Dataset for CDS BCL2L2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

77 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6TEC3_BCL2L2-01        ------------------------------------cgaaaaaaggggaa
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctca
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        taacggcgtaaaggaccgagattgggaagaacagcatgcgacgggaaata
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        gccctgctgtcttgccccctgcccctccaggccccccggcagccctcctg
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        -------------------------------------------------c
G1Q051_BCL2L2-01        -------atgaatgaattttctctagacaactttatgctctatagttttg
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ----------------------------ctgagcctctgtctacatattc
G1P3J2_BCL2L2-01        -------------------cctgaaatgctccattctgtgtctctgacta
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        ----------------------------atgccccttctgattctctctc
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        -------------------------------------------------c
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        -------------------aagcctgaagcaccccttctggctttccaac
W5QDH5_BCL2L2-01        -------atgggctggccaaacctgaaatacctccttctgggcctctcac
W5QDH5_BCL2L2-02        -------atgggctggccaaacctgaaatacctccttctgggcctctcac
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ----------------------------------cttctggttctctgtc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      ----------------------------atgccccttctggttctctgtc
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        -------------------atgtccctttttggtctctgtcaatattttt
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        tcatcttccgggggagccccgataagtacctgacggagcaaggctggatg
Q5XGJ4_BCL2L2-01        -----------------------------------------------atg
H3AAS7_BCL2L2-01        -----------------------------------------------atg
H3AAS7_BCL2L2-02        -----------------------------------------------atg
F7G6M3_BCL2L2-01        acgcccctccacggcctccccctccccgctgtcctgcagccccccggatg
F6U940_BCL2L2-01        -----------------------------------------------atg
G3WPT2_BCL2L2-02        -----------------------------------------------atg
G3WPT2_BCL2L2-01        atagctcaagccccattttcttctctctgccttttatagccagccagatg
G1Q051_BCL2L2-01        attctgttgatattaggcccaaagtgctgggtccta-------------a
A0A1U7RC37_BCL2L2-      -----------------------------------------------atg
D3Z5F7_BCL2L2-01        -----------------------------------------------atg
P70345_BCL2L2-04        -----------------------------------------------atg
G1TV33_BCL2L2-01        ccgatattcatgccggtctttcatccttgcctcttacagccgcccggatg
G1P3J2_BCL2L2-01        aatatactcatgccagtcttttatccttgacctttacagccgcccggatg
A0A2K6GWN0_BCL2L2-      -----------------------------------------------atg
A0A2R9A7B2_BCL2L2-      -----------------------------------------------atg
H2Q805_BCL2L2-02        -----------------------------------------------atg
A0A2I2YPX6_BCL2L2-      -----------------------------------------------atg
G1RYB4_BCL2L2-01        -----------------------------------------------atg
F7G4L5_BCL2L2-05        -----------------------------------------------atg
F7G4L5_BCL2L2-04        catatattcatgccagtgtttcatccttgcctcttatagctgcccggatg
A0A2I3MUE4_BCL2L2-      -----------------------------------------------atg
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------atg
A0A2K6AI30_BCL2L2-      -----------------------------------------------atg
A0A2K5MZX9_BCL2L2-      -----------------------------------------------atg
A0A2K6EA73_BCL2L2-      -----------------------------------------------atg
A0A2K5HEK7_BCL2L2-      -----------------------------------------------atg
A0A2K6MEE6_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2R8M4C0_BCL2L2-      -----------------------------------------------atg
A0A2K5CWZ4_BCL2L2-      -----------------------------------------------atg
A0A2K6TM77_BCL2L2-      -----------------------------------------------atg
A0A287AW74_BCL2L2-      -----------------------------------------------atg
F6PH48_BCL2L2-01        -----------------------------------------------atg
Q45T69_BCL2L2-01        -----------------------------------------------atg
G1LMC3_BCL2L2-01        catatattcatgccagtctttcatccttgactcttacagccgcccggatg
A0A2I2UAE3_BCL2L2-      -----------------------------------------------atg
M3Y5X5_BCL2L2-01        catatattcacgccagcctttcatccttgactcttacagccgcccggatg
W5QDH5_BCL2L2-01        catatattcatgccagtcttttatgtttgactccaacagccgcccggatg
W5QDH5_BCL2L2-02        catatattcatgccagtcttttatgtttgactccaacagccgcccggatg
Q05KI8_BCL2L2-01        -----------------------------------------------atg
Q1RMX3_BCL2L2-01        -----------------------------------------------atg
A0A1U7RC37_BCL2L2-      -----------------------------------------------atg
A0A287AW74_BCL2L2-      -----------------------------------------------atg
A0A286XQQ9_BCL2L2-      -----------------------------------------------atg
H0XR82_BCL2L2-01        -----------------------------------------------atg
A0A2K6GWN0_BCL2L2-      -----------------------------------------------atg
I3ND50_BCL2L2-02        -----------------------------------------------atg
A0A1S3FYD8_BCL2L2-      -----------------------------------------------atg
A0A2R9A7B2_BCL2L2-      -----------------------------------------------atg
H2Q805_BCL2L2-01        -----------------------------------------------atg
G1RYB4_BCL2L2-03        -----------------------------------------------atg
A0A2I2YPX6_BCL2L2-      -----------------------------------------------atg
Q92843_BCL2L2-02        -----------------------------------------------atg
A0A2K5MZX9_BCL2L2-      -----------------------------------------------atg
A0A2K6EA73_BCL2L2-      -----------------------------------------------atg
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------atg
F7G4L5_BCL2L2-02        -----------------------------------------------atg
F7G4L5_BCL2L2-03        -----------------------------------------------atg
A0A2K6AI30_BCL2L2-      -----------------------------------------------atg
A0A2I3MUE4_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2K6RW46_BCL2L2-      -----------------------------------------------atg
A0A2K6MEE6_BCL2L2-      -----------------------------------------------atg
A0A0D9RU30_BCL2L2-      -----------------------------------------------atg
A0A2K5HEK7_BCL2L2-      -----------------------------------------------atg
A0A2R8M4C0_BCL2L2-      catatattaatgccagtctttcatccttgcctcttatagctgcccggatg
A0A2K6TM77_BCL2L2-      --------------catctttcatccttgcctcttatagccgcccggatg
A0A2K6TM77_BCL2L2-      -----------------------------------------------atg
A0A2K5CWZ4_BCL2L2-      catatattcatgccagtctttcatccttgcctcttatagccgcccggatg
A0A2K5CWZ4_BCL2L2-      --------------catctttcatccttgcctcttatagccgcccggatg
G3TMU7_BCL2L2-01        --tatattcatgttagtctttcatccctgactcttgcagccgcccgcatg
O88996_BCL2L2-01        -----------------------------------------------atg
Q7TS60_BCL2L2-01        catatatttatgtcagtctgtcatccttgcccctttcagccgcccggatg
I3ND50_BCL2L2-01        -----------------------------------------------atg
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        -----------------------------------------------atg
                                                                          

F6TEC3_BCL2L2-01        gcg----caatctga---------actaggatcccgggctttggtagagg
Q5XGJ4_BCL2L2-01        gcg----caatctga---------actaggatcccgggctttggtagagg
H3AAS7_BCL2L2-01        gattc----gcttta---------cagtaacagaggag---tggtggagg
H3AAS7_BCL2L2-02        gattc----gcttta---------cagtaacagaggag---tggtggagg
F7G6M3_BCL2L2-01        gcgaccccggccccg-gcctcggtctcagacacccgggccctggtggcgg
F6U940_BCL2L2-01        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G3WPT2_BCL2L2-02        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G3WPT2_BCL2L2-01        gcgactccagcctca-gc------cccagatactcgagccctggtggcag
G1Q051_BCL2L2-01        gagctcccagcctcaggc------cccagacacacaggctctggtggcag
A0A1U7RC37_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctagtggctg
D3Z5F7_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
P70345_BCL2L2-04        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
G1TV33_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggccg
G1P3J2_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6GWN0_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2R9A7B2_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
H2Q805_BCL2L2-02        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2I2YPX6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
G1RYB4_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-05        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-04        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I3MUE4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5V0Q3_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6AI30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5MZX9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6EA73_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5HEK7_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6MEE6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2R8M4C0_BCL2L2-      gcgaccccagcctcc-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A287AW74_BCL2L2-      gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
F6PH48_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
Q45T69_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
G1LMC3_BCL2L2-01        gcgaccccagcttca-gc------cccagacacacgggctctagtggcag
A0A2I2UAE3_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
M3Y5X5_BCL2L2-01        gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
W5QDH5_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
W5QDH5_BCL2L2-02        gcgaccccagcctca-gc------cccagacacacgggctctagtggcag
Q05KI8_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctagtggcag
Q1RMX3_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctagtggcag
A0A1U7RC37_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctagtggctg
A0A287AW74_BCL2L2-      gcgaccccggcctca-gc------cccagacacacgggctctagtggcag
A0A286XQQ9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggctg
H0XR82_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K6GWN0_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
I3ND50_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggccg
A0A1S3FYD8_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggctg
A0A2R9A7B2_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
H2Q805_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
G1RYB4_BCL2L2-03        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I2YPX6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
Q92843_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5MZX9_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6EA73_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5V0Q3_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-02        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
F7G4L5_BCL2L2-03        gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6AI30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2I3MUE4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6RW46_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K6MEE6_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A0D9RU30_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5HEK7_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2R8M4C0_BCL2L2-      gcgaccccagcctcc-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K6TM77_BCL2L2-      gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
A0A2K5CWZ4_BCL2L2-      gcgaccccagcctcg-gc------cccagacacacgggctctggtggcag
G3TMU7_BCL2L2-01        gcgaccccagcctca-gc------cccagacacacgggctctggtggcag
O88996_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
Q7TS60_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
I3ND50_BCL2L2-01        gcgaccccagcctcg-gc------cccagacacacgggctctggtggccg
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        gcgaccccagcctca-ac------cccagacacacgggctctagtggctg
                                                                          

F6TEC3_BCL2L2-01        attttgtgcgatacaagttatgccagcgtagtctagttc-cggagcctgc
Q5XGJ4_BCL2L2-01        attttgtgcgatacaagttatgccagcgtagtctagttc-cggagcctgc
H3AAS7_BCL2L2-01        acttcatttattacaaactcggccagaaggggtactctcagcagggtgcc
H3AAS7_BCL2L2-02        acttcatttattacaaactcggccagaaggggtactctcagcagggtgcc
F7G6M3_BCL2L2-01        actttgtgggctacaagctgcggcagaagggcttcgcctgcggggccggg
F6U940_BCL2L2-01        attttgtgggttacaagctgaggcagaagggctatgcctgtggaactggc
G3WPT2_BCL2L2-02        attttgtgggttataagctaaggcagaagggctatgcctgtggaactggc
G3WPT2_BCL2L2-01        attttgtgggttataagctaaggcagaagggctatgcctgtggaactggc
G1Q051_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtttgtggagcgggt
A0A1U7RC37_BCL2L2-      actttgtaggctataagctgaggcagaagggctatgtctgtggagctggc
D3Z5F7_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
P70345_BCL2L2-04        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
G1TV33_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtctgtggggctggc
G1P3J2_BCL2L2-01        actttgtaggctacaagctgaggcagaagggttatgtttgtggagcgggt
A0A2K6GWN0_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
A0A2R9A7B2_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2Q805_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I2YPX6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G1RYB4_BCL2L2-01        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-05        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-04        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I3MUE4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5V0Q3_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6AI30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5MZX9_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6EA73_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5HEK7_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6MEE6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2R8M4C0_BCL2L2-      actttgtaggttataagctgaggcagaaaggttatgtctgtggaactggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A287AW74_BCL2L2-      actttgtgggctataagctgaggcagaagggttatgtctgtggagctggc
F6PH48_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
Q45T69_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
G1LMC3_BCL2L2-01        actttgtaggctataagctgaggcagaaaggttatgtgtgtggagctggc
A0A2I2UAE3_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtttgtggagcaggc
M3Y5X5_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtttgtggagctggc
W5QDH5_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
W5QDH5_BCL2L2-02        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
Q05KI8_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
Q1RMX3_BCL2L2-01        actttgtgggctataagctgaggcagaaggggtatgtttgtggagctggc
A0A1U7RC37_BCL2L2-      actttgtaggctataagctgaggcagaagggctatgtctgtggagctggc
A0A287AW74_BCL2L2-      actttgtgggctataagctgaggcagaagggttatgtctgtggagctggc
A0A286XQQ9_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
H0XR82_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6GWN0_BCL2L2-      actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
I3ND50_BCL2L2-02        actttgtaggctataagctgaggcagaagggttacgtctgtggagctggc
A0A1S3FYD8_BCL2L2-      actttgtaggctataaactgaggcagaagggttatgtctgtggagcgggc
A0A2R9A7B2_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2Q805_BCL2L2-01        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G1RYB4_BCL2L2-03        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I2YPX6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
Q92843_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5MZX9_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6EA73_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5V0Q3_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
F7G4L5_BCL2L2-03        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6AI30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2I3MUE4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6RW46_BCL2L2-      actttttaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6MEE6_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A0D9RU30_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5HEK7_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2R8M4C0_BCL2L2-      actttgtaggttataagctgaggcagaaaggttatgtctgtggaactggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K6TM77_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
A0A2K5CWZ4_BCL2L2-      actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
G3TMU7_BCL2L2-01        actttgtgggctacaagctgaggcagaagggttatgtttgtggagctggc
O88996_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
Q7TS60_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
I3ND50_BCL2L2-01        actttgtaggctataagctgaggcagaagggttacgtctgtggagctggc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        actttgtaggctataagctgaggcagaagggttatgtctgtggagctggc
                                                                          

F6TEC3_BCL2L2-01        --------aggagcagcatcctgttctttgcattcagccatgcgtgctgc
Q5XGJ4_BCL2L2-01        --------aggagcagcatcctgttctttgcattcagccatgcgtgctgc
H3AAS7_BCL2L2-01        ccaacgga---tccccccgccaacccactctaccgtgccatgcgggaggc
H3AAS7_BCL2L2-02        ccaacgga---tccccccgccaacccactctaccgtgccatgcgggaggc
F7G6M3_BCL2L2-01        cccggggagggccccccggcccagcccctgcaccgggccatgcgggccgc
F6U940_BCL2L2-01        ccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgc
G3WPT2_BCL2L2-02        ccaggagagggccctacaaatgagcctctgcaccgggccatgcgagccgc
G3WPT2_BCL2L2-01        ccaggagagggccctacaaatgagcctctgcaccgggccatgcgagccgc
G1Q051_BCL2L2-01        cccggagagggcccagcagctgacccactgcaccaagccatgcgggcagc
A0A1U7RC37_BCL2L2-      cctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgc
D3Z5F7_BCL2L2-01        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc
P70345_BCL2L2-04        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc
G1TV33_BCL2L2-01        cctggagagggcccggcagctaacccgctgcaccaagccatgcgggcagc
G1P3J2_BCL2L2-01        cccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6GWN0_BCL2L2-      ccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R9A7B2_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H2Q805_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
G1RYB4_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-05        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-04        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I3MUE4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5V0Q3_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6AI30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6EA73_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5HEK7_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6MEE6_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R8M4C0_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A287AW74_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F6PH48_BCL2L2-01        cccggggagggcccagccgctgacccactgcaccaagccatgcgggcagc
Q45T69_BCL2L2-01        cctggagagggcccagcagctgatccactgcaccaagccatgcgggcagc
G1LMC3_BCL2L2-01        cctggggagggcccagcagctgacccactgcaccaagccatgcgggcagc
A0A2I2UAE3_BCL2L2-      cctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagc
M3Y5X5_BCL2L2-01        cctggggagggcccagcagctgacccactgcaccaagccatgcgggcagc
W5QDH5_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
W5QDH5_BCL2L2-02        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
Q05KI8_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
Q1RMX3_BCL2L2-01        cccggggagggcccagcagctgacccgctacaccaagccatgcgggcagc
A0A1U7RC37_BCL2L2-      cctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgc
A0A287AW74_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A286XQQ9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H0XR82_BCL2L2-01        ccaggggagggcccagcaactgacccgttgcaccaagccatgcgggcagc
A0A2K6GWN0_BCL2L2-      ccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
I3ND50_BCL2L2-02        cctggggagggcccagcagctgatccactgcaccaagccatgcgggcagc
A0A1S3FYD8_BCL2L2-      cctggggagggcccagcagctgacccactgcatcaagccatgcgggcagc
A0A2R9A7B2_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
H2Q805_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
G1RYB4_BCL2L2-03        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
Q92843_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6EA73_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5V0Q3_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-02        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
F7G4L5_BCL2L2-03        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6AI30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2I3MUE4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6RW46_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K6MEE6_BCL2L2-      cctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A0D9RU30_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2K5HEK7_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
A0A2R8M4C0_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K6TM77_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
A0A2K5CWZ4_BCL2L2-      cccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagc
G3TMU7_BCL2L2-01        cccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagc
O88996_BCL2L2-01        cctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagc
Q7TS60_BCL2L2-01        cctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagc
I3ND50_BCL2L2-01        cctggggagggcccagcagctgatccactgcaccaagccatgcgggcagc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        cctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgc
                                                                          

F6TEC3_BCL2L2-01        aggggatgaatttgaagagagattcagacaagcattcagtgagatctcca
Q5XGJ4_BCL2L2-01        aggggatgaatttgaagagagattcagacaagcattcagtgagatctcca
H3AAS7_BCL2L2-01        gggggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgt
H3AAS7_BCL2L2-02        gggggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgt
F7G6M3_BCL2L2-01        cggggacgagttcgagtcacgcttccggcgggccttctcggacttggcgt
F6U940_BCL2L2-01        tggagacgagtttgagtcccgctttcgacgcacattttctgatctggccg
G3WPT2_BCL2L2-02        tggagatgagtttgagtcccgtttccgacgcacattttctgatctggctg
G3WPT2_BCL2L2-01        tggagatgagtttgagtcccgtttccgacgcacattttctgatctggctg
G1Q051_BCL2L2-01        tggagatgagtttgagacccatttccgatgcaccttctctgatctggtgg
A0A1U7RC37_BCL2L2-      tggagacgagtttgagacccgcttccggcgcaccttctccgacctggctg
D3Z5F7_BCL2L2-01        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg
P70345_BCL2L2-04        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg
G1TV33_BCL2L2-01        cggagatgagttcgagacccgcttccggcaaaacttctccgacctggccg
G1P3J2_BCL2L2-01        tggagatgagttcgagacccgtttccgtcgcaccttctctgatctggcgg
A0A2K6GWN0_BCL2L2-      tggagatgagtttgagacccgcttccggcgtaccttctctgatctggcgg
A0A2R9A7B2_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
H2Q805_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I2YPX6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G1RYB4_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-05        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-04        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I3MUE4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5V0Q3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6AI30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5MZX9_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6EA73_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5HEK7_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6MEE6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2R8M4C0_BCL2L2-      tggagatgaattcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A287AW74_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctcagatttggcag
F6PH48_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatctggcgg
Q45T69_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
G1LMC3_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
A0A2I2UAE3_BCL2L2-      tggagatgagtttgagacccgcttccggcgcaccttctctgatttggcag
M3Y5X5_BCL2L2-01        tggagatgagtttgagacccgcttccggcgtaccttctctgatttggcag
W5QDH5_BCL2L2-01        tggagatgagtttgagacccgcttccggcgcaccttctccgatttggcag
W5QDH5_BCL2L2-02        tggagatgagtttgagacccgcttccggcgcaccttctccgatttggcag
Q05KI8_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctccgatctggcag
Q1RMX3_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctccgatctggcag
A0A1U7RC37_BCL2L2-      tggagacgagtttgagacccgcttccggcgcaccttctccgacctggctg
A0A287AW74_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctcagatttggcag
A0A286XQQ9_BCL2L2-      tggggatgagttcgagacccgattccggcgcaccttctctgatctggctg
H0XR82_BCL2L2-01        tggagatgagttcgagacccgcttccggcgtaccttctctgatctggcag
A0A2K6GWN0_BCL2L2-      tggagatgagtttgagacccgcttccggcgtaccttctctgatctggcgg
I3ND50_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
A0A1S3FYD8_BCL2L2-      tggagatgaatttgagacccgcttccggcgcaccttctctgatctggcag
A0A2R9A7B2_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
H2Q805_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G1RYB4_BCL2L2-03        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I2YPX6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
Q92843_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5MZX9_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6EA73_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5V0Q3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-02        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
F7G4L5_BCL2L2-03        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6AI30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2I3MUE4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6RW46_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6MEE6_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A0D9RU30_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5HEK7_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2R8M4C0_BCL2L2-      tggagatgaattcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K6TM77_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5CWZ4_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcgg
G3TMU7_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
O88996_BCL2L2-01        tggagacgagtttgagacccgcttccggcgcaccttctctgacctggccg
Q7TS60_BCL2L2-01        tggagacgagtttgagacccgcttccggcgcaccttctctgacctggccg
I3ND50_BCL2L2-01        tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        tggagacgagtttgagacccgtttccgccgcaccttctctgacctggccg
                                                                          

F6TEC3_BCL2L2-01        cacagatccatgtgacccctggcacagcatatgcacgctttgcagaagta
Q5XGJ4_BCL2L2-01        cacagatccatgtgacccctggcacagcatatgcacgctttgcagaagta
H3AAS7_BCL2L2-01        cacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacg
H3AAS7_BCL2L2-02        cacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacg
F7G6M3_BCL2L2-01        cccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggtg
F6U940_BCL2L2-01        ctcagttgcatgtgactcctggctcggctcagcagcgctttacccaggtc
G3WPT2_BCL2L2-02        ctcagttgcatgtgactcctggctcagcccagcagcgctttacccaggtc
G3WPT2_BCL2L2-01        ctcagttgcatgtgactcctggctcagcccagcagcgctttacccaggtc
G1Q051_BCL2L2-01        ctcagctgcatgtgaccccaggttcagcccagcaatgtttcacccaggtc
A0A1U7RC37_BCL2L2-      ctcagctccacgtgaccccaggctcagcccagcaacgcttcacccaggtt
D3Z5F7_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
P70345_BCL2L2-04        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
G1TV33_BCL2L2-01        ctcagttgcatgtgaccccaggctcagcacagcagagcttcacccaggtc
G1P3J2_BCL2L2-01        ctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccaggtc
A0A2K6GWN0_BCL2L2-      ctcagctgcatgtgacccccggctcagcccagcagcgcttcacccaggtc
A0A2R9A7B2_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
H2Q805_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2I2YPX6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G1RYB4_BCL2L2-01        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
F7G4L5_BCL2L2-05        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-04        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2I3MUE4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5V0Q3_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6AI30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5MZX9_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6EA73_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5HEK7_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6MEE6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2R8M4C0_BCL2L2-      ctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A287AW74_BCL2L2-      ctcagttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtc
F6PH48_BCL2L2-01        ctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccaggtc
Q45T69_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
G1LMC3_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
A0A2I2UAE3_BCL2L2-      cccagttgcatgtgacccctgggtcagcccagcaacgcttcacccaggtc
M3Y5X5_BCL2L2-01        cccagctgcatgtgaccccaggctcggcccagcagcgcttcacccaggtc
W5QDH5_BCL2L2-01        ctcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtc
W5QDH5_BCL2L2-02        ctcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtc
Q05KI8_BCL2L2-01        ctcagctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtc
Q1RMX3_BCL2L2-01        ctcagctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtc
A0A1U7RC37_BCL2L2-      ctcagctccacgtgaccccaggctcagcccagcaacgcttcacccaggtt
A0A287AW74_BCL2L2-      ctcagttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtc
A0A286XQQ9_BCL2L2-      ctcagctgcatgtgacccctggctcagcccagcaacgcttcacccaggtc
H0XR82_BCL2L2-01        ctcagctacatgtgaccccaggctcagcccagcaacgcttcacccaggtc
A0A2K6GWN0_BCL2L2-      ctcagctgcatgtgacccccggctcagcccagcagcgcttcacccaggtc
I3ND50_BCL2L2-02        ctcagctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtc
A0A1S3FYD8_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
A0A2R9A7B2_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
H2Q805_BCL2L2-01        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G1RYB4_BCL2L2-03        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2I2YPX6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
Q92843_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5MZX9_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6EA73_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K5V0Q3_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-02        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
F7G4L5_BCL2L2-03        ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6AI30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2I3MUE4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6MEE6_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A0D9RU30_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K5HEK7_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2R8M4C0_BCL2L2-      ctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K6TM77_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
A0A2K5CWZ4_BCL2L2-      ctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtc
G3TMU7_BCL2L2-01        cccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtc
O88996_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
Q7TS60_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
I3ND50_BCL2L2-01        ctcagctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtc
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        ctcagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtt
                                                                          

F6TEC3_BCL2L2-01        gcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcatt
Q5XGJ4_BCL2L2-01        gcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcatt
H3AAS7_BCL2L2-01        gcagacagcctcttccaggatggggtgaactggggccgggtggtggcgct
H3AAS7_BCL2L2-02        gcagacagcctcttccaggatggggtgaactggggccgggtggtggcgct
F7G6M3_BCL2L2-01        tcggacgagctcttccagggggggcccaactggggccggctggtggcctt
F6U940_BCL2L2-01        tcagatgagctcttccaaggggggcccaactggggccgtcttgtggcatt
G3WPT2_BCL2L2-02        tcagatgagctcttccaggggggggccaactggggccgtcttgtggcatt
G3WPT2_BCL2L2-01        tcagatgagctcttccaggggggggccaactggggccgtcttgtggcatt
G1Q051_BCL2L2-01        tctgatgaactcttccaggggggccccaactggggttaccttgtggcctt
A0A1U7RC37_BCL2L2-      tccgacgaacttttccaagggggccccaattggggccgtcttgtggcatt
D3Z5F7_BCL2L2-01        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt
P70345_BCL2L2-04        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt
G1TV33_BCL2L2-01        tgcgatgaacttttccaaaggggtcccaactggggccgcgtggtggcctt
G1P3J2_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
A0A2K6GWN0_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtggcctt
A0A2R9A7B2_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
H2Q805_BCL2L2-02        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2I2YPX6_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
G1RYB4_BCL2L2-01        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-05        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-04        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2I3MUE4_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5V0Q3_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6AI30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5MZX9_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6EA73_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5HEK7_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6MEE6_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2R8M4C0_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A287AW74_BCL2L2-      tctgatgaactcttccaaggaggccccaactggggccgccttgtggcctt
F6PH48_BCL2L2-01        tctgacgaactcttccaaggtggccccaactggggccgccttgtggcctt
Q45T69_BCL2L2-01        tctgacgaactcttccaagggggccccaactggggccgtcttgtggcctt
G1LMC3_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgcctggtggcctt
A0A2I2UAE3_BCL2L2-      tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
M3Y5X5_BCL2L2-01        tctgacgaactcttccaagggggccccaactggggccgccttgtggcctt
W5QDH5_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
W5QDH5_BCL2L2-02        tctgatgaactcttccaagggggccccaactggggtcgccttgtggcctt
Q05KI8_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
Q1RMX3_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
A0A1U7RC37_BCL2L2-      tccgacgaacttttccaagggggccccaattggggccgtcttgtggcatt
A0A287AW74_BCL2L2-      tctgatgaactcttccaaggaggccccaactggggccgccttgtggcctt
A0A286XQQ9_BCL2L2-      tccgacgaacttttccaaggtggccccaactggggccgtcttgtggcctt
H0XR82_BCL2L2-01        tctgatgaacttttccaagggggccccaactggggccgccttgtggcctt
A0A2K6GWN0_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtggcctt
I3ND50_BCL2L2-02        tctgacgaacttttccaagggggtcccaactggggtcgtcttgtggcctt
A0A1S3FYD8_BCL2L2-      tctgatgaacttttccaaggaggccccaactggggccgtcttgtggcctt
A0A2R9A7B2_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
H2Q805_BCL2L2-01        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
G1RYB4_BCL2L2-03        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2I2YPX6_BCL2L2-      tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
Q92843_BCL2L2-02        tccgatgaactttttcaagggggccccaactggggccgccttgtagcctt
A0A2K5MZX9_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6EA73_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5V0Q3_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-02        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
F7G4L5_BCL2L2-03        tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6AI30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2I3MUE4_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6RW46_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K6MEE6_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A0D9RU30_BCL2L2-      tccgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2K5HEK7_BCL2L2-      tctgatgaacttttccaagggggccccaactggggccgccttgtagcctt
A0A2R8M4C0_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K6TM77_BCL2L2-      tccgatgaacttttccaagggggtcccaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
A0A2K5CWZ4_BCL2L2-      tccgatgaacttttccaagggggccctaactggggccgccttgtagcctt
G3TMU7_BCL2L2-01        tctgatgaactcttccaagggggccccaactggggccgccttgtggcctt
O88996_BCL2L2-01        tccgacgaacttttccaagggggccccaactggggccgtcttgtggcatt
Q7TS60_BCL2L2-01        tccgacgaacttttccaagggggccccaactggggccgtcttgtggcatt
I3ND50_BCL2L2-01        tctgacgaacttttccaagggggtcccaactggggtcgtcttgtggcctt
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        tccgacgaacttttccaagggggccctaactggggccgtcttgtggcatt
                                                                          

F6TEC3_BCL2L2-01        ttttgtttttggtgccgcactgtgtgctgagagtgtcaacaaggagatgt
Q5XGJ4_BCL2L2-01        ttttgtttttggtgccgcactgtgtgctgagagtgtcaacaaggagatgt
H3AAS7_BCL2L2-01        gttcgtcttcagcgcagcactctgtgtggagagcgtggataaggaaatgg
H3AAS7_BCL2L2-02        gttcgtcttcagcgcagcactctgtgtggagagcgtggataaggaaatgg
F7G6M3_BCL2L2-01        cttcgtgttcggggccgcgctctgcgccgagagcgtcaacaaggagatgg
F6U940_BCL2L2-01        cttcgtctttggggcagcgctctgtgcagagagtgtcaacaaagagatgg
G3WPT2_BCL2L2-02        cttcgtctttggggcagcgctctgtgcagagagcgtcaacaaagagatgg
G3WPT2_BCL2L2-01        cttcgtctttggggcagcgctctgtgcagagagcgtcaacaaagagatgg
G1Q051_BCL2L2-01        ctttgtctttggagctgctctgtgtgttgagagtgtcaacaaggagatgg
A0A1U7RC37_BCL2L2-      ctttgtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatgg
D3Z5F7_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
P70345_BCL2L2-04        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
G1TV33_BCL2L2-01        ctttgcctttggggccgcactgtgtgctgagagcgtcaacaaggagatgg
G1P3J2_BCL2L2-01        ctttgtctttggagctgctctgtgtgctgagagtgtcaacaaggagatgg
A0A2K6GWN0_BCL2L2-      cttcgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R9A7B2_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
H2Q805_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I2YPX6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G1RYB4_BCL2L2-01        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-05        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-04        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I3MUE4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5V0Q3_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6AI30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5MZX9_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6EA73_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5HEK7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6MEE6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R8M4C0_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A287AW74_BCL2L2-      ctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatgg
F6PH48_BCL2L2-01        ctttgtctttggagccgcgctgtgtgctgagagtgtcaacaaggagatgg
Q45T69_BCL2L2-01        ctttgtctttggagctgcactgtgtgctgagagtgtcaacaaagagatgg
G1LMC3_BCL2L2-01        ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatgg
A0A2I2UAE3_BCL2L2-      ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgg
M3Y5X5_BCL2L2-01        ctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatgg
W5QDH5_BCL2L2-01        ctttgtctttggagccgcattgtgtgctgagagtgtcaacaaggagatgg
W5QDH5_BCL2L2-02        ctttgtctttggagccgcattgtgtgctgagagtgtcaacaaggagatgg
Q05KI8_BCL2L2-01        ctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatgg
Q1RMX3_BCL2L2-01        ctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatgg
A0A1U7RC37_BCL2L2-      ctttgtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatgg
A0A287AW74_BCL2L2-      ctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatgg
A0A286XQQ9_BCL2L2-      ctttgtctttggcgctgccctgtgtgctgagagtgtcaacaaagagatgc
H0XR82_BCL2L2-01        cttcgtctttggggccgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6GWN0_BCL2L2-      cttcgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
I3ND50_BCL2L2-02        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagagatgg
A0A1S3FYD8_BCL2L2-      ctttgtctttggggctgccctgtgtgccgagagtgtcaacaaagaaatgg
A0A2R9A7B2_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
H2Q805_BCL2L2-01        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G1RYB4_BCL2L2-03        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I2YPX6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
Q92843_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5MZX9_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6EA73_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5V0Q3_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-02        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
F7G4L5_BCL2L2-03        ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6AI30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I3MUE4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6RW46_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6MEE6_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A0D9RU30_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5HEK7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2R8M4C0_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K6TM77_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2K5CWZ4_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
G3TMU7_BCL2L2-01        ctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatgg
O88996_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
Q7TS60_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
I3ND50_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagagatgg
P70345_BCL2L2-03        ----------------------------------------------atgg
P70345_BCL2L2-01        ctttgtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatgg
                                                                      *** 

F6TEC3_BCL2L2-01        cccctcttctgccacggattcaggactggatggtgacatatctggagaca
Q5XGJ4_BCL2L2-01        cccctcttctgccacggattcaggactggatggtgacatatctggagaca
H3AAS7_BCL2L2-01        cttcgctggtgggacggattattgactggacagtaacttatgtagagagc
H3AAS7_BCL2L2-02        cttcgctggtgggacggattattgactggacagtaacttatgtagagagc
F7G6M3_BCL2L2-01        agcccctggtggggcaggtgcaggactggatggtggcctacctggacacc
F6U940_BCL2L2-01        agccactggtgggacaggtgcaggactggatggtgacctacctagagaca
G3WPT2_BCL2L2-02        agccactggtgggacaggttcaggattggatggtgacctacctagagaca
G3WPT2_BCL2L2-01        agccactggtgggacaagaaaaaagatatggggtgcacttgaagcaggga
G1Q051_BCL2L2-01        agccacttgtgggacaagtacaggagtggacggtggcctacctggagatg
A0A1U7RC37_BCL2L2-      agccacttgtgggacaagtgcaggattggatggtgacttacctggagaca
D3Z5F7_BCL2L2-01        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
P70345_BCL2L2-04        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
G1TV33_BCL2L2-01        agcccctggtgggacaagtgcaggagtggatggtgacctacctggagacg
G1P3J2_BCL2L2-01        agccacttgtgggacaagtacaggagtggatggtggcctacctggagacg
A0A2K6GWN0_BCL2L2-      agccactggtgggacaagtgcaggagtggatggtggcctacctggagaca
A0A2R9A7B2_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
H2Q805_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I2YPX6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G1RYB4_BCL2L2-01        aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
F7G4L5_BCL2L2-05        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-04        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I3MUE4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5V0Q3_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6AI30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5MZX9_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6EA73_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5HEK7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6MEE6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R8M4C0_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A287AW74_BCL2L2-      agccactcgtgggacaagtgcaggagtggatggtgacctacctggagaca
F6PH48_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagact
Q45T69_BCL2L2-01        agccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
G1LMC3_BCL2L2-01        aaccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
A0A2I2UAE3_BCL2L2-      agccacttgtgggacaagtgcaagagtggatggtggcctacctggagaca
M3Y5X5_BCL2L2-01        agccacttgtgggccaagtgcaagagtggatggtggcctacctggagacg
W5QDH5_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
W5QDH5_BCL2L2-02        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
Q05KI8_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
Q1RMX3_BCL2L2-01        agccacttgtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A1U7RC37_BCL2L2-      agccacttgtgggacaagtgcaggattggatggtgacttacctggagaca
A0A287AW74_BCL2L2-      agccactcgtgggacaagtgcaggagtggatggtgacctacctggagaca
A0A286XQQ9_BCL2L2-      aaccactggtgggccaagtgcaggagtggatggtggcctacctggagacg
H0XR82_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtagcctacctggagaca
A0A2K6GWN0_BCL2L2-      agccactggtgggacaagtgcaggagtggatggtggcctacctggagaca
I3ND50_BCL2L2-02        agccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A1S3FYD8_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R9A7B2_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
H2Q805_BCL2L2-01        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G1RYB4_BCL2L2-03        aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
A0A2I2YPX6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
Q92843_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5MZX9_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6EA73_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5V0Q3_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-02        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
F7G4L5_BCL2L2-03        aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6AI30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2I3MUE4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6RW46_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6MEE6_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A0D9RU30_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5HEK7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2R8M4C0_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K6TM77_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
A0A2K5CWZ4_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
G3TMU7_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtggtctacctggagacg
O88996_BCL2L2-01        agccattggtgggacaagtgcaggattggatggtgacctacctggagaca
Q7TS60_BCL2L2-01        agccattggtgggacaagtgcaggattggatggtgacctacctggagaca
I3ND50_BCL2L2-01        agccactggtgggacaagtgcaggagtggatggtggcctacctggagacg
P70345_BCL2L2-03        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
P70345_BCL2L2-01        agcctttggtgggacaagtgcaggattggatggtggcctacctggagaca
                           *  *  **   *           *     **    *      *    

F6TEC3_BCL2L2-01        aacctgagagactggattcagagca--atggaggctg-------------
Q5XGJ4_BCL2L2-01        aacctgagagactggattcagagca--atggaggctg-------------
H3AAS7_BCL2L2-01        agccttcaggattggatcaaccaca--gtggaggatg-------------
H3AAS7_BCL2L2-02        agccttcaggattggatcaaccaca--gtggaggatg-------------
F7G6M3_BCL2L2-01        cagctggccgactggatccgcagca--gcgggggctg-------------
F6U940_BCL2L2-01        cagctggcagactggatccacagca--gtgggggctg-------------
G3WPT2_BCL2L2-02        cagctggcagactggatccacagca--gcgggggctg-------------
G3WPT2_BCL2L2-01        attttagcaaggtatttaccaagcaaggctggagct--------------
G1Q051_BCL2L2-01        cggctggctgactggatccacagta--ttgggggctg-------------
A0A1U7RC37_BCL2L2-      cgcctggctgactggatccacagca--gtggcggctg-------------
D3Z5F7_BCL2L2-01        cgtctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-04        cgtctggctgactggatccacagca--gtgggggctg-------------
G1TV33_BCL2L2-01        cagctggccggctggatccacagca--ccgggggctg-------------
G1P3J2_BCL2L2-01        cggctggccgactggatccacagta--gtgggggctg-------------
A0A2K6GWN0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2R9A7B2_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
H2Q805_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2YPX6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
G1RYB4_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-05        cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-04        cggctggctgactggatccacagca--gtgggggctggttatcccagatc
A0A2I3MUE4_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5V0Q3_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6AI30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5MZX9_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6EA73_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5HEK7_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6MEE6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2R8M4C0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A287AW74_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
F6PH48_BCL2L2-01        cggctggccgactggatccacagca--gtggaggctg-------------
Q45T69_BCL2L2-01        cggctggccgactggatccacagca--gtgggggctg-------------
G1LMC3_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2UAE3_BCL2L2-      cggctggccgactggattcacagca--gtgggggctg-------------
M3Y5X5_BCL2L2-01        cggctggccgactggatccacagca--gtgggggctg-------------
W5QDH5_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
W5QDH5_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
Q05KI8_BCL2L2-01        aggctggctgactggatccacagca--gtgggggctg-------------
Q1RMX3_BCL2L2-01        aggctggctgactggatccacagca--gtgggggctg-------------
A0A1U7RC37_BCL2L2-      cgcctggctgactggatccacagca--gtggcggctg-------------
A0A287AW74_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A286XQQ9_BCL2L2-      cgcctggccgactggatccacagca--gtgggggctg-------------
H0XR82_BCL2L2-01        cggctggctgactggatccatagca--gtggtggctg-------------
A0A2K6GWN0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
I3ND50_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
A0A1S3FYD8_BCL2L2-      cgcctggccgactggatccacagca--gtgggggctg-------------
A0A2R9A7B2_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
H2Q805_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
G1RYB4_BCL2L2-03        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I2YPX6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
Q92843_BCL2L2-02        cagctggctgactggatccacagca--gtgggggctg-------------
A0A2K5MZX9_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6EA73_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5V0Q3_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-02        cggctggctgactggatccacagca--gtgggggctg-------------
F7G4L5_BCL2L2-03        cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6AI30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2I3MUE4_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6RW46_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K6MEE6_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A0D9RU30_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2K5HEK7_BCL2L2-      cggctggctgactggatccacagca--gtgggggctg-------------
A0A2R8M4C0_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K6TM77_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
A0A2K5CWZ4_BCL2L2-      cggctggccgactggatccacagca--gtgggggctg-------------
G3TMU7_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
O88996_BCL2L2-01        cgcttggctgactggatccacagca--gtgggggctg-------------
Q7TS60_BCL2L2-01        cgcttggctgactggatccacagca--gtgggggctg-------------
I3ND50_BCL2L2-01        cggctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-03        cgtctggctgactggatccacagca--gtgggggctg-------------
P70345_BCL2L2-01        cgtctggctgactggatccacagca--gtgggggctg-------------
                            *       *   *       *     *  * *              

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------
F7G4L5_BCL2L2-04        actgaagctgagatggctgatgaagtaatttgcagtgaaattttaagcga
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        ---------------------------------gaat------ggatttc
Q5XGJ4_BCL2L2-01        ---------------------------------gaat------ggatttc
H3AAS7_BCL2L2-01        ---------------------------------gagt------gctttcg
H3AAS7_BCL2L2-02        ---------------------------------gagt------gctttcg
F7G6M3_BCL2L2-01        ---------------------------------ggcg------gagttca
F6U940_BCL2L2-01        ---------------------------------ggcg------gaattca
G3WPT2_BCL2L2-02        ---------------------------------ggcg------gaattca
G3WPT2_BCL2L2-01        ----------------------------------gcg------gaattca
G1Q051_BCL2L2-01        ---------------------------------ggca------gagttca
A0A1U7RC37_BCL2L2-      ---------------------------------ggagctagaagcgatca
D3Z5F7_BCL2L2-01        ---------------------------------ggagctagaagcgatca
P70345_BCL2L2-04        ---------------------------------gg---------------
G1TV33_BCL2L2-01        ---------------------------------ggcg------gagttca
G1P3J2_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2K6GWN0_BCL2L2-      ---------------------------------ggagctggaagccatca
A0A2R9A7B2_BCL2L2-      ---------------------------------ggagctggaagctatca
H2Q805_BCL2L2-02        ---------------------------------ggagctggaagctatca
A0A2I2YPX6_BCL2L2-      ---------------------------------ggagctggaagctatca
G1RYB4_BCL2L2-01        ---------------------------------ggagctggaagctatca
F7G4L5_BCL2L2-05        ---------------------------------ggagctggaagctatca
F7G4L5_BCL2L2-04        ctgtgactctgctccaagttccccagatctcgaggagctggaagctatca
A0A2I3MUE4_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5V0Q3_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6AI30_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5MZX9_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6EA73_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5HEK7_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6MEE6_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6RW46_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2R8M4C0_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A2K6TM77_BCL2L2-      ---------------------------------ggagctggaagctatca
A0A287AW74_BCL2L2-      ---------------------------------ggagctggaagcgatca
F6PH48_BCL2L2-01        ---------------------------------ggcg------gagttca
Q45T69_BCL2L2-01        ---------------------------------ggcg------gagttca
G1LMC3_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2I2UAE3_BCL2L2-      ---------------------------------ggcg------gagttca
M3Y5X5_BCL2L2-01        ---------------------------------ggcg------gagttca
W5QDH5_BCL2L2-01        ---------------------------------ggagctggaagcgatca
W5QDH5_BCL2L2-02        ---------------------------------ggcg------gagttca
Q05KI8_BCL2L2-01        ---------------------------------ggcg------gagttca
Q1RMX3_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A1U7RC37_BCL2L2-      ---------------------------------ggcg------gagttca
A0A287AW74_BCL2L2-      ---------------------------------ggcg------gagttca
A0A286XQQ9_BCL2L2-      ---------------------------------ggcg------gagttca
H0XR82_BCL2L2-01        ---------------------------------ggcg------gagttca
A0A2K6GWN0_BCL2L2-      ---------------------------------ggcg------gagttca
I3ND50_BCL2L2-02        ---------------------------------g----------------
A0A1S3FYD8_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2R9A7B2_BCL2L2-      ---------------------------------ggcg------gagttca
H2Q805_BCL2L2-01        ---------------------------------ggcg------gagttca
G1RYB4_BCL2L2-03        ---------------------------------ggcg------gagttca
A0A2I2YPX6_BCL2L2-      ---------------------------------ggcg------gagttca
Q92843_BCL2L2-02        ---------------------------------ggcg------gagttca
A0A2K5MZX9_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6EA73_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5V0Q3_BCL2L2-      ---------------------------------ggcg------gagttca
F7G4L5_BCL2L2-02        ---------------------------------ggcg------gagttca
F7G4L5_BCL2L2-03        ---------------------------------ggcg------gagttca
A0A2K6AI30_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2I3MUE4_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6RW46_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6RW46_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6MEE6_BCL2L2-      ---------------------------------ggcg------gagttca
A0A0D9RU30_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5HEK7_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2R8M4C0_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6TM77_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K6TM77_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggcg------gagttca
A0A2K5CWZ4_BCL2L2-      ---------------------------------ggcg------gagttca
G3TMU7_BCL2L2-01        ---------------------------------ggcg------gagttca
O88996_BCL2L2-01        ---------------------------------ggcg------gagttca
Q7TS60_BCL2L2-01        ---------------------------------ggcg------gagttca
I3ND50_BCL2L2-01        ---------------------------------ggcg------gagttca
P70345_BCL2L2-03        ---------------------------------ggcg------gagttca
P70345_BCL2L2-01        ---------------------------------ggcg------gagttca
                                                                          

F6TEC3_BCL2L2-01        taactcta--tatggggat----ggtgccatagaagaggccaggaggcag
Q5XGJ4_BCL2L2-01        taactcta--tatggggat----ggtgccatagaagaggccaggaggcag
H3AAS7_BCL2L2-01        tgtgtctg--tatgggaat----ggtgcagtgggcggagccaggaggttt
H3AAS7_BCL2L2-02        tgtgtctg--tatgggaat----ggtgcagtgggcggagccaggaggttt
F7G6M3_BCL2L2-01        cggccctg--tacggggac----ggggccctggaggacgcccggcgcctg
F6U940_BCL2L2-01        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G3WPT2_BCL2L2-02        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G3WPT2_BCL2L2-01        cggctctg--tacggggat----ggggccctggaggaggcaaggcgtctg
G1Q051_BCL2L2-01        cagctcta--tacggg----------------------------------
A0A1U7RC37_BCL2L2-      aagcccgagtcagggagatggaggaggaggctgagaagctaaaggagcta
D3Z5F7_BCL2L2-01        aagctcgagtcagggagatggaggaagaggctgagaagctaaaggagcta
P70345_BCL2L2-04        -------------------------------taagaag------------
G1TV33_BCL2L2-01        cagctctg--tacggggat----cgggccctggaggaggcgcggcgtctg
G1P3J2_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggctcgacgcctg
A0A2K6GWN0_BCL2L2-      aagctcgggtcagggagatggaggaagaagctgagaagttaaaagagcta
A0A2R9A7B2_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
H2Q805_BCL2L2-02        aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2I2YPX6_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
G1RYB4_BCL2L2-01        aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
F7G4L5_BCL2L2-05        aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
F7G4L5_BCL2L2-04        aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2I3MUE4_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K5V0Q3_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K6AI30_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K5MZX9_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K6EA73_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K5HEK7_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K6MEE6_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2K6RW46_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
A0A2R8M4C0_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggaacta
A0A2K5CWZ4_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaagaacta
A0A2K6TM77_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggaacta
A0A287AW74_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggagcta
F6PH48_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q45T69_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G1LMC3_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I2UAE3_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
M3Y5X5_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
W5QDH5_BCL2L2-01        aagctcgagttagggagatggaggaagaagctgagaagctaaaggagcta
W5QDH5_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q05KI8_BCL2L2-01        cagctcta--tacggggtc----ggggccctggaggaggcgcggcgtctg
Q1RMX3_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A1U7RC37_BCL2L2-      cagctctg--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A287AW74_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A286XQQ9_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
H0XR82_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggctcggcgtctg
A0A2K6GWN0_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
I3ND50_BCL2L2-02        ctgttctc--cagggggaatatgggggctctg-----------------a
A0A1S3FYD8_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2R9A7B2_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
H2Q805_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G1RYB4_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I2YPX6_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
Q92843_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5MZX9_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6EA73_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5V0Q3_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
F7G4L5_BCL2L2-02        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
F7G4L5_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6AI30_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2I3MUE4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6RW46_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6RW46_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6MEE6_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A0D9RU30_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5HEK7_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2R8M4C0_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6TM77_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K6TM77_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5CWZ4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
A0A2K5CWZ4_BCL2L2-      cagctcta--tacggggac----ggggccctggaggaggcgcggcgtctg
G3TMU7_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
O88996_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
Q7TS60_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
I3ND50_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
P70345_BCL2L2-03        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
P70345_BCL2L2-01        cagctcta--tacggggac----ggggccctggaggaggcacggcgtctg
                                                                          

F6TEC3_BCL2L2-01        cgtgagggg----------aattgggcatcac------tgaagactgtct
Q5XGJ4_BCL2L2-01        cgtgagggg----------aattgggcatcac------tgaagactgtct
H3AAS7_BCL2L2-01        caggaaggc----------tactggtcatcca------tgaagacggttg
H3AAS7_BCL2L2-02        caggaaggc----------tactggtcatcca------tgaagacggttg
F7G6M3_BCL2L2-01        cgggagggc----------aactgggcctccg------tccggaccgtgc
F6U940_BCL2L2-01        cgggagggg----------aactgggcctcag------tgcgaacagtgc
G3WPT2_BCL2L2-02        cgggagggg----------aactgggcctcag------tgcgtacagtgc
G3WPT2_BCL2L2-01        cgggagggg----------aactgggcctcag------tgcgtacagtgc
G1Q051_BCL2L2-01        -------------------aactgggcctcag------tgaggacagtgc
A0A1U7RC37_BCL2L2-      caaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgc
D3Z5F7_BCL2L2-01        caaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgc
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        cgggagggg----------acctgggcgtcag------tgaggacagtgc
G1P3J2_BCL2L2-01        cgggagggg----------aactgggcctcag------tgaggacagtgc
A0A2K6GWN0_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2R9A7B2_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgc
H2Q805_BCL2L2-02        cagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgc
A0A2I2YPX6_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
G1RYB4_BCL2L2-01        cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
F7G4L5_BCL2L2-05        cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
F7G4L5_BCL2L2-04        cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2I3MUE4_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K5V0Q3_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K6AI30_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K5MZX9_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K6EA73_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K5HEK7_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K6MEE6_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K6RW46_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2R8M4C0_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K5CWZ4_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K6TM77_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A287AW74_BCL2L2-      cagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgc
F6PH48_BCL2L2-01        cgggagggg----------aactgggcctcag------tgaggacagtgc
Q45T69_BCL2L2-01        cgggagggg----------aactgggcctcag------tgaggacagtgc
G1LMC3_BCL2L2-01        cgggagggg----------aactgggcctcag------tgaggacagtgc
A0A2I2UAE3_BCL2L2-      cgggagggg----------aactgggcctcag------tgaggacagtgc
M3Y5X5_BCL2L2-01        cgggagggg----------aactgggcctcag------tgaggacagtgc
W5QDH5_BCL2L2-01        cagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgc
W5QDH5_BCL2L2-02        cgggagggg----------aactgggcttcag------tgaggacagtgc
Q05KI8_BCL2L2-01        cgggagggg----------aactgggcttcag------tgaggacagtgc
Q1RMX3_BCL2L2-01        cgggagggg----------aactgggcttcag------tgaggacagtgc
A0A1U7RC37_BCL2L2-      cgggagggg----------aactgggcctcag------tgaggacagtgc
A0A287AW74_BCL2L2-      cgggagggg----------aactgggcctcag------tgaggacagtgc
A0A286XQQ9_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
H0XR82_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6GWN0_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
I3ND50_BCL2L2-02        ttggagg--------------ctgg--------------gacagctgtgc
A0A1S3FYD8_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2R9A7B2_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
H2Q805_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
G1RYB4_BCL2L2-03        cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2I2YPX6_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
Q92843_BCL2L2-02        cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K5MZX9_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6EA73_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K5V0Q3_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
F7G4L5_BCL2L2-02        cgggagggg----------aactgggcatcag------tgaggacagtgc
F7G4L5_BCL2L2-03        cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6AI30_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2I3MUE4_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6RW46_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6RW46_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6MEE6_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A0D9RU30_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K5HEK7_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2R8M4C0_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6TM77_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K6TM77_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K5CWZ4_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
A0A2K5CWZ4_BCL2L2-      cgggagggg----------aactgggcatcag------tgaggacagtgc
G3TMU7_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
O88996_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
Q7TS60_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
I3ND50_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
P70345_BCL2L2-03        cgggagggg----------aactgggcatcag------tgaggacagtgc
P70345_BCL2L2-01        cgggagggg----------aactgggcatcag------tgaggacagtgc
                                                                          

F6TEC3_BCL2L2-01        taac-----------------------------tggagcag---------
Q5XGJ4_BCL2L2-01        taac-----------------------------tggagcag---------
H3AAS7_BCL2L2-01        tgac-----------------------------gggggctg---------
H3AAS7_BCL2L2-02        tgac-----------------------------gggggctg---------
F7G6M3_BCL2L2-01        tgac-----------------------------gggggccg---------
F6U940_BCL2L2-01        taac-----------------------------aggggctg---------
G3WPT2_BCL2L2-02        taac-----------------------------aggggctg---------
G3WPT2_BCL2L2-01        taac-----------------------------aggggctg---------
G1Q051_BCL2L2-01        tgac-----------------------------gggggccc---------
A0A1U7RC37_BCL2L2-      tggcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgtt
D3Z5F7_BCL2L2-01        tggcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgct
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        tgac-----------------------------gggggccg---------
G1P3J2_BCL2L2-01        tgac-----------------------------gggggccg---------
A0A2K6GWN0_BCL2L2-      tggtccagtgatcatgtccattgaagagaaaatggaggctgatgcccgtt
A0A2R9A7B2_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
H2Q805_BCL2L2-02        tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2I2YPX6_BCL2L2-      tggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
G1RYB4_BCL2L2-01        tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
F7G4L5_BCL2L2-05        tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
F7G4L5_BCL2L2-04        tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2I3MUE4_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5V0Q3_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6AI30_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5MZX9_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6EA73_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5HEK7_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6MEE6_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6RW46_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2R8M4C0_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5CWZ4_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6TM77_BCL2L2-      tggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A287AW74_BCL2L2-      tggcccagttatcatgtccattgaggagaagatggaggcagatgcccgat
F6PH48_BCL2L2-01        tgac-----------------------------aggggccg---------
Q45T69_BCL2L2-01        tgac-----------------------------gggggccg---------
G1LMC3_BCL2L2-01        tgac-----------------------------aggggccg---------
A0A2I2UAE3_BCL2L2-      tgac-----------------------------aggggccg---------
M3Y5X5_BCL2L2-01        tgac-----------------------------aggggccg---------
W5QDH5_BCL2L2-01        tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
W5QDH5_BCL2L2-02        tgac-----------------------------gggggccg---------
Q05KI8_BCL2L2-01        tgac-----------------------------gggggctg---------
Q1RMX3_BCL2L2-01        tgac-----------------------------gggggctg---------
A0A1U7RC37_BCL2L2-      tgac-----------------------------gggggccg---------
A0A287AW74_BCL2L2-      tgac-----------------------------gggggccg---------
A0A286XQQ9_BCL2L2-      tgac-----------------------------aggggccg---------
H0XR82_BCL2L2-01        tgac-----------------------------aggggccg---------
A0A2K6GWN0_BCL2L2-      tgac-----------------------------aggggccg---------
I3ND50_BCL2L2-02        tggg-----------------------------aagga------------
A0A1S3FYD8_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2R9A7B2_BCL2L2-      tgac-----------------------------gggggccg---------
H2Q805_BCL2L2-01        tgac-----------------------------gggggccg---------
G1RYB4_BCL2L2-03        tgac-----------------------------gggggccg---------
A0A2I2YPX6_BCL2L2-      tgac-----------------------------gggggccg---------
Q92843_BCL2L2-02        tgac-----------------------------gggggccg---------
A0A2K5MZX9_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K6EA73_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K5V0Q3_BCL2L2-      tgac-----------------------------gggggccg---------
F7G4L5_BCL2L2-02        tgac-----------------------------gggggccg---------
F7G4L5_BCL2L2-03        tgac-----------------------------gggggccg---------
A0A2K6AI30_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2I3MUE4_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K6RW46_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K6RW46_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K6MEE6_BCL2L2-      tgac-----------------------------gggggccg---------
A0A0D9RU30_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2K5HEK7_BCL2L2-      tgac-----------------------------gggggccg---------
A0A2R8M4C0_BCL2L2-      tgac-----------------------------aggggccg---------
A0A2K6TM77_BCL2L2-      tgac-----------------------------aggggccg---------
A0A2K6TM77_BCL2L2-      tgac-----------------------------aggggccg---------
A0A2K5CWZ4_BCL2L2-      tgac-----------------------------aggggccg---------
A0A2K5CWZ4_BCL2L2-      tgac-----------------------------aggggccg---------
G3TMU7_BCL2L2-01        tgac-----------------------------gggggctg---------
O88996_BCL2L2-01        tgac-----------------------------gggggctg---------
Q7TS60_BCL2L2-01        tgac-----------------------------gggggctg---------
I3ND50_BCL2L2-01        tgac-----------------------------gggggccg---------
P70345_BCL2L2-03        tgac-----------------------------gggggccg---------
P70345_BCL2L2-01        tgac-----------------------------gggggccg---------
                                                                          

F6TEC3_BCL2L2-01        ----------tagct----------ctgggtgctttaat-----------
Q5XGJ4_BCL2L2-01        ----------tagct----------ctgggtgctttaat-----------
H3AAS7_BCL2L2-01        ----------tggcg----------ctaggggcggtgat-----------
H3AAS7_BCL2L2-02        ----------tggcg----------ctaggggcggtgat-----------
F7G6M3_BCL2L2-01        ----------tggcg----------ctgggagccctggt-----------
F6U940_BCL2L2-01        ----------tagca----------ctgggggctctggt-----------
G3WPT2_BCL2L2-02        ----------tggca----------ctgggggctctggt-----------
G3WPT2_BCL2L2-01        ----------tggca----------ctgggggctctggt-----------
G1Q051_BCL2L2-01        ----------tggca----------ctaagggccttgtt-----------
A0A1U7RC37_BCL2L2-      ctatctatgttggca----------atgtggactatggtgcgacagcaga
D3Z5F7_BCL2L2-01        ctatctacgttggca----------atgtggactatggtgcaacagcaga
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
G1P3J2_BCL2L2-01        ----------tggca----------ctaggggccttggt-----------
A0A2K6GWN0_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2R9A7B2_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
H2Q805_BCL2L2-02        ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2I2YPX6_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
G1RYB4_BCL2L2-01        ccatctatgttggca----------atgtggactatggtgcaacagcaga
F7G4L5_BCL2L2-05        ccatctatgttggca----------atgtggactatggtgcaacagcaga
F7G4L5_BCL2L2-04        ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2I3MUE4_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K5V0Q3_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K6AI30_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K5MZX9_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K6EA73_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K5HEK7_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K6MEE6_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K6RW46_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2R8M4C0_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K5CWZ4_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A2K6TM77_BCL2L2-      ccatctatgttggca----------atgtggactatggtgcaacagcaga
A0A287AW74_BCL2L2-      ctatctatgttggca----------atgtggactatggtgcaacagcaga
F6PH48_BCL2L2-01        ----------tggca----------ttgggggccctggt-----------
Q45T69_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
G1LMC3_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
A0A2I2UAE3_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
M3Y5X5_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
W5QDH5_BCL2L2-01        ccatctatgttggca----------atgtggactatggtgcaacagcaga
W5QDH5_BCL2L2-02        ----------tggcactttcgctagctgagggctctggc-----------
Q05KI8_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
Q1RMX3_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
A0A1U7RC37_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A287AW74_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A286XQQ9_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
H0XR82_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
A0A2K6GWN0_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
I3ND50_BCL2L2-02        -----------ggca----------t------------------------
A0A1S3FYD8_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2R9A7B2_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
H2Q805_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
G1RYB4_BCL2L2-03        ----------tggca----------ctgggggccctggt-----------
A0A2I2YPX6_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
Q92843_BCL2L2-02        ----------tggca----------ctgggggccctggt-----------
A0A2K5MZX9_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6EA73_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K5V0Q3_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
F7G4L5_BCL2L2-02        ----------tggca----------ctgggggccctggt-----------
F7G4L5_BCL2L2-03        ----------tggca----------ctgggggccctggt-----------
A0A2K6AI30_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2I3MUE4_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6RW46_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6RW46_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6MEE6_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A0D9RU30_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K5HEK7_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2R8M4C0_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6TM77_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K6TM77_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K5CWZ4_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
A0A2K5CWZ4_BCL2L2-      ----------tggca----------ctgggggccctggt-----------
G3TMU7_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
O88996_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
Q7TS60_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
I3ND50_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
P70345_BCL2L2-03        ----------tggca----------ctgggggccctggt-----------
P70345_BCL2L2-01        ----------tggca----------ctgggggccctggt-----------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      agagctggaagcccactttcatggctgtggttcagtcaaccgtgtcacta
D3Z5F7_BCL2L2-01        agagctggaagcccattttcatggctgtggttcagtcaaccgtgttacta
P70345_BCL2L2-04        ---------------ttctca----------------------attgctg
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      agagctggaagctcactttcatggttgtggttcagtcaaccgtgttacca
A0A2R9A7B2_BCL2L2-      agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
H2Q805_BCL2L2-02        agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
A0A2I2YPX6_BCL2L2-      agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
G1RYB4_BCL2L2-01        agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
F7G4L5_BCL2L2-05        agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
F7G4L5_BCL2L2-04        agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2I3MUE4_BCL2L2-      agagttggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K5V0Q3_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K6AI30_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K5MZX9_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K6EA73_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K5HEK7_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K6MEE6_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2K6RW46_BCL2L2-      agagctggaagctcactttcatggctgtggatcagtcaaccgtgttacca
A0A2R8M4C0_BCL2L2-      agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
A0A2K5CWZ4_BCL2L2-      agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
A0A2K6TM77_BCL2L2-      agagctggaagctcactttcatggctgtggttcagtcaaccgtgttacca
A0A287AW74_BCL2L2-      agagctggaagcacactttcatggctgtggttcagtcaaccgcgttacta
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        agagctagaagcacacttccatggctgtggttcagtcaaccgcgttacta
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        -----------gacagtaggagcctt------------------------
Q5XGJ4_BCL2L2-01        -----------gacagtaggagcctt------------------------
H3AAS7_BCL2L2-01        -----------gacggtcggagcgct------------------------
H3AAS7_BCL2L2-02        -----------gacggtcggagcgct------------------------
F7G6M3_BCL2L2-01        -----------gaccgtcggggcctt------------------------
F6U940_BCL2L2-01        -----------gactgtgggggcctt------------------------
G3WPT2_BCL2L2-02        -----------gactgtgggggcctt------------------------
G3WPT2_BCL2L2-01        -----------gactgtgggggcctt------------------------
G1Q051_BCL2L2-01        -----------aactgtaggagcatt------------------------
A0A1U7RC37_BCL2L2-      tactctgtgacaaatttagcggccatcctaaagggtttgcatatatagag
D3Z5F7_BCL2L2-01        tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
P70345_BCL2L2-04        ctctccg----------------catccc------tctacaaagttggtc
G1TV33_BCL2L2-01        -----------aactgtaggggcctt------------------------
G1P3J2_BCL2L2-01        -----------aactgtaggagcatt------------------------
A0A2K6GWN0_BCL2L2-      tactgtgtgacaaatttagtggccatcccaaagggtttgcatatatagag
A0A2R9A7B2_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
H2Q805_BCL2L2-02        tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
A0A2I2YPX6_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
G1RYB4_BCL2L2-01        tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
F7G4L5_BCL2L2-05        tactctgtgacaaatttagtggccatcctaaaggatttgcgtatatagag
F7G4L5_BCL2L2-04        tactctgtgacaaatttagtggccatcctaaaggatttgcgtatatagag
A0A2I3MUE4_BCL2L2-      tactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagag
A0A2K5V0Q3_BCL2L2-      tactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagag
A0A2K6AI30_BCL2L2-      tactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagag
A0A2K5MZX9_BCL2L2-      tactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagag
A0A2K6EA73_BCL2L2-      tactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagag
A0A2K5HEK7_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
A0A2K6MEE6_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
A0A2K6RW46_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
A0A2R8M4C0_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
A0A2K5CWZ4_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
A0A2K6TM77_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
A0A287AW74_BCL2L2-      tactctgtgacaaatttagtggccatcccaaagggtttgcatatatagag
F6PH48_BCL2L2-01        -----------aactgtaggggcctt------------------------
Q45T69_BCL2L2-01        -----------caccgtaggggcctt------------------------
G1LMC3_BCL2L2-01        -----------aactgtaggggcctt------------------------
A0A2I2UAE3_BCL2L2-      -----------aactgtaggggcctt------------------------
M3Y5X5_BCL2L2-01        -----------aactgtaggggcctt------------------------
W5QDH5_BCL2L2-01        tactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagag
W5QDH5_BCL2L2-02        -----------cg----------ctt------------------------
Q05KI8_BCL2L2-01        -----------aactgtaggggcctt------------------------
Q1RMX3_BCL2L2-01        -----------aactgtaggggcctt------------------------
A0A1U7RC37_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A287AW74_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A286XQQ9_BCL2L2-      -----------aactgtaggggcctt------------------------
H0XR82_BCL2L2-01        -----------aactgtaggggcctt------------------------
A0A2K6GWN0_BCL2L2-      -----------aactgtaggggcctt------------------------
I3ND50_BCL2L2-02        ------------------ggggc---------------------------
A0A1S3FYD8_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2R9A7B2_BCL2L2-      -----------aactgtaggggcctt------------------------
H2Q805_BCL2L2-01        -----------aactgtaggggcctt------------------------
G1RYB4_BCL2L2-03        -----------aactgtaggggcctt------------------------
A0A2I2YPX6_BCL2L2-      -----------aactgtaggggcctt------------------------
Q92843_BCL2L2-02        -----------aactgtaggggcctt------------------------
A0A2K5MZX9_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6EA73_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K5V0Q3_BCL2L2-      -----------aactgtaggggcctt------------------------
F7G4L5_BCL2L2-02        -----------aactgtaggggcctt------------------------
F7G4L5_BCL2L2-03        -----------aactgtaggggcctt------------------------
A0A2K6AI30_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2I3MUE4_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6RW46_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6RW46_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6MEE6_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A0D9RU30_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K5HEK7_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2R8M4C0_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6TM77_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K6TM77_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K5CWZ4_BCL2L2-      -----------aactgtaggggcctt------------------------
A0A2K5CWZ4_BCL2L2-      -----------aactgtaggggcctt------------------------
G3TMU7_BCL2L2-01        -----------aactgtaggggcctt------------------------
O88996_BCL2L2-01        -----------aactgtaggggcctt------------------------
Q7TS60_BCL2L2-01        -----------aactgtaggggcctt------------------------
I3ND50_BCL2L2-01        -----------aactgtaggggcctt------------------------
P70345_BCL2L2-03        -----------aactgtaggggcctt------------------------
P70345_BCL2L2-01        -----------aactgtaggggcctt------------------------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      ttctcagacaaagagtcggtgaggacttccctggccttagacgagtccct
D3Z5F7_BCL2L2-01        ttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccct
P70345_BCL2L2-04        ttcatgggaaaatag-----------------ggcctctgatggg-----
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      ttctcagacaaagagtcagtgaggacttccctggccttagatgagtccct
A0A2R9A7B2_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
H2Q805_BCL2L2-02        ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2I2YPX6_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
G1RYB4_BCL2L2-01        ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
F7G4L5_BCL2L2-05        ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
F7G4L5_BCL2L2-04        ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2I3MUE4_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K5V0Q3_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K6AI30_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K5MZX9_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K6EA73_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K5HEK7_BCL2L2-      ttctcagacaaagagtcagtgaggacgtccttggccttagatgagtccct
A0A2K6MEE6_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K6RW46_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2R8M4C0_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K5CWZ4_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
A0A2K6TM77_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagacgagtccct
A0A287AW74_BCL2L2-      ttctcagacaaagagtcagtgaggacttccttggccttagatgagtccct
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        ttctcagacaaagagtcagtgaggacttccctggccttagatgaatcctt
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      gtttagaggaagacaaatca------------------------------
D3Z5F7_BCL2L2-01        gttcagaggaagacaaatca------------------------------
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      gtttagaggaagacaaatcaaggtaagcctgtgctttccattgtacatcc
A0A2R9A7B2_BCL2L2-      atttagaggaaggcaaatca------------------------------
H2Q805_BCL2L2-02        atttagaggaaggcaaatca------------------------------
A0A2I2YPX6_BCL2L2-      atttagaggaaggcaaatcaaggttgactttaaggctatcatttgttcat
G1RYB4_BCL2L2-01        gtttagaggaaggcaaatca------------------------------
F7G4L5_BCL2L2-05        atttagaggaaggcaaatca------------------------------
F7G4L5_BCL2L2-04        atttagaggaaggcaaatca------------------------------
A0A2I3MUE4_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K5V0Q3_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K6AI30_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K5MZX9_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K6EA73_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K5HEK7_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K6MEE6_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2K6RW46_BCL2L2-      atttagaggaaggcaaatca------------------------------
A0A2R8M4C0_BCL2L2-      atttagaggaaggcagatcaagattgactttaaggctttcatttattcat
A0A2K5CWZ4_BCL2L2-      atttagaggaaggcaaatcaaggttgactttaaggctttcatttattcat
A0A2K6TM77_BCL2L2-      atttagaggacggcaaatcaaggttgactttaaggctttcatttattcat
A0A287AW74_BCL2L2-      atttagaggaagacaaatca------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        atttagaggaagacagatca------------------------------
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      ---------aggtgattcccaaacggaccaacagaccaggcatcagtaca
D3Z5F7_BCL2L2-01        ---------aggtgattcccaaacgaaccaacagaccaggcatcagcaca
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      tttactctcaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2R9A7B2_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
H2Q805_BCL2L2-02        ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2I2YPX6_BCL2L2-      ctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
G1RYB4_BCL2L2-01        ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
F7G4L5_BCL2L2-05        ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
F7G4L5_BCL2L2-04        ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2I3MUE4_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K5V0Q3_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K6AI30_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K5MZX9_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K6EA73_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K5HEK7_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K6MEE6_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K6RW46_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2R8M4C0_BCL2L2-      ctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K5CWZ4_BCL2L2-      ctctgactcaggtgatcccgaaacgaaccaacagaccaggcatcagcaca
A0A2K6TM77_BCL2L2-      ctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A287AW74_BCL2L2-      ---------aggtgatcccaaaacgaaccaacagaccaggcatcagcaca
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        ---------aggtgatccctaaacgaaccaacagaccaggcatcagcaca
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      acagaccggggtttcccgcgtgcccgataccgtgcccggactaccaatta
D3Z5F7_BCL2L2-01        acagaccggggtttcccgcgctcccgataccgtgcccggactaccaacta
P70345_BCL2L2-04        --aggctggggtt------------------gtgctggga----------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      acagaccggggtttcccacgagcccgctaccgtgcccggactaccaacta
A0A2R9A7B2_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
H2Q805_BCL2L2-02        acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2I2YPX6_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
G1RYB4_BCL2L2-01        acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
F7G4L5_BCL2L2-05        acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
F7G4L5_BCL2L2-04        acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2I3MUE4_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K5V0Q3_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K6AI30_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K5MZX9_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K6EA73_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K5HEK7_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K6MEE6_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K6RW46_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2R8M4C0_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcacggaccaccaacta
A0A2K5CWZ4_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcacggaccaccaacta
A0A2K6TM77_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcacggaccaccaacta
A0A287AW74_BCL2L2-      acagaccggggttttccacgagctcgataccgtgcccggaccaccaacta
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        acagaccgaggtttcccacgagcccgataccgtgcccgaaccaccaacta
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        ------------------------------gtttgccagcaag-------
Q5XGJ4_BCL2L2-01        ------------------------------gtttgccagcaag-------
H3AAS7_BCL2L2-01        ------------------------------ttttgccagcaga-------
H3AAS7_BCL2L2-02        ------------------------------ttttgccagcaga-------
F7G6M3_BCL2L2-01        ------------------------------cttcgcgagcaaa-------
F6U940_BCL2L2-01        ------------------------------ctttgccagcaag-------
G3WPT2_BCL2L2-02        ------------------------------ctttgccagcaag-------
G3WPT2_BCL2L2-01        ------------------------------ctttgccagcaag-------
G1Q051_BCL2L2-01        ------------------------------ttttgctagcatg-------
A0A1U7RC37_BCL2L2-      caacagctcccgatctcgattctacagcggttttaacagcaggccccggg
D3Z5F7_BCL2L2-01        caacagctcccgatctcgattctacagtggttttaacagcaggccccggg
P70345_BCL2L2-04        --------------------------------------------------
G1TV33_BCL2L2-01        ------------------------------ttttgctagcaaa-------
G1P3J2_BCL2L2-01        ------------------------------ttttgctagcaag-------
A0A2K6GWN0_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2R9A7B2_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
H2Q805_BCL2L2-02        caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2I2YPX6_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
G1RYB4_BCL2L2-01        caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
F7G4L5_BCL2L2-05        caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
F7G4L5_BCL2L2-04        caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2I3MUE4_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K5V0Q3_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K6AI30_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K5MZX9_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K6EA73_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K5HEK7_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K6MEE6_BCL2L2-      caacagttcccgctctcgcttctacagtggttttaacagcaggccccggg
A0A2K6RW46_BCL2L2-      caacagttcccgctctcgcttctacagtggttttaacagcaggccccggg
A0A2R8M4C0_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K5CWZ4_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K6TM77_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A287AW74_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
F6PH48_BCL2L2-01        ------------------------------ttttgctagcaag-------
Q45T69_BCL2L2-01        ------------------------------ttttgcgagcaag-------
G1LMC3_BCL2L2-01        ------------------------------ttttgctagcaag-------
A0A2I2UAE3_BCL2L2-      ------------------------------ttttgctagcaag-------
M3Y5X5_BCL2L2-01        ------------------------------ttttgctagcaag-------
W5QDH5_BCL2L2-01        caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
W5QDH5_BCL2L2-02        ------------------------------ttttgc-agaaag-------
Q05KI8_BCL2L2-01        ------------------------------ttttgctagcaag-------
Q1RMX3_BCL2L2-01        ------------------------------ttttgctagcaag-------
A0A1U7RC37_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A287AW74_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A286XQQ9_BCL2L2-      ------------------------------ttttgctagcaag-------
H0XR82_BCL2L2-01        ------------------------------ttttgctagcaag-------
A0A2K6GWN0_BCL2L2-      ------------------------------tttcgctagcaag-------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2R9A7B2_BCL2L2-      ------------------------------ttttgctagcaag-------
H2Q805_BCL2L2-01        ------------------------------ttttgctagcaag-------
G1RYB4_BCL2L2-03        ------------------------------ttttgctagcaag-------
A0A2I2YPX6_BCL2L2-      ------------------------------ttttgctagcaag-------
Q92843_BCL2L2-02        ------------------------------ttttgctagcaag-------
A0A2K5MZX9_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6EA73_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K5V0Q3_BCL2L2-      ------------------------------ttttgctagcaag-------
F7G4L5_BCL2L2-02        ------------------------------ttttgctagcaag-------
F7G4L5_BCL2L2-03        ------------------------------ttttgctagcaag-------
A0A2K6AI30_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2I3MUE4_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6RW46_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6RW46_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6MEE6_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A0D9RU30_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K5HEK7_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2R8M4C0_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6TM77_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K6TM77_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K5CWZ4_BCL2L2-      ------------------------------ttttgctagcaag-------
A0A2K5CWZ4_BCL2L2-      ------------------------------ttttgctagcaag-------
G3TMU7_BCL2L2-01        ------------------------------ttttgctagcaag-------
O88996_BCL2L2-01        ------------------------------ttttgctagcaag-------
Q7TS60_BCL2L2-01        ------------------------------ttttgctagcaag-------
I3ND50_BCL2L2-01        ------------------------------ttttgctagcaag-------
P70345_BCL2L2-03        ------------------------------ttttgctagcaag-------
P70345_BCL2L2-01        ------------------------------ttttgctagcaag-------
                                                                          

F6TEC3_BCL2L2-01        --------------------------------------------------
Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
F6U940_BCL2L2-01        --------------------------------------------------
G3WPT2_BCL2L2-02        --------------------------------------------------
G3WPT2_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      gtcgagtctacaggggccgggctagagcgacatcatggtattccccttac
D3Z5F7_BCL2L2-01        gtcgaatctacaggggccgggctagagcgacatcatggtattccccttac
P70345_BCL2L2-04        -----------aggg----------------------------------c
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2R9A7B2_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
H2Q805_BCL2L2-02        gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2I2YPX6_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
G1RYB4_BCL2L2-01        gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
F7G4L5_BCL2L2-05        gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
F7G4L5_BCL2L2-04        gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2I3MUE4_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K5V0Q3_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K6AI30_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K5MZX9_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K6EA73_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K5HEK7_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K6MEE6_BCL2L2-      gtcgcgtctaca--ggtcaggatag-------------------------
A0A2K6RW46_BCL2L2-      gtcgcgtctaca--ggtcaggatag-------------------------
A0A2R8M4C0_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K5CWZ4_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K6TM77_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A287AW74_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
F6PH48_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
W5QDH5_BCL2L2-01        gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
W5QDH5_BCL2L2-02        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWN0_BCL2L2-      --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
P70345_BCL2L2-03        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
                                                                          

F6TEC3_BCL2L2-01        tga
Q5XGJ4_BCL2L2-01        tga
H3AAS7_BCL2L2-01        taa
H3AAS7_BCL2L2-02        taa
F7G6M3_BCL2L2-01        tga
F6U940_BCL2L2-01        tga
G3WPT2_BCL2L2-02        tga
G3WPT2_BCL2L2-01        tga
G1Q051_BCL2L2-01        tga
A0A1U7RC37_BCL2L2-      taa
D3Z5F7_BCL2L2-01        taa
P70345_BCL2L2-04        tga
G1TV33_BCL2L2-01        tga
G1P3J2_BCL2L2-01        tga
A0A2K6GWN0_BCL2L2-      taa
A0A2R9A7B2_BCL2L2-      taa
H2Q805_BCL2L2-02        taa
A0A2I2YPX6_BCL2L2-      taa
G1RYB4_BCL2L2-01        taa
F7G4L5_BCL2L2-05        taa
F7G4L5_BCL2L2-04        taa
A0A2I3MUE4_BCL2L2-      taa
A0A2K5V0Q3_BCL2L2-      taa
A0A2K6AI30_BCL2L2-      taa
A0A2K5MZX9_BCL2L2-      taa
A0A2K6EA73_BCL2L2-      taa
A0A2K5HEK7_BCL2L2-      taa
A0A2K6MEE6_BCL2L2-      ---
A0A2K6RW46_BCL2L2-      ---
A0A2R8M4C0_BCL2L2-      taa
A0A2K5CWZ4_BCL2L2-      taa
A0A2K6TM77_BCL2L2-      taa
A0A287AW74_BCL2L2-      taa
F6PH48_BCL2L2-01        tga
Q45T69_BCL2L2-01        tga
G1LMC3_BCL2L2-01        tga
A0A2I2UAE3_BCL2L2-      tga
M3Y5X5_BCL2L2-01        tga
W5QDH5_BCL2L2-01        taa
W5QDH5_BCL2L2-02        t--
Q05KI8_BCL2L2-01        tga
Q1RMX3_BCL2L2-01        tga
A0A1U7RC37_BCL2L2-      tga
A0A287AW74_BCL2L2-      tga
A0A286XQQ9_BCL2L2-      tga
H0XR82_BCL2L2-01        tga
A0A2K6GWN0_BCL2L2-      tga
I3ND50_BCL2L2-02        tga
A0A1S3FYD8_BCL2L2-      tga
A0A2R9A7B2_BCL2L2-      tga
H2Q805_BCL2L2-01        tga
G1RYB4_BCL2L2-03        tga
A0A2I2YPX6_BCL2L2-      tga
Q92843_BCL2L2-02        tga
A0A2K5MZX9_BCL2L2-      tga
A0A2K6EA73_BCL2L2-      tga
A0A2K5V0Q3_BCL2L2-      tga
F7G4L5_BCL2L2-02        tga
F7G4L5_BCL2L2-03        tga
A0A2K6AI30_BCL2L2-      tga
A0A2I3MUE4_BCL2L2-      tga
A0A2K6RW46_BCL2L2-      tga
A0A2K6RW46_BCL2L2-      tga
A0A2K6MEE6_BCL2L2-      tga
A0A0D9RU30_BCL2L2-      tga
A0A2K5HEK7_BCL2L2-      tga
A0A2R8M4C0_BCL2L2-      tga
A0A2K6TM77_BCL2L2-      tga
A0A2K6TM77_BCL2L2-      tga
A0A2K5CWZ4_BCL2L2-      tga
A0A2K5CWZ4_BCL2L2-      tga
G3TMU7_BCL2L2-01        tga
O88996_BCL2L2-01        tga
Q7TS60_BCL2L2-01        tga
I3ND50_BCL2L2-01        tga
P70345_BCL2L2-03        tga
P70345_BCL2L2-01        tga
                           

© 1998-2019