat
A0A2R9A7B2_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
H2Q805_BCL2L2-02        tgagtccctatttagaggaaggcaaatca---------------------
A0A2I2YPX6_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggttgactttaaggctatca
G1RYB4_BCL2L2-01        tgagtccctgtttagaggaaggcaaatca---------------------
F7G4L5_BCL2L2-04        tgagtccctatttagaggaaggcaaatca---------------------
F7G4L5_BCL2L2-05        tgagtccctatttagaggaaggcaaatca---------------------
A0A2I3MUE4_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K5V0Q3_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K6AI30_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K5MZX9_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K6EA73_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K5HEK7_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K6MEE6_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2K6RW46_BCL2L2-      tgagtccctatttagaggaaggcaaatca---------------------
A0A2R8M4C0_BCL2L2-      tgagtccctatttagaggaaggcagatcaagattgactttaaggctttca
A0A2K5CWZ4_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggttgactttaaggctttca
A0A2K6TM77_BCL2L2-      cgagtccctatttagaggacggcaaatcaaggttgactttaaggctttca
A0A287AW74_BCL2L2-      tgagtccctatttagaggaagacaaatca---------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        tgaatccttatttagaggaagacagatca---------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        ------------------aggtgattcccaaacgaaccaacagaccaggc
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      tgtacatcctttactctcaggtgatcccaaaacgaaccaacagaccaggc
A0A2R9A7B2_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
H2Q805_BCL2L2-02        ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2I2YPX6_BCL2L2-      tttgttcatctctgactcaggtgatcccaaaacgaaccaacagaccaggc
G1RYB4_BCL2L2-01        ------------------aggtgatcccaaaacgaaccaacagaccaggc
F7G4L5_BCL2L2-04        ------------------aggtgatcccaaaacgaaccaacagaccaggc
F7G4L5_BCL2L2-05        ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2I3MUE4_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K5V0Q3_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K6AI30_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K5MZX9_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K6EA73_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K5HEK7_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K6MEE6_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2K6RW46_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
A0A2R8M4C0_BCL2L2-      tttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggc
A0A2K5CWZ4_BCL2L2-      tttattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggc
A0A2K6TM77_BCL2L2-      tttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggc
A0A287AW74_BCL2L2-      ------------------aggtgatcccaaaacgaaccaacagaccaggc
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        ------------------aggtgatccctaaacgaaccaacagaccaggc
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        atcagcacaacagaccggggtttcccgcgctcccgataccgtgcccggac
P70345_BCL2L2-04        -----------aggctggggtt------------------gtgctggga-
G1TV33_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      atcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggac
A0A2R9A7B2_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
H2Q805_BCL2L2-02        atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2I2YPX6_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
G1RYB4_BCL2L2-01        atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
F7G4L5_BCL2L2-04        atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
F7G4L5_BCL2L2-05        atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2I3MUE4_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K5V0Q3_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K6AI30_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K5MZX9_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K6EA73_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K5HEK7_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K6MEE6_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2K6RW46_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcccggac
A0A2R8M4C0_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcacggac
A0A2K5CWZ4_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcacggac
A0A2K6TM77_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcacggac
A0A287AW74_BCL2L2-      atcagcacaacagaccggggttttccacgagctcgataccgtgcccggac
G1P3J2_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        atcagcacaacagaccgaggtttcccacgagcccgataccgtgcccgaac
W5QDH5_BCL2L2-02        --------------------------------------------------
A0A2U4CFE3_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------

F6TEC3_BCL2L2-01        ---------------------------------------gtttgccagca
Q5XGJ4_BCL2L2-01        ---------------------------------------gtttgccagca
H3AAS7_BCL2L2-01        ---------------------------------------ttttgccagca
H3AAS7_BCL2L2-02        ---------------------------------------ttttgccagca
F7G6M3_BCL2L2-01        ---------------------------------------cttcgcgagca
F6U940_BCL2L2-01        ---------------------------------------ctttgccagca
G3WPT2_BCL2L2-02        ---------------------------------------ctttgccagca
G3WPT2_BCL2L2-01        ---------------------------------------ctttgccagca
G1Q051_BCL2L2-01        ---------------------------------------ttttgctagca
D3Z5F7_BCL2L2-01        taccaactacaacagctcccgatctcgattctacagtggttttaacagca
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ---------------------------------------ttttgctagca
A0A2K6GWN0_BCL2L2-      taccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2R9A7B2_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
H2Q805_BCL2L2-02        caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2I2YPX6_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
G1RYB4_BCL2L2-01        caccaactacaacagttcccgctctcgattctacagtggttttaacagca
F7G4L5_BCL2L2-04        caccaactacaacagttcccgctctcgattctacagtggttttaacagca
F7G4L5_BCL2L2-05        caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2I3MUE4_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5V0Q3_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K6AI30_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5MZX9_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K6EA73_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5HEK7_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K6MEE6_BCL2L2-      caccaactacaacagttcccgctctcgcttctacagtggttttaacagca
A0A2K6RW46_BCL2L2-      caccaactacaacagttcccgctctcgcttctacagtggttttaacagca
A0A2R8M4C0_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5CWZ4_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K6TM77_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A287AW74_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
G1P3J2_BCL2L2-01        ---------------------------------------ttttgctagca
W5QDH5_BCL2L2-01        caccaactacaacagttcccgctctcgattctacagtggttttaacagca
W5QDH5_BCL2L2-02        ---------------------------------------ttttgc-agaa
A0A2U4CFE3_BCL2L2-      ---------------------------------------ttttgctagca
Q05KI8_BCL2L2-01        ---------------------------------------ttttgctagca
Q1RMX3_BCL2L2-01        ---------------------------------------ttttgctagca
F6PH48_BCL2L2-01        ---------------------------------------ttttgctagca
Q45T69_BCL2L2-01        ---------------------------------------ttttgcgagca
G1LMC3_BCL2L2-01        ---------------------------------------ttttgctagca
A0A2I2UAE3_BCL2L2-      ---------------------------------------ttttgctagca
M3Y5X5_BCL2L2-01        ---------------------------------------ttttgctagca
A0A287AW74_BCL2L2-      ---------------------------------------ttttgctagca
A0A286XQQ9_BCL2L2-      ---------------------------------------ttttgctagca
H0XR82_BCL2L2-01        ---------------------------------------ttttgctagca
A0A2K6GWN0_BCL2L2-      ---------------------------------------tttcgctagca
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ---------------------------------------ttttgctagca
H2Q805_BCL2L2-01        ---------------------------------------ttttgctagca
G1RYB4_BCL2L2-03        ---------------------------------------ttttgctagca
A0A2I2YPX6_BCL2L2-      ---------------------------------------ttttgctagca
Q92843_BCL2L2-02        ---------------------------------------ttttgctagca
A0A2K5MZX9_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6EA73_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K5V0Q3_BCL2L2-      ---------------------------------------ttttgctagca
F7G4L5_BCL2L2-03        ---------------------------------------ttttgctagca
F7G4L5_BCL2L2-02        ---------------------------------------ttttgctagca
A0A2K6AI30_BCL2L2-      ---------------------------------------ttttgctagca
A0A2I3MUE4_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6RW46_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6RW46_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6MEE6_BCL2L2-      ---------------------------------------ttttgctagca
A0A0D9RU30_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K5HEK7_BCL2L2-      ---------------------------------------ttttgctagca
A0A2R8M4C0_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6TM77_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K6TM77_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K5CWZ4_BCL2L2-      ---------------------------------------ttttgctagca
A0A2K5CWZ4_BCL2L2-      ---------------------------------------ttttgctagca
G3TMU7_BCL2L2-01        ---------------------------------------ttttgctagca
O88996_BCL2L2-01        ---------------------------------------ttttgctagca
Q7TS60_BCL2L2-01        ---------------------------------------ttttgctagca
I3ND50_BCL2L2-01        ---------------------------------------ttttgctagca
P70345_BCL2L2-03        ---------------------------------------ttttgctagca
P70345_BCL2L2-01        ---------------------------------------ttttgctagca

F6TEC3_BCL2L2-01        ag------------------------------------------------
Q5XGJ4_BCL2L2-01        ag------------------------------------------------
H3AAS7_BCL2L2-01        ga------------------------------------------------
H3AAS7_BCL2L2-02        ga------------------------------------------------
F7G6M3_BCL2L2-01        aa------------------------------------------------
F6U940_BCL2L2-01        ag------------------------------------------------
G3WPT2_BCL2L2-02        ag------------------------------------------------
G3WPT2_BCL2L2-01        ag------------------------------------------------
G1Q051_BCL2L2-01        tg------------------------------------------------
D3Z5F7_BCL2L2-01        ggccccggggtcgaatctacaggggccgggctagagcgacatcatggtat
P70345_BCL2L2-04        --------------------aggg--------------------------
G1TV33_BCL2L2-01        aa------------------------------------------------
A0A2K6GWN0_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2R9A7B2_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
H2Q805_BCL2L2-02        ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2I2YPX6_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
G1RYB4_BCL2L2-01        ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
F7G4L5_BCL2L2-04        ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
F7G4L5_BCL2L2-05        ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2I3MUE4_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2K5V0Q3_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2K6AI30_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2K5MZX9_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2K6EA73_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
A0A2K5HEK7_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2K6MEE6_BCL2L2-      ggccccggggtcgcgtctaca--ggtcaggatag----------------
A0A2K6RW46_BCL2L2-      ggccccggggtcgcgtctaca--ggtcaggatag----------------
A0A2R8M4C0_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2K5CWZ4_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2K6TM77_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A287AW74_BCL2L2-      ggccccggggtcgtgtctacaggggccgggctagagcgacatcatggtat
G1P3J2_BCL2L2-01        ag------------------------------------------------
W5QDH5_BCL2L2-01        ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
W5QDH5_BCL2L2-02        ag------------------------------------------------
A0A2U4CFE3_BCL2L2-      ag------------------------------------------------
Q05KI8_BCL2L2-01        ag------------------------------------------------
Q1RMX3_BCL2L2-01        ag------------------------------------------------
F6PH48_BCL2L2-01        ag------------------------------------------------
Q45T69_BCL2L2-01        ag------------------------------------------------
G1LMC3_BCL2L2-01        ag------------------------------------------------
A0A2I2UAE3_BCL2L2-      ag------------------------------------------------
M3Y5X5_BCL2L2-01        ag------------------------------------------------
A0A287AW74_BCL2L2-      ag------------------------------------------------
A0A286XQQ9_BCL2L2-      ag------------------------------------------------
H0XR82_BCL2L2-01        ag------------------------------------------------
A0A2K6GWN0_BCL2L2-      ag------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ag------------------------------------------------
H2Q805_BCL2L2-01        ag------------------------------------------------
G1RYB4_BCL2L2-03        ag------------------------------------------------
A0A2I2YPX6_BCL2L2-      ag------------------------------------------------
Q92843_BCL2L2-02        ag------------------------------------------------
A0A2K5MZX9_BCL2L2-      ag------------------------------------------------
A0A2K6EA73_BCL2L2-      ag------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ag------------------------------------------------
F7G4L5_BCL2L2-03        ag------------------------------------------------
F7G4L5_BCL2L2-02        ag------------------------------------------------
A0A2K6AI30_BCL2L2-      ag------------------------------------------------
A0A2I3MUE4_BCL2L2-      ag------------------------------------------------
A0A2K6RW46_BCL2L2-      ag------------------------------------------------
A0A2K6RW46_BCL2L2-      ag------------------------------------------------
A0A2K6MEE6_BCL2L2-      ag------------------------------------------------
A0A0D9RU30_BCL2L2-      ag------------------------------------------------
A0A2K5HEK7_BCL2L2-      ag------------------------------------------------
A0A2R8M4C0_BCL2L2-      ag------------------------------------------------
A0A2K6TM77_BCL2L2-      ag------------------------------------------------
A0A2K6TM77_BCL2L2-      ag------------------------------------------------
A0A2K5CWZ4_BCL2L2-      ag------------------------------------------------
A0A2K5CWZ4_BCL2L2-      ag------------------------------------------------
G3TMU7_BCL2L2-01        ag------------------------------------------------
O88996_BCL2L2-01        ag------------------------------------------------
Q7TS60_BCL2L2-01        ag------------------------------------------------
I3ND50_BCL2L2-01        ag------------------------------------------------
P70345_BCL2L2-03        ag------------------------------------------------
P70345_BCL2L2-01        ag------------------------------------------------

F6TEC3_BCL2L2-01        ---------tga
Q5XGJ4_BCL2L2-01        ---------tga
H3AAS7_BCL2L2-01        ---------taa
H3AAS7_BCL2L2-02        ---------taa
F7G6M3_BCL2L2-01        ---------tga
F6U940_BCL2L2-01        ---------tga
G3WPT2_BCL2L2-02        ---------tga
G3WPT2_BCL2L2-01        ---------tga
G1Q051_BCL2L2-01        ---------tga
D3Z5F7_BCL2L2-01        tccccttactaa
P70345_BCL2L2-04        --------ctga
G1TV33_BCL2L2-01        ---------tga
A0A2K6GWN0_BCL2L2-      tccccttactaa
A0A2R9A7B2_BCL2L2-      tccccttactaa
H2Q805_BCL2L2-02        tccccttactaa
A0A2I2YPX6_BCL2L2-      tccccttactaa
G1RYB4_BCL2L2-01        tccccttactaa
F7G4L5_BCL2L2-04        tccccttactaa
F7G4L5_BCL2L2-05        tccccttactaa
A0A2I3MUE4_BCL2L2-      tccccttactaa
A0A2K5V0Q3_BCL2L2-      tccccttactaa
A0A2K6AI30_BCL2L2-      tccccttactaa
A0A2K5MZX9_BCL2L2-      tccccttactaa
A0A2K6EA73_BCL2L2-      tccccttactaa
A0A2K5HEK7_BCL2L2-      tccccttactaa
A0A2K6MEE6_BCL2L2-      ------------
A0A2K6RW46_BCL2L2-      ------------
A0A2R8M4C0_BCL2L2-      tccccttactaa
A0A2K5CWZ4_BCL2L2-      tccccttactaa
A0A2K6TM77_BCL2L2-      tccccttactaa
A0A287AW74_BCL2L2-      tccccttactaa
G1P3J2_BCL2L2-01        ---------tga
W5QDH5_BCL2L2-01        tccccttactaa
W5QDH5_BCL2L2-02        ---------t--
A0A2U4CFE3_BCL2L2-      ---------tga
Q05KI8_BCL2L2-01        ---------tga
Q1RMX3_BCL2L2-01        ---------tga
F6PH48_BCL2L2-01        ---------tga
Q45T69_BCL2L2-01        ---------tga
G1LMC3_BCL2L2-01        ---------tga
A0A2I2UAE3_BCL2L2-      ---------tga
M3Y5X5_BCL2L2-01        ---------tga
A0A287AW74_BCL2L2-      ---------tga
A0A286XQQ9_BCL2L2-      ---------tga
H0XR82_BCL2L2-01        ---------tga
A0A2K6GWN0_BCL2L2-      ---------tga
I3ND50_BCL2L2-02        ---------tga
A0A2R9A7B2_BCL2L2-      ---------tga
H2Q805_BCL2L2-01        ---------tga
G1RYB4_BCL2L2-03        ---------tga
A0A2I2YPX6_BCL2L2-      ---------tga
Q92843_BCL2L2-02        ---------tga
A0A2K5MZX9_BCL2L2-      ---------tga
A0A2K6EA73_BCL2L2-      ---------tga
A0A2K5V0Q3_BCL2L2-      ---------tga
F7G4L5_BCL2L2-03        ---------tga
F7G4L5_BCL2L2-02        ---------tga
A0A2K6AI30_BCL2L2-      ---------tga
A0A2I3MUE4_BCL2L2-      ---------tga
A0A2K6RW46_BCL2L2-      ---------tga
A0A2K6RW46_BCL2L2-      ---------tga
A0A2K6MEE6_BCL2L2-      ---------tga
A0A0D9RU30_BCL2L2-      ---------tga
A0A2K5HEK7_BCL2L2-      ---------tga
A0A2R8M4C0_BCL2L2-      ---------tga
A0A2K6TM77_BCL2L2-      ---------tga
A0A2K6TM77_BCL2L2-      ---------tga
A0A2K5CWZ4_BCL2L2-      ---------tga
A0A2K5CWZ4_BCL2L2-      ---------tga
G3TMU7_BCL2L2-01        ---------tga
O88996_BCL2L2-01        ---------tga
Q7TS60_BCL2L2-01        ---------tga
I3ND50_BCL2L2-01        ---------tga
P70345_BCL2L2-03        ---------tga
P70345_BCL2L2-01        ---------tga

© 1998-2019