Dataset for CDS BCL2L10 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

73 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3P9BLI0_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc
A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc
A0A3P9BLI0_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc
A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      ----------------------------------------------atgt
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------atgtcgagaggcggagtcacacat
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat
A0A3Q2UUN9_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat
A0A3P9BLI0_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat
A0A3Q2UUN9_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      tccaactctcatggggactttttcttctggaggcggagtcagcggataaa
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      ---------------------------atgcgccgaggttctccttccgc
A0A3B3TYN4_BCL2L10      ---------------------------atgcaccgaggttctccttccgc
A0A096ME02_BCL2L10      ---------------------------atgcaccgaggttctccttccgc
A0A3B3YT99_BCL2L10      ---------------------------atgcaccgaggttctccttccgc
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      ------------------------atgtgcaactcagcgtctccttccgc
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       tctctatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3Q2UUN9_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3P9BLI0_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3Q2UUN9_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      tgtgcggacgctgaggggaaactgcgagtgcaccgaggatctccttccgc
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       ------atgggtgtggcggcccctccctgggcggaggcgcagcgggacct
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       -------------------------------------------atg----
D2IT42_BCL2L10-02       -------------------------------------------atg---t
A0A3B5MJ12_BCL2L10      -------------------------------------------atg---t
M4AUW7_BCL2L10-01       -------------------------------------------atg---t
A0A3P9NE65_BCL2L10      cgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatg---t
A0A3B3TYN4_BCL2L10      cgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatg---t
A0A096ME02_BCL2L10      cgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatg---t
A0A3B3YT99_BCL2L10      cgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatg---t
A0A3Q2GL87_BCL2L10      -------atgtgcagagagccgttacatatcactgggaggaaaatg---t
A0A3Q2PJS5_BCL2L10      -------atgtgcagagagccgtcacacatcgctgggaggaaaatg---t
A0A3B3C5I4_BCL2L10      -------------------atggatggtttttctgctcagaaaatg---t
A0A3P9IIZ2_BCL2L10      -------------------------------------------atg---t
A0A3P9LM07_BCL2L10      -------------------------------------------atg---t
H2MBQ3_BCL2L10-01       -------------------------------------------atg---t
A0A3B4AAV4_BCL2L10      -------------------------------------------atg---t
A0A3P8W7K5_BCL2L10      cgtctctacgagctctgagcagtctgatatcgctgggaggaaaatg---t
A0A3Q3VI28_BCL2L10      -------------------------------------------atg---t
A0A3B5KD08_BCL2L10      -------------------------------------------atg---t
A0A3Q3EZT5_BCL2L10      -------atgtgcagagcgcagtctgatatcgctgggaggaaaatg---t
A0A3Q3EZT5_BCL2L10      -------atgtgcagagcgcagtctgatatcgctgggaggaaaatg---t
A0A3Q0S9R1_BCL2L10      -------------------------------------------atg---g
I3J363_BCL2L10-01       cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3B4ETX9_BCL2L10      -------atgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3Q4MN81_BCL2L10      -------atgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3P8PVZ8_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3Q2UUN9_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3P9BLI0_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3Q2UUN9_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3Q3JQ78_BCL2L10      -------atgtgcagagagcaccttgatatcgctgggaggaaaatg---t
A0A3B4TIY6_BCL2L10      -------------------------------------------atg---t
A0A3B4WGF4_BCL2L10      -------------------------------------------atg---t
A0A3Q3KZW1_BCL2L10      -------------------------------------------atg---t
A0A3Q1IAB0_BCL2L10      cgtccgtatgtgcagagagcagactgatatcgctgggaggaaaatg---t
A0A3B4ZFS0_BCL2L10      -------------------------------------------atg---t
A0A3Q1GM98_BCL2L10      -------------------------------------------atg---t
A0A3Q1D2L0_BCL2L10      -------------------------------------------atg---t
A0A3P8RL82_BCL2L10      -------------------------------------------atg---t
A0A1U7QVA0_BCL2L10      -------------------------------------------atg---g
Q9Z0F3_BCL2L10-01       -------------------------------------------atg---g
Q99M66_BCL2L10-01       -------------------------------------------atg---g
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       -------------------------------------------atg---g
W5QIG4_BCL2L10-01       ----------------ggtcggccccccggtagaggcggagccatg---g
E1B9B3_BCL2L10-01       -----------------atga-----ctgaaggc---ggagccatg---g
F1MV39_BCL2L10-01       -----------------gttg-----ctgatggacaggaaagcctg---g
H0WZ06_BCL2L10-01       -------------------------------------------atg---g
G1T264_BCL2L10-01       -------------------------------------------atg---g
A0A2K6F2Q2_BCL2L10      -------------------------------------------atg---g
A0A1U7UZD8_BCL2L10      -------------------------------------------atg---g
A0A2K6TIT7_BCL2L10      -------------------------------------------atg---g
A0A2K5RIU7_BCL2L10      -------------------------------------------atg---g
A0A2K5F974_BCL2L10      -------------------------------------------atg---g
F7CT87_BCL2L10-01       -------------------------------------------atg---g
A0A0D9RG38_BCL2L10      -------------------------------------------atg---g
A0A2K5TKG9_BCL2L10      -------------------------------------------atg---g
F7H6U5_BCL2L10-01       -------------------------------------------atg---g
A0A2K6B2D9_BCL2L10      -------------------------------------------atg---g
A0A2K5MMZ4_BCL2L10      -------------------------------------------atg---g
A0A096NM44_BCL2L10      -------------------------------------------atg---g
A0A2K5K3B0_BCL2L10      -------------atggctgaccagttgcgggagcgcaccaacgtg---g
A0A2K6M5H5_BCL2L10      -------------atggctgacccgttgcgggagcgcaccaccgtg---g
A0A2K6R5T5_BCL2L10      -------------------------------------------atg---g
G1R3W6_BCL2L10-01       -------------atggttgaccagt------------------------
H2NN92_BCL2L10-01       -------------atggttgaccagttgcgggagcgcactatcacg---g
Q9HD36_BCL2L10-02       -------------atggttgaccagttgcgggagcgcaccaccatg---g
G3QLU6_BCL2L10-01       -------------atggttgaccagtggcgggagcgcaccaccatg---g
A0A2R9BCD9_BCL2L10      -------------atggttgaccagtggcgtgagcgcactaccatg---g
H2Q9G4_BCL2L10-01       -------------atggttgaccagtggcgtgagcgcaccaccatg---g
F6ZPD4_BCL2L10-01       ----------------------------------------gccgtg---g
A0A337RYG8_BCL2L10      -------------------------------------------atg---g
M3Y8D1_BCL2L10-01       agaaaaccgggtcgggtcgggcagcgcggggagaggtcgggccatg---g
G1LKR4_BCL2L10-01       -------------------------------------------atg---g
A0A452QJG0_BCL2L10      -------------------------------------------atg---g
                                                                          

F6VJQ0_BCL2L10-01       --gattacaagtgtgctcttagggaagagacggcgcggctggtaactgac
D2IT42_BCL2L10-02       cg---------tgtaggctgtggaaagagaccctggccctgtcagaggac
A0A3B5MJ12_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggttgttgcagaggat
M4AUW7_BCL2L10-01       cc---------tgtgggctgtggaaagagaccgtggttgttgcagaggat
A0A3P9NE65_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgtcgcagaggat
A0A3B3TYN4_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgttgcagaggat
A0A096ME02_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgttgcagaggat
A0A3B3YT99_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgttgcagaggat
A0A3Q2GL87_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgtcgcagaggat
A0A3Q2PJS5_BCL2L10      cc---------tgtgggctgtggaaagagaccgtggctgtcgcagaggat
A0A3B3C5I4_BCL2L10      ct---------tgtgggctgaggaaagagaccctagctgtggccctggat
A0A3P9IIZ2_BCL2L10      ct---------tgtgggctgaggaaagagaccctagctgtggccctggat
A0A3P9LM07_BCL2L10      ct---------tgtgggctgaggaaagagaccctagctgtggccctggat
H2MBQ3_BCL2L10-01       ct---------tgtgggctgaggaaagagaccctagctgtggccctggat
A0A3B4AAV4_BCL2L10      cg---------tgtgggctgtggaaagagaccttggctctggcagaggac
A0A3P8W7K5_BCL2L10      ca---------tgtgggctgtggaaagagaccctggctgtggcagaggac
A0A3Q3VI28_BCL2L10      cg---------tgcgggctgtggaaagagaccctggctctcgcacaggac
A0A3B5KD08_BCL2L10      cg---------tgcgggctgtggaaagagaccctggctcttgcagaggac
A0A3Q3EZT5_BCL2L10      cg---------tgcgggctgtggaaagagaccctggctctggcagaggac
A0A3Q3EZT5_BCL2L10      cg---------tgcgggctgtggaaagagaccctggctctggcagaggac
A0A3Q0S9R1_BCL2L10      tc---------cctgggctgtggaaagaaaccctgggtttggctgaggac
I3J363_BCL2L10-01       tc---------tgtgggctgtggaaagagaccctgcttttggccgaggac
A0A3B4ETX9_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3Q4MN81_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3P8PVZ8_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3Q2UUN9_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3P9BLI0_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3Q2UUN9_BCL2L10      tc---------tgtgggctgtggaaagagaccctggttttggccgaggac
A0A3Q3JQ78_BCL2L10      cg---------tgtgggctgtggaaagacaccctggctctggcagaggac
A0A3B4TIY6_BCL2L10      ca---------tgcgggctgtggaaagagacccgggctgtggcagaggac
A0A3B4WGF4_BCL2L10      ca---------tgcgggctgtggaaagagacccgggctgtggcagaggac
A0A3Q3KZW1_BCL2L10      cg---------tgtgggctgtggaaagagaccctggctctggcagaggat
A0A3Q1IAB0_BCL2L10      cg---------tgtgggctgtggaaagacaccctggctctggcagaggac
A0A3B4ZFS0_BCL2L10      cc---------tgtgggctatggaaagagaccttggttgtggcagaggac
A0A3Q1GM98_BCL2L10      cc---------tgtgggctatggaaagagactgtggtcctggcagaggac
A0A3Q1D2L0_BCL2L10      cc---------tgtgggctatggaaagagaccttggtcctggcagaggac
A0A3P8RL82_BCL2L10      cc---------tgtgggctatggaaagagaccttggtcctggcagaggac
A0A1U7QVA0_BCL2L10      cc---------gacccgctgcgggtccgcactagactgctgctaactgac
Q9Z0F3_BCL2L10-01       ccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgac
Q99M66_BCL2L10-01       ---------gtgacccgctgcaggatcgcactagacggctgctgactgac
G1QEX2_BCL2L10-01       -----------gacgagttgaagttgcgcacccgacggctgctgaccgag
F1RZB9_BCL2L10-01       cg---------gacgcgttcagggagcgcacagcccggcttctgaccgac
W5QIG4_BCL2L10-01       tg---------gacccgtttagggagcgcacggcccggctgctgatggac
E1B9B3_BCL2L10-01       tg---------gacccgtttagggagcgcaccgcccggctgctgatggac
F1MV39_BCL2L10-01       t---------------------ggagcgcaccgcccggctgctgatggac
H0WZ06_BCL2L10-01       ca---------gacccgttgagggagcgcaccgagcggctgctgactgac
G1T264_BCL2L10-01       ca---------gacgctttggaggagcgcactgcgcgcctgctcaccgac
A0A2K6F2Q2_BCL2L10      gt---------gaccggttcagggagcgcaccgagcggctgctggccgac
A0A1U7UZD8_BCL2L10      cc---------gacccgctggaggagcgtaccgcgcggctgctggctgac
A0A2K6TIT7_BCL2L10      ct---------gacccgctgcagcagcgcaccgagcagctggtggcggac
A0A2K5RIU7_BCL2L10      ct---------gacccgctgcggcagcgcaccgagcggctggtggcggac
A0A2K5F974_BCL2L10      ct---------gacccgctgcggcagcgcaccgagcggctggtggcggac
F7CT87_BCL2L10-01       ct---------gacccgctgcggcagcgcaccgagcagctggtgacggac
A0A0D9RG38_BCL2L10      ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
A0A2K5TKG9_BCL2L10      ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
F7H6U5_BCL2L10-01       ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
A0A2K6B2D9_BCL2L10      ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
A0A2K5MMZ4_BCL2L10      ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
A0A096NM44_BCL2L10      ct---------gacccgttgcgggagcgcaccgagcggctcctggccgac
A0A2K5K3B0_BCL2L10      ct---------gacccgttgcgcgagcgcaccgagcggctgctggccgac
A0A2K6M5H5_BCL2L10      ct---------gacccgttgcgcgagcgcaccgagcggttgctggccgac
A0A2K6R5T5_BCL2L10      ct---------gacccgttgcgcgagcgcaccgagcggttgctggccgac
G1R3W6_BCL2L10-01       ------------------tgcgggagcgcaccgagcggctgctggccgac
H2NN92_BCL2L10-01       cc---------gacctgctgagggagcgcaccgagcggctgctggccgac
Q9HD36_BCL2L10-02       cc---------gacccgctgcgggagcgcaccgagctgttgctggccgac
G3QLU6_BCL2L10-01       cc---------gacccgctgcgggagcgcaccgagcggttgctggccgac
A0A2R9BCD9_BCL2L10      cc---------gacccgctgcgggagcgcaccgagcggttgctggccgac
H2Q9G4_BCL2L10-01       cc---------gacccgctgcgggagcgcaccgagcggttgctggccgac
F6ZPD4_BCL2L10-01       cg---------gaggcgctgagggagcgcacggcgctactgctgatcgac
A0A337RYG8_BCL2L10      ct---------gacgcgttgagggagcgcacggcgcagctactgactgac
M3Y8D1_BCL2L10-01       cg---------gacgctttgagggagcgcacggcgcagctgctgaccgac
G1LKR4_BCL2L10-01       cg---------gacgcgttgaggg---gcacggcgcggctgctgaccgac
A0A452QJG0_BCL2L10      cg---------gacgcgctgagggagcgcacggcgcggctgctgaccgac
                                                     **        *       ** 

F6VJQ0_BCL2L10-01       tacctggaatattgttgccggagggaaggcgtccaggagctgccggcccc
D2IT42_BCL2L10-02       tacctgttgtcctgcactgcaagcaca---ggcacagccccgccgcctcc
A0A3B5MJ12_BCL2L10      tacatccgcctgcgctgctcaagccca---cacccagcccctccacctcc
M4AUW7_BCL2L10-01       tacatccgcctgcgctgctcaagccca---cacccagcccctccacctcc
A0A3P9NE65_BCL2L10      tacatccacctgcgctgctcaaaccca---cacccagcccctccacctcc
A0A3B3TYN4_BCL2L10      tacatccgcctgtgctgctcaagccca---cacccagcccctccacctcc
A0A096ME02_BCL2L10      tacatccacctgcgctgctcaagccca---cacccagcccctccacctcc
A0A3B3YT99_BCL2L10      tacatccacctgcgctgctcaagccca---cacccagcccctccacctcc
A0A3Q2GL87_BCL2L10      tacatgcgcctgcgctgctccagcccg---ctcccagccccgccacctcc
A0A3Q2PJS5_BCL2L10      tacatgcgcctgcgctgctctagccca---cacccagcccctccacctcc
A0A3B3C5I4_BCL2L10      tacctgtccctgagctgcaggagcccagtcctccaggcccccccacctcc
A0A3P9IIZ2_BCL2L10      tacctgtccctgagctgcaggagccca---ctccaggcccccccacctcc
A0A3P9LM07_BCL2L10      tacctgtccctgagctgcaggagccca---ctccaggcccccccacctcc
H2MBQ3_BCL2L10-01       tacctgtccctgagctgcaggagccca---ctccaggcccccccacctcc
A0A3B4AAV4_BCL2L10      tacctgagcctgtgctgcagcggccca---caggcagctcctccacctcc
A0A3P8W7K5_BCL2L10      tacctgtccctctgctgttcaagcccc---cggccagcccctccacctcc
A0A3Q3VI28_BCL2L10      tacctgtccttgtgctgcacaagccag---cggccagcccctccacctcc
A0A3B5KD08_BCL2L10      tacctgtccctgtgcagcacaagccag---tgtccagcccctccacctcc
A0A3Q3EZT5_BCL2L10      tacctgtccctgtgctgcacaagccca---cggccagcccctccacctcc
A0A3Q3EZT5_BCL2L10      tacctgtccctgtgctgcacaagccca---cggccagcccctccacctcc
A0A3Q0S9R1_BCL2L10      tacctgtctctgtgctgcacaagtcca---catcaagtccctccacctcc
I3J363_BCL2L10-01       tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3B4ETX9_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3Q4MN81_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3P8PVZ8_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3Q2UUN9_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3P9BLI0_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3Q2UUN9_BCL2L10      tacctgtccttttgctgcacgagtcca---catcaagcccctccacctcc
A0A3Q3JQ78_BCL2L10      tacctgtctctgtgctgcacaagctca---cggccagcccctccacctcc
A0A3B4TIY6_BCL2L10      tacctgtatctttgctgcacaagccca---cagccagcccctccacctcc
A0A3B4WGF4_BCL2L10      tacctgttcctttgctgcacaagccca---cagccagcccctccacctcc
A0A3Q3KZW1_BCL2L10      tacctgtccctgtgctgcacaagccca---cagtcagtccctccacctcc
A0A3Q1IAB0_BCL2L10      tacctgtccctgtgctgcaccagccct---tggccagcccctccacctcc
A0A3B4ZFS0_BCL2L10      tacctgtccctgtgctgcacaagccca---cattcagcccctccacctcc
A0A3Q1GM98_BCL2L10      tacctgtccctgtgctgtgcaggccca---catcaagcccctccacctcc
A0A3Q1D2L0_BCL2L10      tacctgtccctgtgctgtgcaagccca---catcaagcccctccacctcc
A0A3P8RL82_BCL2L10      tacctgtccctgtgctgtgcaagccca---catcaagcccctccacctcc
A0A1U7QVA0_BCL2L10      tacttgacgttctgtgcacgggagccgggtgaccccgagccaccgcccac
Q9Z0F3_BCL2L10-01       tacatattcttctgcgcacgggagccggacaccccagagccaccgcccac
Q99M66_BCL2L10-01       tacatattgttctgcgcacgggcgccgaacacccctgagccactgcccac
G1QEX2_BCL2L10-01       ttcctggaacaccgcacccgaaggcgcggcactgccccgcagcagccgtc
F1RZB9_BCL2L10-01       tacctggagtactgcgcccgggagcccggcaccgccgcgcggcagccgtc
W5QIG4_BCL2L10-01       tggctggagttctgcgcccgggagcccggcactccagctcctgcgccgtc
E1B9B3_BCL2L10-01       tacctggagttctgcgcccgggagccgggcactccagctcctgcgccgtc
F1MV39_BCL2L10-01       tacctggagttctgcgcccgggagccgggcactccagctcctgcgccgtc
H0WZ06_BCL2L10-01       tacctggagtactgcgcgcgggatccgactgccccggagccgacgccgtc
G1T264_BCL2L10-01       tacctggagtgctgcgcccgcgagcccggcacccctgagccgcagccgtc
A0A2K6F2Q2_BCL2L10      tacctggagtactgcacaagggagccgggcgccccggggctgccgccgtc
A0A1U7UZD8_BCL2L10      tacctggagtactgcgcccggccgcccggcagccccgagccgcggccgtc
A0A2K6TIT7_BCL2L10      tacctggagtactgctcccgggagcccggcacccccgagtcgccaccggc
A0A2K5RIU7_BCL2L10      tacctggagtactgctcccgggagcccggcacccccgagtcgccgccggc
A0A2K5F974_BCL2L10      tacctggagtactgctcccaggagcctggcacccccgagtcgccgccgtc
F7CT87_BCL2L10-01       tacctggagtactgctcccgggagcctggcacccccgagtcgccgccgtc
A0A0D9RG38_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccctgagcccaggccgtc
A0A2K5TKG9_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccctgagccaaggccgtc
F7H6U5_BCL2L10-01       tatctggggtgctgcgcccgggaacccggcacccctgagccaaggccgtc
A0A2K6B2D9_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccctgagccaagaccgtc
A0A2K5MMZ4_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccctgagccgaggccgtc
A0A096NM44_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccctgagccgaggccgtc
A0A2K5K3B0_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccccgagccgaggccgtc
A0A2K6M5H5_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccccgagccgaggccgtc
A0A2K6R5T5_BCL2L10      tatctggggtgctgcgcccgggaacccggcacccccgagccgaggccgtc
G1R3W6_BCL2L10-01       tacctggggtgctgcgcccgggaacccggcacccccgagccgacgccgtc
H2NN92_BCL2L10-01       tacctggggtgctgcgcccgggaacccggcaccccagagccgacgccgcc
Q9HD36_BCL2L10-02       tacctggggtactgcgcccgggaacccggcacccccgagccggcgccatc
G3QLU6_BCL2L10-01       tacctggggtactgcgcccgggaacccggcacccccgagccgacgccgtc
A0A2R9BCD9_BCL2L10      tacctggggtactgcgcccgggaacccggcacccccgagccgacgccgtc
H2Q9G4_BCL2L10-01       tacctggggtactgcgcccgggaacccggcacccccgagccgacgccgtc
F6ZPD4_BCL2L10-01       tacctgcagcgccgcgcccggga---------------------gccggc
A0A337RYG8_BCL2L10      tacctggagtactgcgcccgggagcccggcagccccgcgcggacgccgtc
M3Y8D1_BCL2L10-01       tacctggagtactgcgcccgcggccccggcacccccgcgcggtcgccgtc
G1LKR4_BCL2L10-01       tacctggagtactgcgcccgggagcccggcacccctgcgcgggcgccgtc
A0A452QJG0_BCL2L10      tacctggagtactgcgcccgggagcccggcacccctgcgcgggcgccgtc
                        *   *        *                                *  *

F6VJQ0_BCL2L10-01       ta---cccctgctgcagctacactgcgtttggtgtcgagcgagctccgcc
D2IT42_BCL2L10-02       cagcgagtcagccgcggccatgaggggac---tggcccaggacatggagc
A0A3B5MJ12_BCL2L10      cagcgagccggccgccgccatgaggcgcc---tggcccaggacgtggagg
M4AUW7_BCL2L10-01       cagcgagccggccgccgccatgaggcgcc---tggcccaggacgtggagg
A0A3P9NE65_BCL2L10      cagcgagccggccgccgccatgaggcgcc---tggcccaggacgtggagg
A0A3B3TYN4_BCL2L10      cagcgagccggctgccgccatgaggcgcc---tggcccaggacgtggagg
A0A096ME02_BCL2L10      cagcgagccggctgccgccatgaggcgcc---tggcccaggacgtggagg
A0A3B3YT99_BCL2L10      cagcgagccggccgccgccatgaggcgcc---tggcccaggacgtggagg
A0A3Q2GL87_BCL2L10      cagtgagcccgccgctgccatgaggcgcc---tggcccaggacatggaga
A0A3Q2PJS5_BCL2L10      cagtgagcccgctgctgccatgaggcgcc---tggctcaggacgtggaga
A0A3B3C5I4_BCL2L10      cagcgagtcagcttctgccatgcggcgcc---tggcccaggacatggaga
A0A3P9IIZ2_BCL2L10      cagcgagtcagctgctgccatgaggcgcc---tggcccaggacatggagg
A0A3P9LM07_BCL2L10      cagcgagtcagctgctgccatgaggcgcc---tggcccaggacatggagg
H2MBQ3_BCL2L10-01       cagcgagtcagctgctgccatgaggcgcc---tggcccaggacatggagg
A0A3B4AAV4_BCL2L10      cagcgggtcagcctctgccatgaggcgcc---tgggccaggacatggagg
A0A3P8W7K5_BCL2L10      cagcgagtcagccgctgccatgagacacc---tggcccaggacatggaga
A0A3Q3VI28_BCL2L10      cagcgagtcagccgctgccatgagggacc---tggctcaggacatggaga
A0A3B5KD08_BCL2L10      cagcgagtcggccactgccatgaggcacc---tgggtcaggacatggaga
A0A3Q3EZT5_BCL2L10      cagcatgtcagccgctgctataaggcgcc---tggcccaggacatggaga
A0A3Q3EZT5_BCL2L10      cagcatgtcagccgctgctataaggcgcc---tggcccaggacatggaga
A0A3Q0S9R1_BCL2L10      cagcgagtcagccgctgccatgagacgtc---tgggccaggatattgagc
I3J363_BCL2L10-01       cagcgaatcagccgctgccatgaggcgtc---tgggctgggacatcgaaa
A0A3B4ETX9_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3Q4MN81_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3P8PVZ8_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3Q2UUN9_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3P9BLI0_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3Q2UUN9_BCL2L10      cagcgaatcagccgctgccatgaggcgtc---taggctgggacatcgaaa
A0A3Q3JQ78_BCL2L10      cagcgagtcagccgctgccatgagatgtc---tggcccaggacatggaga
A0A3B4TIY6_BCL2L10      cagcgaatcagccgctgccatgagaagta---tggcccaagacatggaga
A0A3B4WGF4_BCL2L10      cagcgaatcagccgctgccatgagaggca---tggcccaagacatggaga
A0A3Q3KZW1_BCL2L10      cagcgagtcagctgctgccatgagatgtc---tggcccagaaaatggaga
A0A3Q1IAB0_BCL2L10      cagcgagtcagccgctgccatgagacgtc---tggcccaggacatggaga
A0A3B4ZFS0_BCL2L10      cagcgagtcagccgctgccatgaggtgcc---tggcccaggacatggaga
A0A3Q1GM98_BCL2L10      cagcgagtcagccgctgccatgaggcgtc---tggcccaagacatggaga
A0A3Q1D2L0_BCL2L10      cagcgagtcagcggctgccatgaggcgtc---tggcccaggacatggaga
A0A3P8RL82_BCL2L10      cagcgagtcagcggctgccatgaggcgtc---tggcccaggacatggaga
A0A1U7QVA0_BCL2L10      gt---cggcagaggcggccttgctgcgctctgtggcagagcagatccaac
Q9Z0F3_BCL2L10-01       gt---ctgtcgaggcggccttgcttcgctctgtgactaggcagatccagc
Q99M66_BCL2L10-01       gt---ctgttgaggcggccttgctgcgctctgtgactagtcagatccaac
G1QEX2_BCL2L10-01       ca---cgcccgaggccaccgtgatgcgctccctggctgctcattcgtggc
F1RZB9_BCL2L10-01       ct---cgcccgaggccgcagtgctgcgttgcgtggctgcccagatacggg
W5QIG4_BCL2L10-01       ca---cgcccgaggctgctgtgctgcgccacgtggccgcccgtgtcctgg
E1B9B3_BCL2L10-01       ca---cgcctgaggctgccgtgctgcgccacgtggccgcacgtatccagg
F1MV39_BCL2L10-01       ca---cgcctgaggctgccgtgctgcgccacgtggccgcacgtatccagg
H0WZ06_BCL2L10-01       ct---cgcccgaggccgccttgctgcgctccgtgaccgcctatatacagc
G1T264_BCL2L10-01       ca---cgccggaggcggctgtgctgcgctgtgcggccacgcagcttcagc
A0A2K6F2Q2_BCL2L10      ct---cgctcgaggccgccgcgatgcgcttcgcagccaccaagatacggc
A0A1U7UZD8_BCL2L10      ct---cgcccgaggccgccgtgctgcgctccacggccgccaggctgcggc
A0A2K6TIT7_BCL2L10      ca---cggccgaggccgctgtgctgcgcgccacggccgccgttgtacgga
A0A2K5RIU7_BCL2L10      ca---cggccgaggccgctgtgctgcgcgccaccgccgccggtgtacgga
A0A2K5F974_BCL2L10      ca---cggccgaggccgctgtgctgcgcgccatggccgccggtgtacgga
F7CT87_BCL2L10-01       ca---ccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcgga
A0A0D9RG38_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
A0A2K5TKG9_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
F7H6U5_BCL2L10-01       ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
A0A2K6B2D9_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
A0A2K5MMZ4_BCL2L10      ca---cgcccgaggccgccgtgctgcgctcagcagccgccaggttacggc
A0A096NM44_BCL2L10      ca---cgcccgaggccgccgtgctgcgctcagcagccgccaggttacggc
A0A2K5K3B0_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggcggcccgattacggc
A0A2K6M5H5_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggcggccaggttacggc
A0A2K6R5T5_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggcggccaggttacggc
G1R3W6_BCL2L10-01       ca---cgcccgaggccgccatgctgcgctccgcggccgccaggttacggc
H2NN92_BCL2L10-01       ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
Q9HD36_BCL2L10-02       ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
G3QLU6_BCL2L10-01       ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
A0A2R9BCD9_BCL2L10      ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
H2Q9G4_BCL2L10-01       ca---cgcccgaggccgccgtgctgcgctccgcggccgccaggttacggc
F6ZPD4_BCL2L10-01       ca---cgcccgaggtggccgtgctgcgctgcgtggccgcccagatacagc
A0A337RYG8_BCL2L10      ca---cgcccgaggccgcggtgctgcgctacctggccgcccagatacggc
M3Y8D1_BCL2L10-01       ta---cgcgcgaggccgcggtgctgcgctcggtggccgccgtcgtgcggc
G1LKR4_BCL2L10-01       ca---cgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagc
A0A452QJG0_BCL2L10      ca---cgcccgaggccgcggtgctgcgctcggtggccgcccaggtccagc
                                  *      *                                

F6VJQ0_BCL2L10-01       agatttaccaggacttcttcgagtgcgccctgaatcagctactcgaccgg
D2IT42_BCL2L10-02       ggcagcactacgctcgcttc---caggctctggcccagagc---ttcctg
A0A3B5MJ12_BCL2L10      ccaagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
M4AUW7_BCL2L10-01       ccaagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
A0A3P9NE65_BCL2L10      cccagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
A0A3B3TYN4_BCL2L10      cccagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
A0A096ME02_BCL2L10      cccagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
A0A3B3YT99_BCL2L10      cccagcaccaggctcgcttt---cactccctggcccagggc---ttcctg
A0A3Q2GL87_BCL2L10      cccagcaccaggctcgtttc---cacaccctggcccagagc---ttcctg
A0A3Q2PJS5_BCL2L10      gccagcaccaggctcgtttc---cacgccctggcccagagc---ttcctg
A0A3B3C5I4_BCL2L10      cgcagtaccagccccgcttc---tccacgctagctcaggac---ttcagg
A0A3P9IIZ2_BCL2L10      cgcagtaccagccccgcttc---tccaccttagcacagaac---ttcagg
A0A3P9LM07_BCL2L10      cgcagtaccagccccgcttc---tccaccttagcacagaac---ttcagg
H2MBQ3_BCL2L10-01       cgcagtaccagccccgcttc---tccaccttagcacagaac---ttcagg
A0A3B4AAV4_BCL2L10      cccagcacaaggcacgcttc---cactctctgagccagacc---ttcctc
A0A3P8W7K5_BCL2L10      agcagcaccaagctcgcttc---cagacgttgtctcagtct---ttcctg
A0A3Q3VI28_BCL2L10      agcaacaccaggctcgcttc---cactccctggctcagacc---ttcttg
A0A3B5KD08_BCL2L10      agcagcaccaggctcggttc---aactccctagctcagacc---ttcctg
A0A3Q3EZT5_BCL2L10      agcagcaccaggcccgcttc---caatccctggctcagacc---ttcctg
A0A3Q3EZT5_BCL2L10      agcagcaccaggcccgcttc---caatccctggctcagacc---ttcctg
A0A3Q0S9R1_BCL2L10      ggcagcaccaggctcgcttt---gacaaccttgctcagacc---ttcctg
I3J363_BCL2L10-01       gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3B4ETX9_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3Q4MN81_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3P8PVZ8_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3Q2UUN9_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3P9BLI0_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3Q2UUN9_BCL2L10      gacagcaccaagctcgcttc---gacaacctcgctcagacc---ttcctg
A0A3Q3JQ78_BCL2L10      cgcagcaccaggctcgcttc---cactccctcgcgcagacc---ttcctg
A0A3B4TIY6_BCL2L10      cgcagcaccaggctcgcttc---cacacccttgctcaaacc---ttcgta
A0A3B4WGF4_BCL2L10      cgcagcaccaggctcgcttc---cacacccttgctcaaacc---tttgta
A0A3Q3KZW1_BCL2L10      ggcagcaccaggctcgcttc---cactccctcactcagact---ttcctg
A0A3Q1IAB0_BCL2L10      agcagcatcaggttcgcttc---cactccctagctcagact---ttcctg
A0A3B4ZFS0_BCL2L10      agcagcaccaggctcgcttc---cactccctcactcagacc---ttcctg
A0A3Q1GM98_BCL2L10      agcagcaccaggctcgcttc---cactccctcactcaggcc---ttcctg
A0A3Q1D2L0_BCL2L10      agcagcaccaggctcgcttc---cactccctcactcagacc---ttcctg
A0A3P8RL82_BCL2L10      agcagcaccaggctcgcttc---cactccctcactcagacc---ttcctg
A0A1U7QVA0_BCL2L10      agcagcaccacttttttttc---t-cctccttcgtcggcta---ccaggg
Q9Z0F3_BCL2L10-01       aggagcaccaagaatttttt---t-cctccttctgcgaaag---ccgggg
Q99M66_BCL2L10-01       aggagcaccaggatcttttc---a-actccttccgcgacta---ccaggg
G1QEX2_BCL2L10-01       tgggtaccccgcactcctgg---t-cc-----cggaggcag-------ag
F1RZB9_BCL2L10-01       agtacaacgtgcgcaccttg---t-ctgtctaccgcggctt---ccgctg
W5QIG4_BCL2L10-01       aagcaaatcgaaacgtcttg---c-ccctataccgccgcta---ccgcag
E1B9B3_BCL2L10-01       aagcaaatcgaaacgtcttg---c-ccctataccgccgctg---ccgcag
F1MV39_BCL2L10-01       aagcaaatcgaaatgtcttg---c-ccctataccgccgctg---ccgcag
H0WZ06_BCL2L10-01       agcgccactggtcctttttc---t-ccgcctacataggcta---ccccgg
G1T264_BCL2L10-01       gggtccactggcccttcttc---t-ccgtctaccgcggcta---ccccgg
A0A2K6F2Q2_BCL2L10      ggaagcacgcgtccttcttc---t-ccgcctacgtcggcta---ccccgg
A0A1U7UZD8_BCL2L10      agcggcacgcctccttcttc---t-cggccttcgttgacta---ccccgg
A0A2K6TIT7_BCL2L10      aactctacccgtccttcttc---t-ccgcttaccgcggcta---ccccag
A0A2K5RIU7_BCL2L10      aagtctaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
A0A2K5F974_BCL2L10      aactctaccggtccttcttc---t-ccgcctacctcggcta---cccggg
F7CT87_BCL2L10-01       aactctaccggtctttcttc---t-ccgcctacctcggcta---ccccgg
A0A0D9RG38_BCL2L10      agctccaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
A0A2K5TKG9_BCL2L10      agctccaccggtccttcttc---t-ccgcctaccgcggcta---ccccgg
F7H6U5_BCL2L10-01       agctccaccggtccttcttc---t-ccgcctaccgcggcta---ccccgg
A0A2K6B2D9_BCL2L10      agctccaccggtccttcttc---t-ccgcctaccgcggcta---ccccgg
A0A2K5MMZ4_BCL2L10      agctccaccggtccttcttc---t-ccgcctaccgcggcta---ccgcgg
A0A096NM44_BCL2L10      agctccaccggtccttcttc---t-ccgcctaccgcggcta---ccccgg
A0A2K5K3B0_BCL2L10      agctccatcggtccttcttc---t-ccgcctacctcggcta---ccccgg
A0A2K6M5H5_BCL2L10      agctccaccggtccttcttc---t-ctgcctacctcggcta---ccccgg
A0A2K6R5T5_BCL2L10      agctccaccggtccttcttc---t-ctgcctacctcggcta---ccccgg
G1R3W6_BCL2L10-01       agctccacccgtccttcttc---t-ccgcctacctcggcta---ccctgg
H2NN92_BCL2L10-01       agctccaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
Q9HD36_BCL2L10-02       agattcaccggtcctttttc---t-ccgcctacctcggcta---ccccgg
G3QLU6_BCL2L10-01       agattcaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
A0A2R9BCD9_BCL2L10      agatccaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
H2Q9G4_BCL2L10-01       agatccaccggtccttcttc---t-ccgcctacctcggcta---ccccgg
F6ZPD4_BCL2L10-01       cccgcaaccagcgtgttctt---t-cccgctaccgcggctt---ccgcgg
A0A337RYG8_BCL2L10      agcgccaccagcgtttcttg---t-cggcttaccgcggcta---ccgcgg
M3Y8D1_BCL2L10-01       agcgtcacgagcgcttcttg---t-cggattaccgcggcta---cggcgg
G1LKR4_BCL2L10-01       agcgtcacgagcgcttcttg---t-ccgattaccgcggctacgccggcgg
A0A452QJG0_BCL2L10      agcgtcacgagcacttcttg---t-ccgattaccgcggcta---cggcgg
                                                                          

F6VJQ0_BCL2L10-01       gaacctgagcaagtaa---------------tcgtcaacgtagcgga---
D2IT42_BCL2L10-02       gcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggagga
A0A3B5MJ12_BCL2L10      aagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatga
M4AUW7_BCL2L10-01       aagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatga
A0A3P9NE65_BCL2L10      aagcactgcgggacggatctctgctccaacctcagaaaggtgatggatga
A0A3B3TYN4_BCL2L10      aagcactgcgggacagacctctgctccaacctcagaaaggtgatggatga
A0A096ME02_BCL2L10      aagcactgcgggacagacctctgctccaacctcagaaaggtgatggatga
A0A3B3YT99_BCL2L10      aagcactgcgggacagacctctgctccaacctcagaaaggtgatggatga
A0A3Q2GL87_BCL2L10      aggcacagcgggacggacctctgctccagcctcaggaaggtgatggacga
A0A3Q2PJS5_BCL2L10      aggcacagccagacggacctctgcaccagcctctggaaggtgatggacga
A0A3B3C5I4_BCL2L10      aagcactgcgggccggacctgtgctccagcctcaggaaggtgatggagga
A0A3P9IIZ2_BCL2L10      aagcacagcgggcaggacctgtgctccagcctcaggaaggtgatggagga
A0A3P9LM07_BCL2L10      aagcacagcgggccggacctgtgctccagcctcaggaaggtgatggagga
H2MBQ3_BCL2L10-01       aagcacagcgggccggacctgtgctccagcctcaggaaggtgatggagga
A0A3B4AAV4_BCL2L10      aagcagtgtgggccggacccctgctccagtctccggaaggtcatggagga
A0A3P8W7K5_BCL2L10      aggcaatgtggctctgagccctgtgtgtgtcttaggaaggttatggaaga
A0A3Q3VI28_BCL2L10      aggcagtgcgggacggacccatgctccagcctcaggaacgtgatggagga
A0A3B5KD08_BCL2L10      agacagtgcgggccggacctctgctccagcctcaggaaagtgatggagga
A0A3Q3EZT5_BCL2L10      aggcagtgcgggccggacccctgctccggtcttaggaaggtgatggagga
A0A3Q3EZT5_BCL2L10      aggcagtgcgggccggacccctgctccggtcttaggaaggtgatggagga
A0A3Q0S9R1_BCL2L10      aggcattgcgggccggatcactgctctagcctcaggaaggtgatggagga
I3J363_BCL2L10-01       gtgcagtgtgggccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3B4ETX9_BCL2L10      gtgcagtgtggaccagaccactgcctcagcctcagaaaggtgatgaagga
A0A3Q4MN81_BCL2L10      gtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3P8PVZ8_BCL2L10      gtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3Q2UUN9_BCL2L10      gtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3P9BLI0_BCL2L10      gtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3Q2UUN9_BCL2L10      gtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaagga
A0A3Q3JQ78_BCL2L10      aagcagtgtgggccggacccctgctccagtctcaggaaggtgatggaaga
A0A3B4TIY6_BCL2L10      acgcagtgtgggctggacccctgctccagcctcaggaaggtgatggagga
A0A3B4WGF4_BCL2L10      acgcagtgtgggctggacccctgctccagcctcaggaaggtgatggagga
A0A3Q3KZW1_BCL2L10      aagcagtgcgggccggacccctgctccagcctcaggaaggttatagagga
A0A3Q1IAB0_BCL2L10      aagcagtgcgggccggacccctgctccagcctcaggaaggtgatggagga
A0A3B4ZFS0_BCL2L10      aggcagcccgggccggacctctgctccagcctcaggagggtgatggagga
A0A3Q1GM98_BCL2L10      aggcagtgcgggccggacttctgctccagcctcaggatggtgatggagga
A0A3Q1D2L0_BCL2L10      aggcagtgcgggccggacctctgctccagcctcaggaaggtgatggagga
A0A3P8RL82_BCL2L10      aggcagtgcgggccggacctctgctccagcctcaggaaggtgatggagga
A0A1U7QVA0_BCL2L10      caaccgcgtggagctga--------------tgacacagatggtagacgc
Q9Z0F3_BCL2L10-01       caatcgcctggagctgg--------------tgaaacagatggcagataa
Q99M66_BCL2L10-01       caaccgcctggagctgg--------------tgacacagatggcggatga
G1QEX2_BCL2L10-01       aaaccgactcgagcaga--------------tggtcgaccagatagagtc
F1RZB9_BCL2L10-01       gaaccgtgtcgaattgg--------------tggcctggatggcacagaa
W5QIG4_BCL2L10-01       gcaccgcgtcgagctgg--------------tggccaggatggcgcagag
E1B9B3_BCL2L10-01       gcaccgcgtcgagctgg--------------tggccaggatggcgcagag
F1MV39_BCL2L10-01       gcaccgcgtcgagctgg--------------tggccaggatggcgcagag
H0WZ06_BCL2L10-01       gaatcgcgttcaggtgg--------------tggaacggatggtgaaggc
G1T264_BCL2L10-01       caaccgcatcgagctgg--------------cggcgcgcgtggcggaggc
A0A2K6F2Q2_BCL2L10      gaaccgcgtctacctgc--------------tggagcggatggcggaggc
A0A1U7UZD8_BCL2L10      gagccgcgtggacctga--------------cggcgcggatggccgatgc
A0A2K6TIT7_BCL2L10      gaaccgcgtcgagctgg--------------tggcgaggatggcggaggc
A0A2K5RIU7_BCL2L10      gaaccgcgtcgagctgg--------------tggcgaggatggcggaggc
A0A2K5F974_BCL2L10      gaaccgcgtcgagctgg--------------tggcgaggatggcggaggc
F7CT87_BCL2L10-01       gaaccgcgtcgagctgg--------------tggcgaggatggcggaggc
A0A0D9RG38_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggacgc
A0A2K5TKG9_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
F7H6U5_BCL2L10-01       gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A2K6B2D9_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A2K5MMZ4_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A096NM44_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A2K5K3B0_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A2K6M5H5_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
A0A2K6R5T5_BCL2L10      gaaccgcgtcgagctgg--------------tggcgctgatggcggaggc
G1R3W6_BCL2L10-01       gaaccgcgtcgagctgg--------------tggtgctgatggcggattc
H2NN92_BCL2L10-01       gaaccgcgtcgaactgg--------------tggcgctgatggcggattc
Q9HD36_BCL2L10-02       gaaccgcttcgagctgg--------------tggcgctgatggcggattc
G3QLU6_BCL2L10-01       gaaccgcttcgagctgg--------------tggcgctgatggcggattc
A0A2R9BCD9_BCL2L10      gaaccgcttcgagctgg--------------tggcgctgatggcggattc
H2Q9G4_BCL2L10-01       gaaccgcttcgagctgg--------------tggcgctgatggcggattc
F6ZPD4_BCL2L10-01       ggaccacgtcgggctgg--------------cggcacggatggcgcaggc
A0A337RYG8_BCL2L10      aaaccgcgtggaactgg--------------tggcgcggttggagcagga
M3Y8D1_BCL2L10-01       caaccgcgtcgagctgg--------------tggctcagttggagcggga
G1LKR4_BCL2L10-01       caaccgcgtggagctgg--------------tggctcaggtggagcggga
A0A452QJG0_BCL2L10      caaccgcgtggagctgg--------------tggctcaggtggagcggga
                                                                          

F6VJQ0_BCL2L10-01       ---gctcatggaccgaggcgagttcaactggggccgggtggcggtgctag
D2IT42_BCL2L10-02       gctggtgggagacggaca---gttgaactgggggagggtagtttccctct
A0A3B5MJ12_BCL2L10      gatggtgggggacggaca---ctttaactgggggagggtggtgtccctct
M4AUW7_BCL2L10-01       gatggtgggggacggaca---ctttaactgggggagggtggtgtccctct
A0A3P9NE65_BCL2L10      gatggtgggagatggaca---ctttaactgggggagggtggtgtccctct
A0A3B3TYN4_BCL2L10      gatggtgggagatggaca---ttttaactgggggagggtggtgtccctct
A0A096ME02_BCL2L10      gatggtgggagatggaca---ttttaactgggggagggtggtgtccctct
A0A3B3YT99_BCL2L10      gatggtgggagatggaca---ttttaactgggggagggtggtgtccctct
A0A3Q2GL87_BCL2L10      gatggtgggggacggact---ctttaactgggggagggtcgtatccctct
A0A3Q2PJS5_BCL2L10      gatggtgggggacggaca---ctttaactggggacgggttgtatctctct
A0A3B3C5I4_BCL2L10      gctggtgggagatgaaca---cttgaactgggggagggttgtttcccttt
A0A3P9IIZ2_BCL2L10      gctggtgggagatgaacg---cttgaactgggggagggtcgtttcccttt
A0A3P9LM07_BCL2L10      gctggtgggagatgaacg---cttgaactgggggagggtcgtttcccttt
H2MBQ3_BCL2L10-01       gctggtgggagatgaacg---cttgaactgggggagggtcgtttcccttt
A0A3B4AAV4_BCL2L10      gctggtgggagatggaca---cttgaactggggaagggttgtgtcccttt
A0A3P8W7K5_BCL2L10      gctggtaggagacggaca---cttgaactgggggagagttgtttccattt
A0A3Q3VI28_BCL2L10      gctggtgggagacggaca---cttgaactgggggagggttgtttccattt
A0A3B5KD08_BCL2L10      gctggtgggagatggaca---cttgaactggggaagggttgtatcccttt
A0A3Q3EZT5_BCL2L10      actggtgggagatggaca---cttgaactggggaagggttgtatcccttt
A0A3Q3EZT5_BCL2L10      actggtgggagatggaca---cttgaactggggaagggttgtatcccttt
A0A3Q0S9R1_BCL2L10      gctggtgggagacggaca---cttgaactgggggagggttgtttcccttt
I3J363_BCL2L10-01       gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3B4ETX9_BCL2L10      gctggttggggatggaca---cttgaactgggggagggttgtttctcttt
A0A3Q4MN81_BCL2L10      gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3P8PVZ8_BCL2L10      gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3Q2UUN9_BCL2L10      gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3P9BLI0_BCL2L10      gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3Q2UUN9_BCL2L10      gctggttggagatggaca---cttgaactgggggagggttgtttctcttt
A0A3Q3JQ78_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttccctat
A0A3B4TIY6_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttccattt
A0A3B4WGF4_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttccattt
A0A3Q3KZW1_BCL2L10      gctggtggcagatggaca---cttgaactgggggagggttgtttcccttt
A0A3Q1IAB0_BCL2L10      gctggtgggagatggaca---catgaactgggggagggttgtttcccttt
A0A3B4ZFS0_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttcccttt
A0A3Q1GM98_BCL2L10      gctggtggaagatggaca---cttgaactgggggagggttgtttcccttt
A0A3Q1D2L0_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttcccttt
A0A3P8RL82_BCL2L10      gctggtgggagatggaca---cttgaactgggggagggttgtttctcttt
A0A1U7QVA0_BCL2L10      cgtgctccccgatggccaagacctcaactggggccgcctggtgttgctct
Q9Z0F3_BCL2L10-01       gttgctctccaaagaccaagacttcagctggagccaactggtgatgctcc
Q99M66_BCL2L10-01       gttgctctccaatgaccaagagttcaactggggccgcctggtgatgctcc
G1QEX2_BCL2L10-01       gctagttccagacggcacagaccccaactggttgagcgtggtggcgctcg
F1RZB9_BCL2L10-01       actactcgcaagcccacgtggccccaactggtaccgcgtggcatcactct
W5QIG4_BCL2L10-01       gctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcg
E1B9B3_BCL2L10-01       gctactcgacgaagaccctggccccagctggggccgcgtggcctcactcg
F1MV39_BCL2L10-01       gctactcgacgaagaccctggccccagctggggccgcgtggcctcactcg
H0WZ06_BCL2L10-01       tatgctctcagacaaccagagactcaactggggccgagtggtgacgctcg
G1T264_BCL2L10-01       cgtgctctccgacggccacgacctcagctggggccgcgtggtgacgctcg
A0A2K6F2Q2_BCL2L10      cgtgctctgcgacag------cctcagctggggccgggtagtgatgctcg
A0A1U7UZD8_BCL2L10      cgtgctctctggcagccgcgacctcagctggggccgcgtggtgacgctcg
A0A2K6TIT7_BCL2L10      cttgctctccgacagtcccggtcccacctggggcaacgtggtgatgctcc
A0A2K5RIU7_BCL2L10      gctgctctccgacagtcccggccccacctggggcaacgtggtgatgcttc
A0A2K5F974_BCL2L10      cctgctctccgacagtcccggccccacctggggcaacgtggtgatgctcc
F7CT87_BCL2L10-01       cctgctctccgacagtcccggccccacctggggcaacgtggtgatgctcc
A0A0D9RG38_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K5TKG9_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
F7H6U5_BCL2L10-01       cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K6B2D9_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K5MMZ4_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A096NM44_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K5K3B0_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K6M5H5_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
A0A2K6R5T5_BCL2L10      cgtgctctccgacagccccggccccacctggggcagggtggtgtcgctgg
G1R3W6_BCL2L10-01       cgtgctctccgacagccccggccccacctggggcagagtggtgacgctcg
H2NN92_BCL2L10-01       cgtgctctccgacagccccagccccacctggggcagagtggtgacgctcg
Q9HD36_BCL2L10-02       cgtgctctccgacagccccggccccacctggggcagagtggtgacgctcg
G3QLU6_BCL2L10-01       cgtgctctccgacagccccggccccacctggggcagagtggtgacgctcg
A0A2R9BCD9_BCL2L10      cgtgctctccgacagccccggccccacctggggcagagtggtgacgctcg
H2Q9G4_BCL2L10-01       cgtgctctccgacagccccggccccacctggggcagagtggtgacgctcg
F6ZPD4_BCL2L10-01       gatcttcggagaccgccacgtccccagctggggccgcgtggcggcgctcg
A0A337RYG8_BCL2L10      tttactctccaacccccaaaccctcagttggggccatgtggtagcgctct
M3Y8D1_BCL2L10-01       gatactcgcccacccccaagccctaagctggggccgtgtggtggcgctcg
G1LKR4_BCL2L10-01       gatactcgcccacccccagcccctaagctggggccgtgtggtggcgctct
A0A452QJG0_BCL2L10      gatactcgcccacccccagcccctaagctggggccgtgtggtggcgctcc
                             *                   *  ***       * *      *  

F6VJQ0_BCL2L10-01       tggtttttgccggggcgctgctggagatg--------gaggaactactga
D2IT42_BCL2L10-02       tcacctttaccggggtgctggccagacaactgcaggagaagaagggggta
A0A3B5MJ12_BCL2L10      tcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaag
M4AUW7_BCL2L10-01       tcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaag
A0A3P9NE65_BCL2L10      tcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaag
A0A3B3TYN4_BCL2L10      tcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaag
A0A096ME02_BCL2L10      tcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaag
A0A3B3YT99_BCL2L10      tcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaag
A0A3Q2GL87_BCL2L10      ttacctttgccggcgtgctggccagacagctgcaggagcaaacgggcaaa
A0A3Q2PJS5_BCL2L10      tcaccttcgccggcgtgctggccagacagctgcaggagcagcagggcagg
A0A3B3C5I4_BCL2L10      ttgcattcgtgggagtgctggcgagacagctgagggagcaaacggacacg
A0A3P9IIZ2_BCL2L10      ttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagacatg
A0A3P9LM07_BCL2L10      ttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagacatg
H2MBQ3_BCL2L10-01       ttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagacatg
A0A3B4AAV4_BCL2L10      tcacctttgctggggtgctggccagacacataaaagagcagaagagtagc
A0A3P8W7K5_BCL2L10      tcacctttactggggttctggccaaacagctgttggtccagaagggttta
A0A3Q3VI28_BCL2L10      tcacctttactggggtgctggccagacaactgctcgaacagaagagcaca
A0A3B5KD08_BCL2L10      tcacctttactggggtgctggccagactgatgcaggagcagaagagcaca
A0A3Q3EZT5_BCL2L10      tcacctttactggggtgctggccagacaactgcaggagcaggaggatgtg
A0A3Q3EZT5_BCL2L10      tcacctttactggggtgctggccagacaactgcaggagcaggaggatgtg
A0A3Q0S9R1_BCL2L10      ttgcttttactggggtgctagccagaaagaggctggagcag---------
I3J363_BCL2L10-01       ttgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3B4ETX9_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3Q4MN81_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3P8PVZ8_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3Q2UUN9_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3P9BLI0_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3Q2UUN9_BCL2L10      tcgcctttactggagtgctggccagaaagatcctggagcag---------
A0A3Q3JQ78_BCL2L10      tcgccttcaccggggtgctggctagacagctgacggagcagaatggcatg
A0A3B4TIY6_BCL2L10      tcacctttactggggtgctggccagactgctgctggagcagaaccgtgtg
A0A3B4WGF4_BCL2L10      tcacctttactggggtgctggccagactgctgctggagcagaaccgtgtg
A0A3Q3KZW1_BCL2L10      tcacctttactggggtgctgtccagacagctgatggagcagaagggcatg
A0A3Q1IAB0_BCL2L10      tcaccttcactggggtgctggccagacagatgctggagcagaaggacaag
A0A3B4ZFS0_BCL2L10      tcacctttactggggtgctggccagacagctgcaggagcagagggacacg
A0A3Q1GM98_BCL2L10      tcacctttactggggtgctggccagacagctgctggagcagaaggacaca
A0A3Q1D2L0_BCL2L10      tcacctttactggggtgctggccagacagctgctggagcagaaggacaca
A0A3P8RL82_BCL2L10      tcacctttactggggtgctggccagacagctgctggagcagaaggacaca
A0A1U7QVA0_BCL2L10      tagcctttgcggggacaattgtgagtcaag------------------ag
Q9Z0F3_BCL2L10-01       tggccttcgcggggacgcttatgaatcaaggcccttacatggctgtcaag
Q99M66_BCL2L10-01       tggccttcgtggggacgctaatgaaccaag------acaggactgttaag
G1QEX2_BCL2L10-01       tgtccttcgcgggggccctgctggagagaccgccgcca--ggccactcgc
F1RZB9_BCL2L10-01       tgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtggg
W5QIG4_BCL2L10-01       tgaccttcgcggggtctctgctggagaggcagccgcagacgacccgacgg
E1B9B3_BCL2L10-01       taaccttcgcggggtcgctgctggagaggccaccgcagacgacccgacgg
F1MV39_BCL2L10-01       tgaccttcgcggggtcgctgctggagaggccgccgcagactacccgacgg
H0WZ06_BCL2L10-01       tgaccttcgcagggacgcttctacagag---gcctccagtagaagccagg
G1T264_BCL2L10-01       tgaccttcgccgggacgcttctggacagagggccgccggtgaccacccag
A0A2K6F2Q2_BCL2L10      tgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctgg
A0A1U7UZD8_BCL2L10      tgaccttcgcggggacgcttctggagcgaggaccgctgctgcccgccggg
A0A2K6TIT7_BCL2L10      tggccttcgcggggacgctgctagagagggggccgctggtgaccgcccgg
A0A2K5RIU7_BCL2L10      tggccttcgcggggacgctgctagagagggggccgctggtgaccgcccgg
A0A2K5F974_BCL2L10      tggccttcgcggggacgctgctagagagggggccgctggtgaccgcccgg
F7CT87_BCL2L10-01       tggccttcgcggggacgctgctagagagggggccgctggtgaccgcccgg
A0A0D9RG38_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctgatgacagcctgg
A0A2K5TKG9_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
F7H6U5_BCL2L10-01       tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A2K6B2D9_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A2K5MMZ4_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A096NM44_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A2K5K3B0_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A2K6M5H5_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
A0A2K6R5T5_BCL2L10      tgaccttcgcggggacgctgctggagagagagccgctggtgacagcctgg
G1R3W6_BCL2L10-01       tggccttcgcagggacgctgctggagagagggccgctggtgaccgcccgg
H2NN92_BCL2L10-01       tgaccttcgcagggacgctgctggagagagggccgctggtgaccgcccgg
Q9HD36_BCL2L10-02       tgaccttcgcagggacgctgctggagagagggccgctggtgaccgcccgg
G3QLU6_BCL2L10-01       tgaccttcgcagggacgctgctggagagagggccgctggtgaccgcccgg
A0A2R9BCD9_BCL2L10      tgaccttcgcagggacgctgctggagagagggccgctggtgaccacccgg
H2Q9G4_BCL2L10-01       tgaccttcgcagggacgctgctggagagagggccgctggtgaccacccgg
F6ZPD4_BCL2L10-01       tgaccctggcggggacgctgctggagagagccccgcggggaacctaccga
A0A337RYG8_BCL2L10      tgaccttcgcggggacgctgctggagagaccgccgccggggacctacttg
M3Y8D1_BCL2L10-01       tgaccttcgcgggaacgctgctggagcgcccgccgtcgggggcctgctcg
G1LKR4_BCL2L10-01       tgaccttcgcgggcacactgctggagagatcgccgtcggggacctactcg
A0A452QJG0_BCL2L10      tcaccttcgcgggcacactgctggagagatcgccgtcggggacctactcg
                        *     *    **     *                               

F6VJQ0_BCL2L10-01       aagaggagcaggtactg----------cagcttcggagggaaacga----
D2IT42_BCL2L10-02       caactggggcaggaccccggg------acgggca---gggcactgggaca
A0A3B5MJ12_BCL2L10      aacccggtgccggactccggg------aagcagc---aggaactgcaaca
M4AUW7_BCL2L10-01       aacccggtgccggactccggg------aagcagc---aggaactgcaaca
A0A3P9NE65_BCL2L10      aacccggggccggactccggg------aagcagc---aggaactgcaaca
A0A3B3TYN4_BCL2L10      aacccggggccggactctggg------aagcagc---aggaactgcaaca
A0A096ME02_BCL2L10      aacccggggccggactccggg------aagcagc---aggaactgcaaca
A0A3B3YT99_BCL2L10      aacccggggccggactccggg------aagcagc---aggaactgcaaca
A0A3Q2GL87_BCL2L10      aacccggggctggatcctggg------aggcagc---aggaactgcaaac
A0A3Q2PJS5_BCL2L10      agcccggggccggaccccggg------aggcagc---a------------
A0A3B3C5I4_BCL2L10      aacccggggctggacctcggg------------c---gggaagcggcacc
A0A3P9IIZ2_BCL2L10      aacccggggctggaccccggg------------c---gggaagtggcggc
A0A3P9LM07_BCL2L10      aacccggggctggaccccggg------------c---gggaagtggcgcc
H2MBQ3_BCL2L10-01       aacccggggctggaccccggg------------c---gggaagtggcgcc
A0A3B4AAV4_BCL2L10      agaccagggctggaccctgga------caagttc---aaggtttgggaca
A0A3P8W7K5_BCL2L10      aagccggggcaggaacccgag------gcagggc---aggaactgggacc
A0A3Q3VI28_BCL2L10      aagccggggctggaacccaggcaggaccaggacc---aggaactgggaca
A0A3B5KD08_BCL2L10      aagccggggctggaccctgga------caagagc---agcaactgggaca
A0A3Q3EZT5_BCL2L10      aagctggggctggaccctgtg------caggggc---agaaactgggaca
A0A3Q3EZT5_BCL2L10      aagctggggctggaccctgtg------caggggc---agaaactgggaca
A0A3Q0S9R1_BCL2L10      aagccagggctggaccctggg------caacagc---aggaactgggaca
I3J363_BCL2L10-01       aagccggggctggaccctggg------caacagc---aggaactgggaca
A0A3B4ETX9_BCL2L10      aagccggggctggaccctggt------caacagc---aggaactgggaca
A0A3Q4MN81_BCL2L10      aagccggggctggaccctggt------caacagc---aggaactgggaca
A0A3P8PVZ8_BCL2L10      aagccggggctggaccctcgt------caacagc---aggaactgggaca
A0A3Q2UUN9_BCL2L10      aagccggggctggaccctcgt------caacagc---aggaactgggaca
A0A3P9BLI0_BCL2L10      aagccggggctggaccctcgt------caacagc---aggaactgggaca
A0A3Q2UUN9_BCL2L10      aagccggggctggaccctcgt------caacagc---aggaactgggaca
A0A3Q3JQ78_BCL2L10      aagcccgggctggaccctggg------caggggc---aggaactgggaca
A0A3B4TIY6_BCL2L10      aacccggggctggaccctggg------cag---------------ggaca
A0A3B4WGF4_BCL2L10      aacccggggctggaccctggg------cag---------------ggaca
A0A3Q3KZW1_BCL2L10      aagccagggctggactctgga------aaggggc---aggaattgggaca
A0A3Q1IAB0_BCL2L10      aagccggggctggaccttggg------aaggggc---aggaactaggaca
A0A3B4ZFS0_BCL2L10      aagccggggctggaacccggg------aagcggc---aggaactgggaca
A0A3Q1GM98_BCL2L10      aagccggggctggaccccggg------aagcgac---aggaactgggaca
A0A3Q1D2L0_BCL2L10      aagctggggctggaccccggg------aagcagc---aggaactgggaca
A0A3P8RL82_BCL2L10      aagccggggctggaccccggg------aagcagc---aggaactgggaca
A0A1U7QVA0_BCL2L10      cagagaaac---------------------cgtctgaaggata---aaat
Q9Z0F3_BCL2L10-01       cagaagagg---------------------gatctggggaatc---gtgt
Q99M66_BCL2L10-01       cggaggagg---------------------gatcaaagaaacc---gtct
G1QEX2_BCL2L10-01       aggca----------------------------cgcagggaatgggatgc
F1RZB9_BCL2L10-01       cggaagaagaag---------------------------------gaggg
W5QIG4_BCL2L10-01       c---agaagagagac------------------------------gacgg
E1B9B3_BCL2L10-01       caggagaagagagac------------------------------gacga
F1MV39_BCL2L10-01       c---agaagagagac------------------------------gacga
H0WZ06_BCL2L10-01       cgggagaagcagga---------caagtcgcaactgaaggagggagaaga
G1T264_BCL2L10-01       cgggtgaggaggaa------------------------------------
A0A2K6F2Q2_BCL2L10      tggaagaagtggggcct------ccagccgcagccgaaggagggggatcc
A0A1U7UZD8_BCL2L10      gggcagcagcggggctt------caggccccggcggaagaaggaggaggg
A0A2K6TIT7_BCL2L10      tggaagaagtggggctt------ccagtcgcggttgaaggagccggaggg
A0A2K5RIU7_BCL2L10      tggaagaagtggggctt------ccagtcgcggctgaaggagccggaggg
A0A2K5F974_BCL2L10      tggaagaagtggggctt------ccagtcgcggctgaaggagccggaggg
F7CT87_BCL2L10-01       tggaagaagtggggctt------ccagtctcggctgaaggagccggaagg
A0A0D9RG38_BCL2L10      tggaagaagcagagctt------ccagccgcggct---ggagcaggaggg
A0A2K5TKG9_BCL2L10      tggaagaagcggggctt------ccagccgcggctgaaggagcaggaggg
F7H6U5_BCL2L10-01       tggaagaagcggggctt------ccagccgcggctgaaggagcaggaggg
A0A2K6B2D9_BCL2L10      tggaagaagcggggctt------ccagccgcggctgaaggagcaggaggg
A0A2K5MMZ4_BCL2L10      tggaagaagcggggctt------ccagccgcggctgaaggagcaggaggg
A0A096NM44_BCL2L10      tggaagaagcggagctt------ccagccgcggctgaaggagcaggaggg
A0A2K5K3B0_BCL2L10      tggaagaagcggagctt------ccagccgcggctgaaggagcaggaggg
A0A2K6M5H5_BCL2L10      tggaagaagcggagctt------ccagccgcggctgaaggagcaggaggg
A0A2K6R5T5_BCL2L10      tggaagaagcggagctt------ccagccgcggctgaaggagcaggaggg
G1R3W6_BCL2L10-01       tggaagaagtggggctt------ccagccgcggctaaaggagcaggaggg
H2NN92_BCL2L10-01       tggaagaagtggggctt------ccagccgcggctaaaggagcaggaggg
Q9HD36_BCL2L10-02       tggaagaagtggggctt------ccagccgcggctaaaggagcaggaggg
G3QLU6_BCL2L10-01       tggaagaagtggggctt------ccagccgcggctaaaggagcaggaggg
A0A2R9BCD9_BCL2L10      tggaagaagtggggctt------ccagccgcggctaaaggagcaggaggg
H2Q9G4_BCL2L10-01       tggaagaagtggggctt------ccagccgcggctaaatgagcaggaggg
F6ZPD4_BCL2L10-01       aagccgaagcggggcta------caagctggagctgagggagtggaaggc
A0A337RYG8_BCL2L10      aacctgacgccggacca------gcaacaggagct---ggagtgggagac
M3Y8D1_BCL2L10-01       aacttggggccggacccggaactggaactggagctgggggagtgggaggc
G1LKR4_BCL2L10-01       aacctggggccggacca------ggaactggagctgggggagtgggaggc
A0A452QJG0_BCL2L10      aacctggggccggacca------ggaactggagctgggggagcgggaggc
                                                                          

F6VJQ0_BCL2L10-01       -----------------gccggcgtctgaccgaaaaactctgcaactatc
D2IT42_BCL2L10-02       ggttcccggcgggagctgcagggggctggcggagacgatagcggactacc
A0A3B5MJ12_BCL2L10      agagcc---cgtaagctgccgggcgctggcggagaccattgctgattacc
M4AUW7_BCL2L10-01       agagcc---cgtaagctgccgggcgctggcggagaccattgctgattacc
A0A3P9NE65_BCL2L10      agagac---cgtaagctgccgggcgctggcggagaccattgctgattacc
A0A3B3TYN4_BCL2L10      agagcc---cgtaagctgccgggcgctggcggagaccattgctgattacc
A0A096ME02_BCL2L10      agagcc---cgtaagctgccgggcgctggcggagaccattgctgattacc
A0A3B3YT99_BCL2L10      agagcc---cgtaagctgccgggcgctggcggagaccattgctgattacc
A0A3Q2GL87_BCL2L10      ggagcc---cgtaagctgccgggcgctggcagagaccatcgccgattatc
A0A3Q2PJS5_BCL2L10      ggagcc---cgtgagctgcagggagctggcggagaccatcgctgattacc
A0A3B3C5I4_BCL2L10      cggacc---tgtgagctgccaggcgctggcagaaactgtagctgatttcc
A0A3P9IIZ2_BCL2L10      cgggcc---tgtgagctgccaggcgctggcagaaactgtagctgatttcc
A0A3P9LM07_BCL2L10      cgggcc---tgtgagctgccaggcgctggcagaaactgtagctgatttcc
H2MBQ3_BCL2L10-01       cgggcc---tgtgagctgccaggcgctggcagaaactgtagctgatttcc
A0A3B4AAV4_BCL2L10      ggtgcc---ctcagactgcaggcggctggcacaaactatagctgattact
A0A3P8W7K5_BCL2L10      ggagcc---tggaacctgcagggaactggcagagaccattgctgattatc
A0A3Q3VI28_BCL2L10      agtgcc---tggtaattgcagtgaactggccgagaccatagcagactacc
A0A3B5KD08_BCL2L10      ggtgcc---cgaaaactgcaggggactcgcggagaccatagcagactatc
A0A3Q3EZT5_BCL2L10      gggacc---cgggcactgcaggggactggcagagaccatagctgactacc
A0A3Q3EZT5_BCL2L10      gggacc---cgggcactgcaggggactggcagagaccatagctgactacc
A0A3Q0S9R1_BCL2L10      ggagcc---cataagctgcagggagctggcagagaccatagctgattacc
I3J363_BCL2L10-01       ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3B4ETX9_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3Q4MN81_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3P8PVZ8_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3Q2UUN9_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3P9BLI0_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3Q2UUN9_BCL2L10      ggagcc---catgagctgcagaaggctggcagagaccatagctgattacc
A0A3Q3JQ78_BCL2L10      ggggcc---cggaaactgcagggaactagcagagaccatagctgattacc
A0A3B4TIY6_BCL2L10      ggggct---cggaaactgcaggggactggcagagaccatagctgattacc
A0A3B4WGF4_BCL2L10      ggggct---cagaaactgcaggggactggcagagaccatagctgattacc
A0A3Q3KZW1_BCL2L10      ggggcc---tgagagctgcaggggactggcagagaccatagctgattacc
A0A3Q1IAB0_BCL2L10      ggagcc---tggacaatgtaggggactggcagagaccatagctgattacc
A0A3B4ZFS0_BCL2L10      ggggcc---cgtaaactgcaggggactggcagagaccatagctgattacc
A0A3Q1GM98_BCL2L10      gaggcc---tgtaaactgcagaggactggcagagaccatagctgattact
A0A3Q1D2L0_BCL2L10      ggggcc---cgtaaactgcagagaactggcagagaccatagctgattacc
A0A3P8RL82_BCL2L10      ggggcc---cgtaaactgcagagaactggcagagaccatagctgattacc
A0A1U7QVA0_BCL2L10      gaaagtgctccaagactgccaactcatagtggccttgctgtgcaatcgac
Q9Z0F3_BCL2L10-01       catagtgacccgagactgctgtctcatagtgaactttctgtataatctgc
Q99M66_BCL2L10-01       cctactggagcgagactgctatctcatagtgagcttgctgtacaatcgac
G1QEX2_BCL2L10-01       caccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggc
F1RZB9_BCL2L10-01       caacgttagcagggactgccgactcctggtggctttgctgtgcgctcagc
W5QIG4_BCL2L10-01       cagcgttagcagggactgtcggctcctcgtggcccttctctgcgctcagt
E1B9B3_BCL2L10-01       cggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagt
F1MV39_BCL2L10-01       cggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagt
H0WZ06_BCL2L10-01       cgaagtcgccagggattgccagcgcctagtggccctactgagctctcggc
G1T264_BCL2L10-01       tgaaatcgcccgggactgccagcgcttggtggccttgctgtgcgctcgcc
A0A2K6F2Q2_BCL2L10      cgaagtcgcccgggaccgccagcgcctggtggccctgctgtgcgcccggc
A0A1U7UZD8_BCL2L10      cgacgttgcgcgggactgccagcgcctggtggccttgctgagcgcgcggc
A0A2K6TIT7_BCL2L10      cgacgtcgcccgggactgccagcgcctggtgggcttgctgagctcgcggc
A0A2K5RIU7_BCL2L10      caacgtctcccgggaccgccagcgcctggtgggcttgctgagctcgcggc
A0A2K5F974_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
F7CT87_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagttcgcggc
A0A0D9RG38_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K5TKG9_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
F7H6U5_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K6B2D9_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K5MMZ4_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A096NM44_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K5K3B0_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K6M5H5_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2K6R5T5_BCL2L10      cgaggtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
G1R3W6_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcgcc
H2NN92_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
Q9HD36_BCL2L10-02       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
G3QLU6_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
A0A2R9BCD9_BCL2L10      cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
H2Q9G4_BCL2L10-01       cgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggc
F6ZPD4_BCL2L10-01       cggcgtggaccgggactggccgcgcctggtggacttcctgtgcgcatggc
A0A337RYG8_BCL2L10      caacgttggccaggactgccagcacctggtggctttgctctgcaatcggc
M3Y8D1_BCL2L10-01       cagcgttcgccaagactgccggcgcctggtggacttcctctgcggtcggc
G1LKR4_BCL2L10-01       cggcgtccgccaggactgccggcacctggtggacttcctctgcaatcggc
A0A452QJG0_BCL2L10      cggcgtccgccaggactgccggcacctggtggacttcctctgcaatcggc
                                         *        *           *           

F6VJQ0_BCL2L10-01       tggtggag---aggaagggcgcgtggctgcatgagaacggaggctg----
D2IT42_BCL2L10-02       taggggag---gagaagagggactggctgctggagaacgggggctg----
A0A3B5MJ12_BCL2L10      tggagaag---cacaaaaaggactggctacaggaaaataatggatg----
M4AUW7_BCL2L10-01       tggagaag---cacaaaaaggactggctacaggaaaataatggatg----
A0A3P9NE65_BCL2L10      tggagaag---cacaaaaaagactggctgcaggaaaataatggatg----
A0A3B3TYN4_BCL2L10      tggagaag---cacaaaaaagactggctgcaggaaaataatggatg----
A0A096ME02_BCL2L10      tggagaag---cacaaaaaagactggctgcaggaaaataatggatg----
A0A3B3YT99_BCL2L10      tggagaag---cacaaaaaagactggctgcaggaaaataatggatg----
A0A3Q2GL87_BCL2L10      tggagacg---cacaaaaaagactggctgcaggaaaataatggatg----
A0A3Q2PJS5_BCL2L10      tggagaag---cacaaaaaggactggctacaggaaaacgacggatg----
A0A3B3C5I4_BCL2L10      tgggagga---gacaagaaagagtggatgctagaaaatgatggatg----
A0A3P9IIZ2_BCL2L10      tgggagga---gacaagaaagagtggatgctagaaaatgatggatg----
A0A3P9LM07_BCL2L10      tgggagga---gacaagaaagagtggatgctagaaaatgatggatg----
H2MBQ3_BCL2L10-01       tgggagga---gacaagaaagaatggatgctagaaaatgatggatg----
A0A3B4AAV4_BCL2L10      tgggggaa---gagaagagggactggctgttggaaaacggtggctg----
A0A3P8W7K5_BCL2L10      tgggagaa---gagaagaaagcgtggcttttggagaatggtggatg----
A0A3Q3VI28_BCL2L10      tgggagag---gagaagaaagcctggctcctggagaacgacggatg----
A0A3B5KD08_BCL2L10      taggagag---gagaagaaagactggctgctggagaatggcggatg----
A0A3Q3EZT5_BCL2L10      tgggagag---gagaaaaaagagtggcttctggagaatgacggatg----
A0A3Q3EZT5_BCL2L10      tgggagag---gagaaaaaagagtggcttctggagaatgacggatg----
A0A3Q0S9R1_BCL2L10      tgggggaa---gagaagaaagactggctcttggacaatgatggatg----
I3J363_BCL2L10-01       tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3B4ETX9_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3Q4MN81_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3P8PVZ8_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3Q2UUN9_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3P9BLI0_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3Q2UUN9_BCL2L10      tgggagaa---gagaagaaagactggctgttggataatgatggatg----
A0A3Q3JQ78_BCL2L10      tgggagag---gagaagaaagactggctgctggaaaacgatggatg----
A0A3B4TIY6_BCL2L10      tgggagaa---gagaagaaagactggctgctggagaacggtggatg----
A0A3B4WGF4_BCL2L10      tgggagaa---gagaagaaagactggctgctggagaacggtggatg----
A0A3Q3KZW1_BCL2L10      tgggagag---gagaagaaagactggctgcaagagaatgacggatg----
A0A3Q1IAB0_BCL2L10      tgggagaa---gagaagaaagactggctgctggagaatgatggatg----
A0A3B4ZFS0_BCL2L10      tgggagag---gagaagaaagactggctgttggagaacgatggatg----
A0A3Q1GM98_BCL2L10      tgggagag---gagaagaaagactggctgttggagaatgatggatg----
A0A3Q1D2L0_BCL2L10      tgggagag---gagaagaaagactggctgttggagaatgatggatg----
A0A3P8RL82_BCL2L10      tgggagag---gagaagaaagactggctgttggagaatgatggatg----
A0A1U7QVA0_BCL2L10      tcctgagg---cggcatcgctcctggctggaggctcaaggtggctg----
Q9Z0F3_BCL2L10-01       tcatggggcgtcggcaccgcgccaggctggaggctctcggcggctg----
Q99M66_BCL2L10-01       tcacagga---cggcatcgctcctggctggaggctcacggtggctg----
G1QEX2_BCL2L10-01       tcacggag---acgcaccgcacctggatggaggcgcaaggtggctg----
F1RZB9_BCL2L10-01       tctcaggg---cagcatcgcacctggctattggcgaacggcggctg----
W5QIG4_BCL2L10-01       tctgcgaa---aggcaccgcgcctggctgatggcgaacggcggctg----
E1B9B3_BCL2L10-01       tctgcgaa---aggcaccgcgcctggctgatgactaacggcggctgggtg
F1MV39_BCL2L10-01       tctgcgaa---aggcaccgcgcctggctgatggctaacggcggctg----
H0WZ06_BCL2L10-01       tggtgggg---cagcaccgcgtttggctggaggctcaaggcggctg----
G1T264_BCL2L10-01       tcgcaggg---cagcaccgcgcctggctgcaggctcaaggcggctg----
A0A2K6F2Q2_BCL2L10      tggcgggg---cagcaccgcgcctggctgcaggctcaaggcggctg----
A0A1U7UZD8_BCL2L10      tcgcgggg---cggcaccgcgcctggctgcaggctcaaggcggctg----
A0A2K6TIT7_BCL2L10      tcgtgggg---cagcaccgtgcctggctggaggctcagggcggctgggtg
A0A2K5RIU7_BCL2L10      tcgtgggg---cagcaccgtgcctggctggaggctcagggcggctgggtg
A0A2K5F974_BCL2L10      tcgtgggg---cagcaccgtgcctggctggaggctcagggcggctgggtg
F7CT87_BCL2L10-01       tcgtgggg---cagcaccgtgcctggctggaggctcagggcggctg----
A0A0D9RG38_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcaaggcggctg----
A0A2K5TKG9_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggctg----
F7H6U5_BCL2L10-01       tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggctg----
A0A2K6B2D9_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggctg----
A0A2K5MMZ4_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggctg----
A0A096NM44_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggctgggtg
A0A2K5K3B0_BCL2L10      tcgcgggg---cagcaccgcgcctggcttcaggctcagggcggttg----
A0A2K6M5H5_BCL2L10      tcacgggg---cagcaccgcgcctggcttcaggctcagggcggctg----
A0A2K6R5T5_BCL2L10      tcacgggg---cagcaccgcgcctggcttcaggctcagggcggctgggtg
G1R3W6_BCL2L10-01       tcgtgggg---cagcaccgcgcctggctgcaggctcagggcggctgggtg
H2NN92_BCL2L10-01       tcgtgggg---cagcaccgcgcctggctgcaggctcagggcggctg----
Q9HD36_BCL2L10-02       tcatgggg---cagcaccgcgcctggctgcaggctcagggcggctgggtg
G3QLU6_BCL2L10-01       tcatgggg---cagcaccgcgcctggctgcaggctcagggcggctg----
A0A2R9BCD9_BCL2L10      tcgtgggg---cagcaccgcgcctggctgcaggctcagggcggctg----
H2Q9G4_BCL2L10-01       tcgtgggg---cagcaccgcgcctggctgcaggctcagggcggctg----
F6ZPD4_BCL2L10-01       tcaagggg---cggcaccgcgcctggctggaggctcactatggctg----
A0A337RYG8_BCL2L10      tcaccgga---cggcatcgcgcctggctggaggctcacgacggctg----
M3Y8D1_BCL2L10-01       tcacaggg---cagcaccgcgcctggctggaggcgcacggcggctg----
G1LKR4_BCL2L10-01       tcacggga---cagcatcgcgcctggctggaggcgcacgacggctg----
A0A452QJG0_BCL2L10      tcacggga---cagcatcgcgcctggctggaggcgcacgacggctg----
                        *              *        ** *             ** **    

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      --------------------------------------------------
A0A3Q2UUN9_BCL2L10      --------------------------------------------------
A0A3P9BLI0_BCL2L10      --------------------------------------------------
A0A3Q2UUN9_BCL2L10      --------------------------------------------------
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       agcgcgaaggacgcggggctggtgggcagcctgggacgcgcccacgctgc
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      agcacgcggagg-----aggacgtggggcgggatgggcacctgggaaggg
A0A2K5RIU7_BCL2L10      agcacgcggagg-----gggacacggggcgggatgggcacccgggaaggg
A0A2K5F974_BCL2L10      agcatgcggagg-----gggacac-gggcctcccgagtagctgggaata-
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      agcacgcggcggacaccgggacgcggggcgggacgggcatccgggaagcg
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      agcacgcggcggacaccgggacgcggggcgggacgggcatccgggaagcg
G1R3W6_BCL2L10-01       agcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcg
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       agcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcg
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       ----------------ga---ctgg---------ctttcaccaccacttc
D2IT42_BCL2L10-02       ----------------gg---aagg---------gttttgtaagttctcc
A0A3B5MJ12_BCL2L10      ----------------gg---aagg---------gttttgtagctatgcc
M4AUW7_BCL2L10-01       ----------------gg---aagg---------gttttgtagctatgcc
A0A3P9NE65_BCL2L10      ----------------gg---acgg---------gttttgtagctatgcc
A0A3B3TYN4_BCL2L10      ----------------gg---acgg---------gttttgtagctacgcc
A0A096ME02_BCL2L10      ----------------gg---acgg---------gttttgtagctacgcc
A0A3B3YT99_BCL2L10      ----------------gg---acgg---------gttttgtagctacgcc
A0A3Q2GL87_BCL2L10      ----------------gg---atgg---------gttctgtaactacgcc
A0A3Q2PJS5_BCL2L10      ----------------gg---acgg---------gttctgtaattacgcc
A0A3B3C5I4_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3P9IIZ2_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3P9LM07_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
H2MBQ3_BCL2L10-01       ----------------gg---aagg---------cttctgtaagttctcc
A0A3B4AAV4_BCL2L10      ----------------gg---tagg---------cttctgtgagttctcc
A0A3P8W7K5_BCL2L10      ----------------gg---aggg---------gttctgtgagttctct
A0A3Q3VI28_BCL2L10      ----------------gg---aggg---------gttctgtaagttctct
A0A3B5KD08_BCL2L10      ----------------gg---aggg---------gttctgtaagtactcc
A0A3Q3EZT5_BCL2L10      ----------------gg---aggg---------attctgtgagttctcc
A0A3Q3EZT5_BCL2L10      ----------------gg---aggg---------attctgtgagttctcc
A0A3Q0S9R1_BCL2L10      ----------------gg---aggg---------tttctgtaagtactcc
I3J363_BCL2L10-01       ----------------gg---aagg---------cttctgtaagttctcc
A0A3B4ETX9_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3Q4MN81_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3P8PVZ8_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3Q2UUN9_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3P9BLI0_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3Q2UUN9_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3Q3JQ78_BCL2L10      ----------------gg---aggg---------gttctgtaagttctcc
A0A3B4TIY6_BCL2L10      ----------------gg---aggg---------gttctgtaaattctcc
A0A3B4WGF4_BCL2L10      ----------------gg---aggg---------gttctgtaagttctcc
A0A3Q3KZW1_BCL2L10      ----------------gg---aagg---------gttctgcaagttctcc
A0A3Q1IAB0_BCL2L10      ----------------gg---aggg---------gttctgtaagttctcc
A0A3B4ZFS0_BCL2L10      ----------------gg---aagg---------cttcgttaagttctcc
A0A3Q1GM98_BCL2L10      ----------------gg---aagg---------cttctgtaagttctcc
A0A3Q1D2L0_BCL2L10      ----------------gg---aagg---------cttctgtaaattctcc
A0A3P8RL82_BCL2L10      ----------------gg---aagg---------cttctgtaaattctcc
A0A1U7QVA0_BCL2L10      ----------------gg---atgg---------cttttgtgtcatcttt
Q9Z0F3_BCL2L10-01       ----------------gg---atgg---------cttttgccgcttcttc
Q99M66_BCL2L10-01       ----------------gg---atgg---------cttttgccaattcttc
G1QEX2_BCL2L10-01       ----------------gg---atgg---------cttttgtcacaacttc
F1RZB9_BCL2L10-01       ----------------gg---atgg---------attttgtctcttcttc
W5QIG4_BCL2L10-01       ----------------gg---atgg---------attttgtctctccttc
E1B9B3_BCL2L10-01       c---------------gg---atgg---------attttgtctcttcttc
F1MV39_BCL2L10-01       ----------------gg---atgg---------attttgtctctttttc
H0WZ06_BCL2L10-01       ----------------gg---atgg---------cttttgtcagttcttc
G1T264_BCL2L10-01       ----------------gg---atgg---------cttttgtgtcttctac
A0A2K6F2Q2_BCL2L10      ----------------gg---atgg---------cttttgtgacttattc
A0A1U7UZD8_BCL2L10      ----------------gg---atgg---------cttttgtgtcttcttc
A0A2K6TIT7_BCL2L10      cccgcc----------ag---gtggggtatttttctcctgtgcctattaa
A0A2K5RIU7_BCL2L10      ctcacccacgtgccc-ag---atgg---------cttttgttacttcttc
A0A2K5F974_BCL2L10      -------------ta-gg---atgg---------cttttgttacttcttc
F7CT87_BCL2L10-01       ----------------gg---atgg---------cttttgttacttcttc
A0A0D9RG38_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
A0A2K5TKG9_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
F7H6U5_BCL2L10-01       ----------------gg---atgg---------cttttgtcacttcttc
A0A2K6B2D9_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
A0A2K5MMZ4_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
A0A096NM44_BCL2L10      cccacgaggccggcacgg---atgg---------cttttgtcacttcttc
A0A2K5K3B0_BCL2L10      ----------------gg---atgg---------cttctgtcacttcttc
A0A2K6M5H5_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
A0A2K6R5T5_BCL2L10      cccacgaggccggcacgg---atgg---------cttttgtcacttcttc
G1R3W6_BCL2L10-01       cccacgaggccggcacgg---atgg---------cttttgtcacttcttc
H2NN92_BCL2L10-01       ----------------gg---atgg---------cttttgtcacttcttc
Q9HD36_BCL2L10-02       cccacgaggctggcacgg---atgg---------cttttgtcacttcttc
G3QLU6_BCL2L10-01       ----------------gg---atgg---------cttttgtcacttcttc
A0A2R9BCD9_BCL2L10      ----------------gg---atgg---------cttttgtcacttcttc
H2Q9G4_BCL2L10-01       ----------------gg---atgg---------cttttgtcacttcttc
F6ZPD4_BCL2L10-01       ----------------gg---atgg---------cttttgtgacttct--
A0A337RYG8_BCL2L10      ----------------gg---atgg---------cttttgtctcttcttc
M3Y8D1_BCL2L10-01       ----------------gg---atgg---------cttttgtctcttcttc
G1LKR4_BCL2L10-01       ----------------gg---atgg---------cttttgtctcttcttc
A0A452QJG0_BCL2L10      ----------------ggtgaatgg---------cttttgtctcttcttc
                                               **          *              

F6VJQ0_BCL2L10-01       gaaaaaaggcaatctcctccaccaagtgactcaag-----taataataca
D2IT42_BCL2L10-02       aggat----------cgcccgagaggtgaaccaagagtcttcgatgaaga
A0A3B5MJ12_BCL2L10      cgcaa----------cgccagagaagcaagtcaggactcctccatgaaga
M4AUW7_BCL2L10-01       cgcaa----------cgccagagaagcaagtcaggactcctccatgaaga
A0A3P9NE65_BCL2L10      ctcaa----------tgccagagaagtaagtcaggactcctccatgaaga
A0A3B3TYN4_BCL2L10      cacaa----------cgccagagaagtaagtcaggactcctccatgaaga
A0A096ME02_BCL2L10      cacaa----------cgccagagaagtaagtcaggactcctccatgaaga
A0A3B3YT99_BCL2L10      cacaa----------cgccagagaagtaagtcaggactcctccatgaaga
A0A3Q2GL87_BCL2L10      cgcaa----------cgccagagaagtcagccaggactcctccatgaaga
A0A3Q2PJS5_BCL2L10      cacgg----------tgccagaggagcgagtcaggactcctccatgaaga
A0A3B3C5I4_BCL2L10      agaac----------agccagagaggtgagccaggactcgtccatgaaga
A0A3P9IIZ2_BCL2L10      agaac----------agccagagaggtgagtcaggactcgtccatgaaga
A0A3P9LM07_BCL2L10      agaac----------agccagagaggtgagtcaggactcgtccatgaaga
H2MBQ3_BCL2L10-01       agaac----------agccagagaggtgagtcaggactcgtccatgaaga
A0A3B4AAV4_BCL2L10      tgtca----------tgccaggaaggtggaccaggactcgtcgatgaaga
A0A3P8W7K5_BCL2L10      cacag----------tgccagagagctgagccaggactcgtccatgaaga
A0A3Q3VI28_BCL2L10      cactc----------tgccagagaggcaaggctggactcatcgatgaaga
A0A3B5KD08_BCL2L10      ctcgc----------tgccagggaggtgaatcacgactcgtccatgaaga
A0A3Q3EZT5_BCL2L10      cgcag----------cgctagagagacgagccaggactcgtccatgaaga
A0A3Q3EZT5_BCL2L10      cgcag----------cgctagagagacgagccaggactcgtccatgaaga
A0A3Q0S9R1_BCL2L10      cgcag----------tgccagagaggtgagccaggactcttccatgaaga
I3J363_BCL2L10-01       cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3B4ETX9_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3Q4MN81_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3P8PVZ8_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3Q2UUN9_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3P9BLI0_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3Q2UUN9_BCL2L10      cgcag----------tgccagagaagtgagccaggactcatccatgaaga
A0A3Q3JQ78_BCL2L10      cgcag----------cgccagagaggtgagccatgactcgtccgtgaaga
A0A3B4TIY6_BCL2L10      cacag----------tgccagagaggtgagccaggacttgtcgatgaaga
A0A3B4WGF4_BCL2L10      cacag----------tgccagagaggtgagccaggacttgtcgatgaaga
A0A3Q3KZW1_BCL2L10      cacag----------cgccagagaggtcagccacgactcatccatgaaga
A0A3Q1IAB0_BCL2L10      tgcag----------tgccagagaagtgagccaggactcctccatgaaga
A0A3B4ZFS0_BCL2L10      ctcag----------tgccagagaggtgagtcaggacttgtccatgaaga
A0A3Q1GM98_BCL2L10      ctcag----------tgccagaaaggcgagtcaggacttgtccatgaaga
A0A3Q1D2L0_BCL2L10      ctcag----------tgccagagaggtgagtcaggacttgtccatgaaga
A0A3P8RL82_BCL2L10      ctcag----------tgccagagaggtgagtcaggacttgtccatgaaga
A0A1U7QVA0_BCL2L10      gggag----------tcccttacc-a-----ctcg-atttttggagcaca
Q9Z0F3_BCL2L10-01       aagaa----------tcctttacc-g-----ctcg-gcttctggagaaga
Q99M66_BCL2L10-01       aagaa----------ccccttacc-a-----cccg-gcttctggagaaga
G1QEX2_BCL2L10-01       ---at----------gcctgcacc-g-----c----cgcctggggacaga
F1RZB9_BCL2L10-01       caagg----------ttcattgca-a-----caaa----cttggacaaga
W5QIG4_BCL2L10-01       ag-cc----------actcattgcaa-----c----catcttgggaaaga
E1B9B3_BCL2L10-01       ag-cc----------actcattccag-----c----catcttgggaaaga
F1MV39_BCL2L10-01       ag-cc----------agtcattccag-----c----catcttgggaaaga
H0WZ06_BCL2L10-01       aggac----------acccttacc-g-----ctag-ctttttggagaaga
G1T264_BCL2L10-01       cggac----------tcccttacc-g-----ctga-ccttctggagaaga
A0A2K6F2Q2_BCL2L10      aggaa----------acccttgcc-g-----ctag-ctgtttggaggaga
A0A1U7UZD8_BCL2L10      agtac----------acccttacc-a-----ctaa-ctttttggagaaga
A0A2K6TIT7_BCL2L10      atgac----------ctcctactc-g-----ctgg-c---atggagaaaa
A0A2K5RIU7_BCL2L10      aggac----------ctcctactc-a-----ctgg-cattatggagaaaa
A0A2K5F974_BCL2L10      aggac----------ctcctcctc-g-----ctgg-cattatggagaaaa
F7CT87_BCL2L10-01       aggac----------ctcctcctt-g-----ctgg-cattatggagaaaa
A0A0D9RG38_BCL2L10      aggag----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K5TKG9_BCL2L10      aggag----------cccctttcc-g-----ctgg-ctttttggagaaaa
F7H6U5_BCL2L10-01       aggag----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K6B2D9_BCL2L10      aggag----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K5MMZ4_BCL2L10      aggag----------cccctttcc-g-----ctgg-ctttttggagaaca
A0A096NM44_BCL2L10      aggag----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K5K3B0_BCL2L10      aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K6M5H5_BCL2L10      aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2K6R5T5_BCL2L10      aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
G1R3W6_BCL2L10-01       aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
H2NN92_BCL2L10-01       aggac----------cccccttcc-g-----ctgg-ctttttggagaaaa
Q9HD36_BCL2L10-02       aggac----------cccctttcc-a-----ctgg-ctttttggagaaaa
G3QLU6_BCL2L10-01       aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
A0A2R9BCD9_BCL2L10      aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
H2Q9G4_BCL2L10-01       aggac----------cccctttcc-g-----ctgg-ctttttggagaaaa
F6ZPD4_BCL2L10-01       ----c----------actcacact-g-----ccag-cttctcagaggata
A0A337RYG8_BCL2L10      ---tc----------acccatgct-g-----ccat-cttcttggagaaga
M3Y8D1_BCL2L10-01       ---ac----------acccgcgct-g-----c----tgtcttggaaaaga
G1LKR4_BCL2L10-01       ---ac----------acccatgct-g-----ccgt-cgtcttggaaaaga
A0A452QJG0_BCL2L10      ---ac----------acccatgctgg-----ccgtccgtcttggaaaaga
                                                       *               * *

F6VJQ0_BCL2L10-01       ctgtgctgcataatggcagcagcagcaggatttggac-tagtgggattag
D2IT42_BCL2L10-02       cggcg---c----tgttcgcggccgccggggtgggca-tcgcaggcctga
A0A3B5MJ12_BCL2L10      cggcg---c----tggttgctgtcgccggggtcggca-tcgctggactca
M4AUW7_BCL2L10-01       cggcg---c----tggttgctgtcgccggggtcggca-tcgctggactca
A0A3P9NE65_BCL2L10      cggcg---c----tggttgctgtcgccggggtcggca-tcgctgggctca
A0A3B3TYN4_BCL2L10      cggcg---c----tggttgctgtcgccggagtcggca-tcgcagggctca
A0A096ME02_BCL2L10      cggcg---c----tggttgctgtcgccggagtcggca-tcgcagggctca
A0A3B3YT99_BCL2L10      cggcg---c----tggttgctgtcgccggagtcggca-tcgcagggctca
A0A3Q2GL87_BCL2L10      cggcg---c----tggttgctgttgccggagtcggca-tcgctggactca
A0A3Q2PJS5_BCL2L10      cggcg---c----tggttgctgtagccggagtgggca-tcgccgggctca
A0A3B3C5I4_BCL2L10      cggcg---c----tctttgcagcggccagcgtgggcc-tggccggactca
A0A3P9IIZ2_BCL2L10      ctgcg---c----tcttcgcggcggccagcgtcggcc-tggctggactca
A0A3P9LM07_BCL2L10      ctgcg---c----tcttcgcggcggccagcgtgggcc-tggctggactca
H2MBQ3_BCL2L10-01       ctgcg---c----tcttcgcggcggccagcgtgggcc-tggctggactca
A0A3B4AAV4_BCL2L10      ccgct---c----tgtttgctgctgctggggtgggtt-tagctgggctta
A0A3P8W7K5_BCL2L10      ccgct---c----tgtttgctgctgctagtgttggcc-ttgctggactca
A0A3Q3VI28_BCL2L10      cggcc---t----tgtttgctgctgctggtgtgggtc-tcgccggtctca
A0A3B5KD08_BCL2L10      ccgca---c----tgttcgccgctgccggggtcggtc-tcgccgggctca
A0A3Q3EZT5_BCL2L10      cggca---c----tgtttgctgcggctggtgtgggcc-ttgctggactca
A0A3Q3EZT5_BCL2L10      cggca---c----tgtttgctgcggctggtgtgggcc-ttgctggactca
A0A3Q0S9R1_BCL2L10      ccgcg---c----tgtttgctgctgctggcgtcggcc-tggccgggctta
I3J363_BCL2L10-01       aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3B4ETX9_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3Q4MN81_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3P8PVZ8_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3Q2UUN9_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3P9BLI0_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3Q2UUN9_BCL2L10      aagcg---c----tgtttgctgccgccggtgtcggcc-ttgctgggctta
A0A3Q3JQ78_BCL2L10      cggcg---c----tgttcgctgctgctggcgtgggcc-tcgctggactca
A0A3B4TIY6_BCL2L10      cagca---c----tgtttgctgctgctggtgtgggcc-tcgctggactca
A0A3B4WGF4_BCL2L10      cagca---c----tatttgctgctgctggtgtgggcc-tcgctggactca
A0A3Q3KZW1_BCL2L10      cagcg---c----tgtttgctgctgctggagtgggtc-ttgctggactca
A0A3Q1IAB0_BCL2L10      gagcg---c----tgtttgctgctgctggtgtgggtc-ttgcgggactca
A0A3B4ZFS0_BCL2L10      cagcg---c----tgtttgctgctgctggtgtcggcc-tcgctggactca
A0A3Q1GM98_BCL2L10      cagcg---c----tgtttgctgctgccggtgtcggcc-tcgctggactca
A0A3Q1D2L0_BCL2L10      cagcg---c----tgtttgctgctgcgggtgtcggcc-ttgctgggctca
A0A3P8RL82_BCL2L10      cagcg---c----tgtttgctgctgcgggtgtcggcc-tcgctgggctta
A0A1U7QVA0_BCL2L10      ctgctgatc----aagacttttctgtcctgtgtcatt-gcaacagccatc
Q9Z0F3_BCL2L10-01       ttgctgatt----caggcttttctgtcaggcttcttt-gcaacagccatc
Q99M66_BCL2L10-01       ttgctgatc----cgggctattctgtcctgtttcttt-gcaacggccatc
G1QEX2_BCL2L10-01       ctgctggct----ccgcttctgagggcatgccttgta-ctcataatctta
F1RZB9_BCL2L10-01       cacatggtc----tgggtttttgtgtcatactgtaca-gcagtggtctta
W5QIG4_BCL2L10-01       cagctggtc----tggtttttcctctcatactggaca-gcaataatcata
E1B9B3_BCL2L10-01       cagctggtc----tggtttttcctctcatactggaca-gcaataatcata
F1MV39_BCL2L10-01       cagctggtc----tggtttttcctcgcatactggaca-gcaataatcata
H0WZ06_BCL2L10-01       ttgctgttc----gaagttttactgttgtgcttttta-gcaacggtcttc
G1T264_BCL2L10-01       ctgctggtc----cgcacttttctgtcctgctttgta-gctacagcctta
A0A2K6F2Q2_BCL2L10      ctgctggtc----caggttcttttgtcatgcttttta-gcaacgaccgtc
A0A1U7UZD8_BCL2L10      ctgccggtt----caggcgtttgtgtcatgcctttta-gcaatggccttc
A0A2K6TIT7_BCL2L10      ctgctggtc----ccggttttcctgtcatggttgtta-acagcagcattc
A0A2K5RIU7_BCL2L10      ttgctggtc----caggttttcctgtcatggttgtta-acagcagcattc
A0A2K5F974_BCL2L10      ctgctggtc----caggttttcctgtcatggttgtta-acagcagcattc
F7CT87_BCL2L10-01       gtgctggtc----caggttttcctgtcatggttgtta-acagcagtattc
A0A0D9RG38_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
A0A2K5TKG9_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
F7H6U5_BCL2L10-01       ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
A0A2K6B2D9_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
A0A2K5MMZ4_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
A0A096NM44_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-gcaacagccttc
A0A2K5K3B0_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-acaacagccttc
A0A2K6M5H5_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-acaacagccttc
A0A2K6R5T5_BCL2L10      ctgctgatc----caggctttcctggcatgcttgtta-acaacagccttc
G1R3W6_BCL2L10-01       cagctggtc----caggcttttctgtcatgcttgtta-acaacagccttc
H2NN92_BCL2L10-01       cagctggtc----caggcttttctgtcatgcttgtta-acaacagccttc
Q9HD36_BCL2L10-02       cagctggtc----caggcttttctgtcatgcttgtta-acaacagccttc
G3QLU6_BCL2L10-01       cagctggtc----caggcttttctgtcatgcttgtta-gcaacagccttc
A0A2R9BCD9_BCL2L10      cagctggtc----caggcttttctgtcatgcttgtta-acaacagccttc
H2Q9G4_BCL2L10-01       cagctggtc----caggcttttctgtcatgcttgtta-acaacagccttc
F6ZPD4_BCL2L10-01       ctgctggtc----cggtttcttctgtcatgcttttca-gcatcagtctta
A0A337RYG8_BCL2L10      ctgctggtc----caggctcttctgtcatgctttaca-gtaatgatctta
M3Y8D1_BCL2L10-01       ctgctggtc----caggctcttctgtcatgctttacg-gcagtgatctta
G1LKR4_BCL2L10-01       ctgctggcc----caggctcttctgtcctgcttcaca-gcggtgatctta
A0A452QJG0_BCL2L10      ctgctggcc----caggctcttctgtcctgcttcacaggcagtgatctta
                                                                          

F6VJQ0_BCL2L10-01       ctctt---ttattag-----------------------------------
D2IT42_BCL2L10-02       cgttc---cttttgg--------------t-----gcg------------
A0A3B5MJ12_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
M4AUW7_BCL2L10-01       ccttc---ctcctgg--------------t-----gcg------------
A0A3P9NE65_BCL2L10      ccttc---cttctgg--------------t-----gcg------------
A0A3B3TYN4_BCL2L10      ccttc---cttctgg--------------t-----gcg------------
A0A096ME02_BCL2L10      ccttc---cttctgg--------------t-----gcg------------
A0A3B3YT99_BCL2L10      ccttc---cttctgg--------------t-----gcg------------
A0A3Q2GL87_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3Q2PJS5_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3B3C5I4_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3P9IIZ2_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3P9LM07_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
H2MBQ3_BCL2L10-01       ccttc---ctcctgg--------------t-----gcg------------
A0A3B4AAV4_BCL2L10      ccttt---ctcttgg--------------t-----gcg------------
A0A3P8W7K5_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3Q3VI28_BCL2L10      ccttc---ctgctgg--------------t-----gcg------------
A0A3B5KD08_BCL2L10      cgttc---ctcctgg--------------t-----gcg------------
A0A3Q3EZT5_BCL2L10      ctttc---ctcctgg--------------t-----gcg------------
A0A3Q3EZT5_BCL2L10      ctttc---ctcctga--------------t-----ccgagtgcaggc---
A0A3Q0S9R1_BCL2L10      ctttc---cttttgg--------------t-----gcg------------
I3J363_BCL2L10-01       ccttc---ctcttgg--------------tcaaaggct------------
A0A3B4ETX9_BCL2L10      ccttc---ctcttgg--------------t-----gcg------------
A0A3Q4MN81_BCL2L10      ccttc---ctcttgg--------------t-----gcg------------
A0A3P8PVZ8_BCL2L10      ccttc---ctcttgg--------------t-----gcg------------
A0A3Q2UUN9_BCL2L10      ccttc---ctcttgg--------------t-----gcg------------
A0A3P9BLI0_BCL2L10      ccttc---ctcttgg--------------t-----gcg------------
A0A3Q2UUN9_BCL2L10      ccttc---ctcttg------------------------------------
A0A3Q3JQ78_BCL2L10      ccttc---ctcctggaaacaagtgggacat-----gtgagcgggaacagt
A0A3B4TIY6_BCL2L10      ccttt---ctcctgg--------------t-----gcg------------
A0A3B4WGF4_BCL2L10      ccttt---ctcctgg--------------t-----gcg------------
A0A3Q3KZW1_BCL2L10      ccttc---cttctgg--------------t-----gcg------------
A0A3Q1IAB0_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3B4ZFS0_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3Q1GM98_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3Q1D2L0_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A3P8RL82_BCL2L10      ccttc---ctcctgg--------------t-----gcg------------
A0A1U7QVA0_BCL2L10      ctgtt---tgtctgg--------------------aaaaga---------
Q9Z0F3_BCL2L10-01       ttttt---tatctgg--------------------aaacg----------
Q99M66_BCL2L10-01       tttta---tatctgg--------------------aaatg----------
G1QEX2_BCL2L10-01       atctg---cttgtgg--------------------ataaaa---------
F1RZB9_BCL2L10-01       ctcta---cttgtgg--------------------agaaaa---------
W5QIG4_BCL2L10-01       atcta---cttctgg--------------------ataaaa---------
E1B9B3_BCL2L10-01       atcta---cttctgg--------------------ataaaa---------
F1MV39_BCL2L10-01       atcta---cttctgg--------------------ataaaa---------
H0WZ06_BCL2L10-01       atcta---tttctgg--------------------acacga-c-------
G1T264_BCL2L10-01       ctctt---cgcctgg--------------------acgcgcgt-------
A0A2K6F2Q2_BCL2L10      atcta---tttctgg--------------------acacga---------
A0A1U7UZD8_BCL2L10      atctattttttctgg--------------------acacga---------
A0A2K6TIT7_BCL2L10      atcta---cttctgg--------------------acacga---------
A0A2K5RIU7_BCL2L10      atcta---cttctgg--------------------acacga---------
A0A2K5F974_BCL2L10      atcta---cttctgg--------------------acacga---------
F7CT87_BCL2L10-01       atcta---cttctgg--------------------acacga---------
A0A0D9RG38_BCL2L10      ggtta---tctctgg--------------------acaaga---------
A0A2K5TKG9_BCL2L10      ggtta---tctctgg--------------------acacga---------
F7H6U5_BCL2L10-01       ggtta---tctctgg--------------------acacga---------
A0A2K6B2D9_BCL2L10      ggtta---tctctgg--------------------acacga---------
A0A2K5MMZ4_BCL2L10      ggtta---tctctgg--------------------acacga---------
A0A096NM44_BCL2L10      ggtta---tctctgg--------------------acacga---------
A0A2K5K3B0_BCL2L10      ggtta---tctctgg--------------------acacga---------
A0A2K6M5H5_BCL2L10      ggtta---cctctgg--------------------acacga---------
A0A2K6R5T5_BCL2L10      ggtta---cctctgg--------------------acacga---------
G1R3W6_BCL2L10-01       attta---tttctgg--------------------acacga---------
H2NN92_BCL2L10-01       attta---tctctgg--------------------acacga---------
Q9HD36_BCL2L10-02       attta---tctctgg--------------------acacga---------
G3QLU6_BCL2L10-01       attta---tctctgg--------------------acacga---------
A0A2R9BCD9_BCL2L10      attta---tctctgg--------------------acacga---------
H2Q9G4_BCL2L10-01       attta---tctctgg--------------------acacga---------
F6ZPD4_BCL2L10-01       atcta---cctctgg--------------------acaaaa---------
A0A337RYG8_BCL2L10      atcta---cttctgg--------------------agaaga---------
M3Y8D1_BCL2L10-01       atcta---cttctgg--------------------aaaaga---------
G1LKR4_BCL2L10-01       atcta---cttctgg--------------------aaaagg---------
A0A452QJG0_BCL2L10      atcta---cttctgg--------------------aaaaga---------
                           *        *                                     

F6VJQ0_BCL2L10-01       ----------------------tcgtacgataa-----------------
D2IT42_BCL2L10-02       -------------ctag---------------------------------
A0A3B5MJ12_BCL2L10      -------------ctag---------------------------------
M4AUW7_BCL2L10-01       -------------ctag---------------------------------
A0A3P9NE65_BCL2L10      -------------ctag---------------------------------
A0A3B3TYN4_BCL2L10      -------------ctag---------------------------------
A0A096ME02_BCL2L10      -------------ctag---------------------------------
A0A3B3YT99_BCL2L10      -------------ctag---------------------------------
A0A3Q2GL87_BCL2L10      -------------ctag---------------------------------
A0A3Q2PJS5_BCL2L10      -------------ctag---------------------------------
A0A3B3C5I4_BCL2L10      -------------ctag---------------------------------
A0A3P9IIZ2_BCL2L10      -------------ctag---------------------------------
A0A3P9LM07_BCL2L10      -------------ctag---------------------------------
H2MBQ3_BCL2L10-01       -------------ctag---------------------------------
A0A3B4AAV4_BCL2L10      -------------ctag---------------------------------
A0A3P8W7K5_BCL2L10      -------------ctga---------------------------------
A0A3Q3VI28_BCL2L10      -------------ctag---------------------------------
A0A3B5KD08_BCL2L10      -------------ctag---------------------------------
A0A3Q3EZT5_BCL2L10      -------------ctag---------------------------------
A0A3Q3EZT5_BCL2L10      -------------ctga---------------------------------
A0A3Q0S9R1_BCL2L10      -------------ctag---------------------------------
I3J363_BCL2L10-01       -------------tcagattttga--------------------------
A0A3B4ETX9_BCL2L10      -------------ctag---------------------------------
A0A3Q4MN81_BCL2L10      -------------ctag---------------------------------
A0A3P8PVZ8_BCL2L10      -------------ctag---------------------------------
A0A3Q2UUN9_BCL2L10      -------------ctag---------------------------------
A0A3P9BLI0_BCL2L10      -------------ctag---------------------------------
A0A3Q2UUN9_BCL2L10      --------------tga---------------------------------
A0A3Q3JQ78_BCL2L10      tcaggaagtctgactga---------------------------------
A0A3B4TIY6_BCL2L10      -------------ctag---------------------------------
A0A3B4WGF4_BCL2L10      -------------ctag---------------------------------
A0A3Q3KZW1_BCL2L10      -------------ttag---------------------------------
A0A3Q1IAB0_BCL2L10      -------------ctag---------------------------------
A0A3B4ZFS0_BCL2L10      -------------ctag---------------------------------
A0A3Q1GM98_BCL2L10      -------------ctaa---------------------------------
A0A3Q1D2L0_BCL2L10      -------------ctaa---------------------------------
A0A3P8RL82_BCL2L10      -------------ctaa---------------------------------
A0A1U7QVA0_BCL2L10      -------------cta------tt-----ataa-----------------
Q9Z0F3_BCL2L10-01       ---------------t------tt-----ataa-----------------
Q99M66_BCL2L10-01       ---------------t------tt-----ataa-----------------
G1QEX2_BCL2L10-01       ---------------a------tc-----atg------------------
F1RZB9_BCL2L10-01       -------------tta------tt-----gtga-----------------
W5QIG4_BCL2L10-01       -------------tta------tc-----gtga-----------------
E1B9B3_BCL2L10-01       -------------tta------tc-----gtgagttctaaaattcttatt
F1MV39_BCL2L10-01       -------------tta------tt-----gtga-----------------
H0WZ06_BCL2L10-01       -------------tta------ct--------------------------
G1T264_BCL2L10-01       -------------gta------tc-----gtgagttgtaa----------
A0A2K6F2Q2_BCL2L10      -------------tta------tt-----atga-----------------
A0A1U7UZD8_BCL2L10      -------------tta------tt-----atga-----------------
A0A2K6TIT7_BCL2L10      -------------taa------tt-----aggagttttaaaatttttagc
A0A2K5RIU7_BCL2L10      -------------taa------tt-----aggagttttaaaatttttagc
A0A2K5F974_BCL2L10      -------------taa------tt-----aggagtttttaa---------
F7CT87_BCL2L10-01       -------------taa----------------------------------
A0A0D9RG38_BCL2L10      -------------tta------tt-----atga-----------------
A0A2K5TKG9_BCL2L10      -------------tta------tt-----atga-----------------
F7H6U5_BCL2L10-01       -------------tta------tt-----atga-----------------
A0A2K6B2D9_BCL2L10      -------------tta------tt-----atga-----------------
A0A2K5MMZ4_BCL2L10      -------------tta------tt-----atga-----------------
A0A096NM44_BCL2L10      -------------tta------tt-----atgagttttaacatttttaac
A0A2K5K3B0_BCL2L10      -------------tta------tt-----atga-----------------
A0A2K6M5H5_BCL2L10      -------------tta------tt-----atga-----------------
A0A2K6R5T5_BCL2L10      -------------tta------tt-----atgagttttaaaatttttaac
G1R3W6_BCL2L10-01       -------------tta------tt-----atgagttttaaaacttttaac
H2NN92_BCL2L10-01       -------------tta------tt-----atga-----------------
Q9HD36_BCL2L10-02       -------------tta------tt-----atgagttttaaaacttttaac
G3QLU6_BCL2L10-01       -------------tta------tt-----atga-----------------
A0A2R9BCD9_BCL2L10      -------------tta------tt-----atga-----------------
H2Q9G4_BCL2L10-01       -------------tta------tt-----atga-----------------
F6ZPD4_BCL2L10-01       -------------tta------tc-----atga-----------------
A0A337RYG8_BCL2L10      -------------tta------tt-----gtga-----------------
M3Y8D1_BCL2L10-01       -------------tta--ccatttattgggtga-----------------
G1LKR4_BCL2L10-01       -------------tta------tt-----gtga-----------------
A0A452QJG0_BCL2L10      -------------ttatgtgagtt-----ctga-----------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3Q2GL87_BCL2L10      --------------------------------------------------
A0A3Q2PJS5_BCL2L10      --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3P9IIZ2_BCL2L10      --------------------------------------------------
A0A3P9LM07_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3Q3VI28_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q3EZT5_BCL2L10      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3Q4MN81_BCL2L10      --------------------------------------------------
A0A3P8PVZ8_BCL2L10      --------------------------------------------------
A0A3Q2UUN9_BCL2L10      --------------------------------------------------
A0A3P9BLI0_BCL2L10      --------------------------------------------------
A0A3Q2UUN9_BCL2L10      --------------------------------------------------
A0A3Q3JQ78_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3Q3KZW1_BCL2L10      --------------------------------------------------
A0A3Q1IAB0_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3P8RL82_BCL2L10      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       tctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagacc
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      ccacttctgcctgcccaactgtga--------------------------
A0A2K5RIU7_BCL2L10      ccacttctacctgcccaactgtga--------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      ccacttctacctgcccaactgtga--------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      ccacttctacctgcccaactgtga--------------------------
G1R3W6_BCL2L10-01       ccgcttctacctgcacagctgtga--------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       ccgcttctacctgcccaactgtga--------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
A0A452QJG0_BCL2L10      --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       -------------------------------------------------
D2IT42_BCL2L10-02       -------------------------------------------------
A0A3B5MJ12_BCL2L10      -------------------------------------------------
M4AUW7_BCL2L10-01       -------------------------------------------------
A0A3P9NE65_BCL2L10      -------------------------------------------------
A0A3B3TYN4_BCL2L10      -------------------------------------------------
A0A096ME02_BCL2L10      -------------------------------------------------
A0A3B3YT99_BCL2L10      -------------------------------------------------
A0A3Q2GL87_BCL2L10      -------------------------------------------------
A0A3Q2PJS5_BCL2L10      -------------------------------------------------
A0A3B3C5I4_BCL2L10      -------------------------------------------------
A0A3P9IIZ2_BCL2L10      -------------------------------------------------
A0A3P9LM07_BCL2L10      -------------------------------------------------
H2MBQ3_BCL2L10-01       -------------------------------------------------
A0A3B4AAV4_BCL2L10      -------------------------------------------------
A0A3P8W7K5_BCL2L10      -------------------------------------------------
A0A3Q3VI28_BCL2L10      -------------------------------------------------
A0A3B5KD08_BCL2L10      -------------------------------------------------
A0A3Q3EZT5_BCL2L10      -------------------------------------------------
A0A3Q3EZT5_BCL2L10      -------------------------------------------------
A0A3Q0S9R1_BCL2L10      -------------------------------------------------
I3J363_BCL2L10-01       -------------------------------------------------
A0A3B4ETX9_BCL2L10      -------------------------------------------------
A0A3Q4MN81_BCL2L10      -------------------------------------------------
A0A3P8PVZ8_BCL2L10      -------------------------------------------------
A0A3Q2UUN9_BCL2L10      -------------------------------------------------
A0A3P9BLI0_BCL2L10      -------------------------------------------------
A0A3Q2UUN9_BCL2L10      -------------------------------------------------
A0A3Q3JQ78_BCL2L10      -------------------------------------------------
A0A3B4TIY6_BCL2L10      -------------------------------------------------
A0A3B4WGF4_BCL2L10      -------------------------------------------------
A0A3Q3KZW1_BCL2L10      -------------------------------------------------
A0A3Q1IAB0_BCL2L10      -------------------------------------------------
A0A3B4ZFS0_BCL2L10      -------------------------------------------------
A0A3Q1GM98_BCL2L10      -------------------------------------------------
A0A3Q1D2L0_BCL2L10      -------------------------------------------------
A0A3P8RL82_BCL2L10      -------------------------------------------------
A0A1U7QVA0_BCL2L10      -------------------------------------------------
Q9Z0F3_BCL2L10-01       -------------------------------------------------
Q99M66_BCL2L10-01       -------------------------------------------------
G1QEX2_BCL2L10-01       -------------------------------------------------
F1RZB9_BCL2L10-01       -------------------------------------------------
W5QIG4_BCL2L10-01       -------------------------------------------------
E1B9B3_BCL2L10-01       aaatcagagtaaaccaccttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01       -------------------------------------------------
H0WZ06_BCL2L10-01       -------------------------------------------------
G1T264_BCL2L10-01       -------------------------------------------------
A0A2K6F2Q2_BCL2L10      -------------------------------------------------
A0A1U7UZD8_BCL2L10      -------------------------------------------------
A0A2K6TIT7_BCL2L10      -------------------------------------------------
A0A2K5RIU7_BCL2L10      -------------------------------------------------
A0A2K5F974_BCL2L10      -------------------------------------------------
F7CT87_BCL2L10-01       -------------------------------------------------
A0A0D9RG38_BCL2L10      -------------------------------------------------
A0A2K5TKG9_BCL2L10      -------------------------------------------------
F7H6U5_BCL2L10-01       -------------------------------------------------
A0A2K6B2D9_BCL2L10      -------------------------------------------------
A0A2K5MMZ4_BCL2L10      -------------------------------------------------
A0A096NM44_BCL2L10      -------------------------------------------------
A0A2K5K3B0_BCL2L10      -------------------------------------------------
A0A2K6M5H5_BCL2L10      -------------------------------------------------
A0A2K6R5T5_BCL2L10      -------------------------------------------------
G1R3W6_BCL2L10-01       -------------------------------------------------
H2NN92_BCL2L10-01       -------------------------------------------------
Q9HD36_BCL2L10-02       -------------------------------------------------
G3QLU6_BCL2L10-01       -------------------------------------------------
A0A2R9BCD9_BCL2L10      -------------------------------------------------
H2Q9G4_BCL2L10-01       -------------------------------------------------
F6ZPD4_BCL2L10-01       -------------------------------------------------
A0A337RYG8_BCL2L10      -------------------------------------------------
M3Y8D1_BCL2L10-01       -------------------------------------------------
G1LKR4_BCL2L10-01       -------------------------------------------------
A0A452QJG0_BCL2L10      -------------------------------------------------
                                                                         

© 1998-2019