Dataset for CDS BCL2L10 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

49 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       atgtcgagaggcggagtcacacattctctatcagctgaagggaagactca
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       ------------------------atgggtgtggcggcccctccctgggc
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       -------------------------------atgt---------------
A0A3B4AAV4_BCL2L10      -------------------------------atgt---------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3B3TYN4_BCL2L10      -atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcac
A0A096ME02_BCL2L10      -atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcac
A0A3B3YT99_BCL2L10      -atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcac
H2MBQ3_BCL2L10-01       -------------------------------atgt---------------
A0A3B3C5I4_BCL2L10      -------atggatggtttttctgctcagaaaatgt---------------
I3J363_BCL2L10-01       actgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctg
A0A3B4ETX9_BCL2L10      -------------------------------atgtgcagagagcagtctg
A0A3B5KD08_BCL2L10      -------------------------------atgt---------------
A0A3B4ZFS0_BCL2L10      -------------------------------atgt---------------
A0A3B4TIY6_BCL2L10      -------------------------------atgt---------------
A0A3B4WGF4_BCL2L10      -------------------------------atgt---------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       ----------------------------------ggtcggccccccggta
E1B9B3_BCL2L10-01       -----------------------------------atga-----ctgaag
F1MV39_BCL2L10-01       -----------------------------------gttg-----ctgatg
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       -------------------------------aggccccagcggaggctgg
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      -------------------------------atggctgaccagttgcggg
A0A2K6M5H5_BCL2L10      -------------------------------atggctgacccgttgcggg
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       -------------------------------atggttgaccagt------
H2NN92_BCL2L10-01       -------------------------------atggttgaccagttgcggg
Q9HD36_BCL2L10-01       -------------------------------atggttgaccagttgcggg
Q9HD36_BCL2L10-02       -------------------------------atggttgaccagttgcggg
G3QLU6_BCL2L10-01       -------------------------------atggttgaccagtggcggg
A0A2R9BCD9_BCL2L10      -------------------------------atggttgaccagtggcgtg
H2Q9G4_BCL2L10-01       -------------------------------atggttgaccagtggcgtg
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       ggaggcgcagcgggacctagaaaaccgggtcgggtcgggcagcgcgggga
                                                                          

F6VJQ0_BCL2L10-01       -----------atggattaca---agtgtgctcttagggaagagacggcg
D2IT42_BCL2L10-02       ------------------------cgtgtaggctgtggaaagagaccctg
A0A3B4AAV4_BCL2L10      ------------------------cgtgtgggctgtggaaagagaccttg
A0A3B5MJ12_BCL2L10      -----------------atgt---cctgtgggctgtggaaagagaccgtg
M4AUW7_BCL2L10-01       -----------------atgt---cctgtgggctgtggaaagagaccgtg
A0A3B3TYN4_BCL2L10      atatcgctgggaggaaaatgt---cctgtgggctgtggaaagagaccgtg
A0A096ME02_BCL2L10      atatcgctgggaggaaaatgt---cctgtgggctgtggaaagagaccgtg
A0A3B3YT99_BCL2L10      atatcgctgggaggaaaatgt---cctgtgggctgtggaaagagaccgtg
H2MBQ3_BCL2L10-01       ------------------------cttgtgggctgaggaaagagacccta
A0A3B3C5I4_BCL2L10      ------------------------cttgtgggctgaggaaagagacccta
I3J363_BCL2L10-01       atatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctg
A0A3B4ETX9_BCL2L10      atatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctg
A0A3B5KD08_BCL2L10      ------------------------cgtgcgggctgtggaaagagaccctg
A0A3B4ZFS0_BCL2L10      ------------------------cctgtgggctatggaaagagaccttg
A0A3B4TIY6_BCL2L10      ------------------------catgcgggctgtggaaagagacccgg
A0A3B4WGF4_BCL2L10      ------------------------catgcgggctgtggaaagagacccgg
Q9Z0F3_BCL2L10-01       -----------atggccgactcgcaggacccactgcatgaacgcactaga
Q99M66_BCL2L10-01       -----------atgg---------gtgacccgctgcaggatcgcactaga
G1QEX2_BCL2L10-01       --------------------------gacgagttgaagttgcgcacccga
F1RZB9_BCL2L10-01       -----------atgg---------cggacgcgttcagggagcgcacagcc
W5QIG4_BCL2L10-01       gaggcggagccatgg---------tggacccgtttagggagcgcacggcc
E1B9B3_BCL2L10-01       gc---ggagccatgg---------tggacccgtttagggagcgcaccgcc
F1MV39_BCL2L10-01       gacaggaaagcctgg---------t------------ggagcgcaccgcc
H0WZ06_BCL2L10-01       -----------atgg---------cagacccgttgagggagcgcaccgag
G1T264_BCL2L10-01       cc---------atgg---------cagacgctttggaggagcgcactgcg
A0A2K6F2Q2_BCL2L10      -----------atgg---------gtgaccggttcagggagcgcaccgag
A0A2K6TIT7_BCL2L10      -----------atgg---------ctgacccgctgcagcagcgcaccgag
A0A2K5F974_BCL2L10      -----------atgg---------ctgacccgctgcggcagcgcaccgag
F7CT87_BCL2L10-01       -----------atgg---------ctgacccgctgcggcagcgcaccgag
A0A0D9RG38_BCL2L10      -----------atgg---------ctgacccgttgcgggagcgcaccgag
A0A2K5TKG9_BCL2L10      -----------atgg---------ctgacccgttgcgggagcgcaccgag
F7H6U5_BCL2L10-01       -----------atgg---------ctgacccgttgcgggagcgcaccgag
A0A2K6B2D9_BCL2L10      -----------atgg---------ctgacccgttgcgggagcgcaccgag
A0A2K5MMZ4_BCL2L10      -----------atgg---------ctgacccgttgcgggagcgcaccgag
A0A096NM44_BCL2L10      -----------atgg---------ctgacccgttgcgggagcgcaccgag
A0A2K5K3B0_BCL2L10      agcgcaccaacgtgg---------ctgacccgttgcgcgagcgcaccgag
A0A2K6M5H5_BCL2L10      agcgcaccaccgtgg---------ctgacccgttgcgcgagcgcaccgag
A0A2K6R5T5_BCL2L10      -----------atgg---------ctgacccgttgcgcgagcgcaccgag
G1R3W6_BCL2L10-01       ---------------------------------tgcgggagcgcaccgag
H2NN92_BCL2L10-01       agcgcactatcacgg---------ccgacctgctgagggagcgcaccgag
Q9HD36_BCL2L10-01       agcgcaccaccatgg---------ccgacccgctgcgggagcgcaccgag
Q9HD36_BCL2L10-02       agcgcaccaccatgg---------ccgacccgctgcgggagcgcaccgag
G3QLU6_BCL2L10-01       agcgcaccaccatgg---------ccgacccgctgcgggagcgcaccgag
A0A2R9BCD9_BCL2L10      agcgcactaccatgg---------ccgacccgctgcgggagcgcaccgag
H2Q9G4_BCL2L10-01       agcgcaccaccatgg---------ccgacccgctgcgggagcgcaccgag
F6ZPD4_BCL2L10-01       -----------gtgg---------cggaggcgctgagggagcgcacggcg
A0A337RYG8_BCL2L10      -----------atgg---------ctgacgcgttgagggagcgcacggcg
G1LKR4_BCL2L10-01       -----------atgg---------cggacgcgttgaggg---gcacggcg
M3Y8D1_BCL2L10-01       gaggtcgggccatgg---------cggacgctttgagggagcgcacggcg
                                                                    **    

F6VJQ0_BCL2L10-01       cggctggtaactgactacctggaatattgttgc-cggagggaaggc-gtc
D2IT42_BCL2L10-02       gccctgtcagaggactacctgttgtcctgcactgca--agcaca---ggc
A0A3B4AAV4_BCL2L10      gctctggcagaggactacctga--gcctgtgctgcagcggccca---cag
A0A3B5MJ12_BCL2L10      gttgttgcagaggattacatcc--gcctgcgctgctcaagccca---cac
M4AUW7_BCL2L10-01       gttgttgcagaggattacatcc--gcctgcgctgctcaagccca---cac
A0A3B3TYN4_BCL2L10      gctgttgcagaggattacatcc--gcctgtgctgctcaagccca---cac
A0A096ME02_BCL2L10      gctgttgcagaggattacatcc--acctgcgctgctcaagccca---cac
A0A3B3YT99_BCL2L10      gctgttgcagaggattacatcc--acctgcgctgctcaagccca---cac
H2MBQ3_BCL2L10-01       gctgtggccctggattacctgt--ccctgagctgcaggagccca---ctc
A0A3B3C5I4_BCL2L10      gctgtggccctggattacctgt--ccctgagctgcaggagcccagtcctc
I3J363_BCL2L10-01       cttttggccgaggactacctgt--ccttttgctgcacgagtcca---cat
A0A3B4ETX9_BCL2L10      gttttggccgaggactacctgt--ccttttgctgcacgagtcca---cat
A0A3B5KD08_BCL2L10      gctcttgcagaggactacctgt--ccctgtgcagcacaagccag---tgt
A0A3B4ZFS0_BCL2L10      gttgtggcagaggactacctgt--ccctgtgctgcacaagccca---cat
A0A3B4TIY6_BCL2L10      gctgtggcagaggactacctgt--atctttgctgcacaagccca---cag
A0A3B4WGF4_BCL2L10      gctgtggcagaggactacctgt--tcctttgctgcacaagccca---cag
Q9Z0F3_BCL2L10-01       cggctgctgtctgactacatattcttctgcgca-cgggagccggac-acc
Q99M66_BCL2L10-01       cggctgctgactgactacatattgttctgcgca-cgggcgccgaac-acc
G1QEX2_BCL2L10-01       cggctgctgaccgagttcctggaacaccgcacc-cgaaggcgcggc-act
F1RZB9_BCL2L10-01       cggcttctgaccgactacctggagtactgcgcc-cgggagcccggc-acc
W5QIG4_BCL2L10-01       cggctgctgatggactggctggagttctgcgcc-cgggagcccggc-act
E1B9B3_BCL2L10-01       cggctgctgatggactacctggagttctgcgcc-cgggagccgggc-act
F1MV39_BCL2L10-01       cggctgctgatggactacctggagttctgcgcc-cgggagccgggc-act
H0WZ06_BCL2L10-01       cggctgctgactgactacctggagtactgcgcg-cgggatccgact-gcc
G1T264_BCL2L10-01       cgcctgctcaccgactacctggagtgctgcgcc-cgcgagcccggc-acc
A0A2K6F2Q2_BCL2L10      cggctgctggccgactacctggagtactgcaca-agggagccgggc-gcc
A0A2K6TIT7_BCL2L10      cagctggtggcggactacctggagtactgctcc-cgggagcccggc-acc
A0A2K5F974_BCL2L10      cggctggtggcggactacctggagtactgctcc-caggagcctggc-acc
F7CT87_BCL2L10-01       cagctggtgacggactacctggagtactgctcc-cgggagcctggc-acc
A0A0D9RG38_BCL2L10      cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K5TKG9_BCL2L10      cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
F7H6U5_BCL2L10-01       cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K6B2D9_BCL2L10      cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K5MMZ4_BCL2L10      cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A096NM44_BCL2L10      cggctcctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K5K3B0_BCL2L10      cggctgctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K6M5H5_BCL2L10      cggttgctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
A0A2K6R5T5_BCL2L10      cggttgctggccgactatctggggtgctgcgcc-cgggaacccggc-acc
G1R3W6_BCL2L10-01       cggctgctggccgactacctggggtgctgcgcc-cgggaacccggc-acc
H2NN92_BCL2L10-01       cggctgctggccgactacctggggtgctgcgcc-cgggaacccggc-acc
Q9HD36_BCL2L10-01       ctgttgctggccgactacctggggtactgcgcc-cgggaacccggc-acc
Q9HD36_BCL2L10-02       ctgttgctggccgactacctggggtactgcgcc-cgggaacccggc-acc
G3QLU6_BCL2L10-01       cggttgctggccgactacctggggtactgcgcc-cgggaacccggc-acc
A0A2R9BCD9_BCL2L10      cggttgctggccgactacctggggtactgcgcc-cgggaacccggc-acc
H2Q9G4_BCL2L10-01       cggttgctggccgactacctggggtactgcgcc-cgggaacccggc-acc
F6ZPD4_BCL2L10-01       ctactgctgatcgactacctgcagcgccgcgcc-cggga-----------
A0A337RYG8_BCL2L10      cagctactgactgactacctggagtactgcgcc-cgggagcccggc-agc
G1LKR4_BCL2L10-01       cggctgctgaccgactacctggagtactgcgcc-cgggagcccggc-acc
M3Y8D1_BCL2L10-01       cagctgctgaccgactacctggagtactgcgcc-cgcggccccggc-acc
                            *       ** *   *                              

F6VJQ0_BCL2L10-01       caggagctgccggcccctacccctgctgcagctacactgcgtttggtgtc
D2IT42_BCL2L10-02       acagccccgccgcctcccagcgagtcagccgcggccatgaggggactggc
A0A3B4AAV4_BCL2L10      gcagctcctccacctcccagcgggtcagcctctgccatgaggcgcctggg
A0A3B5MJ12_BCL2L10      ccagcccctccacctcccagcgagccggccgccgccatgaggcgcctggc
M4AUW7_BCL2L10-01       ccagcccctccacctcccagcgagccggccgccgccatgaggcgcctggc
A0A3B3TYN4_BCL2L10      ccagcccctccacctcccagcgagccggctgccgccatgaggcgcctggc
A0A096ME02_BCL2L10      ccagcccctccacctcccagcgagccggctgccgccatgaggcgcctggc
A0A3B3YT99_BCL2L10      ccagcccctccacctcccagcgagccggccgccgccatgaggcgcctggc
H2MBQ3_BCL2L10-01       caggcccccccacctcccagcgagtcagctgctgccatgaggcgcctggc
A0A3B3C5I4_BCL2L10      caggcccccccacctcccagcgagtcagcttctgccatgcggcgcctggc
I3J363_BCL2L10-01       caagcccctccacctcccagcgaatcagccgctgccatgaggcgtctggg
A0A3B4ETX9_BCL2L10      caagcccctccacctcccagcgaatcagccgctgccatgaggcgtctagg
A0A3B5KD08_BCL2L10      ccagcccctccacctcccagcgagtcggccactgccatgaggcacctggg
A0A3B4ZFS0_BCL2L10      tcagcccctccacctcccagcgagtcagccgctgccatgaggtgcctggc
A0A3B4TIY6_BCL2L10      ccagcccctccacctcccagcgaatcagccgctgccatgagaagtatggc
A0A3B4WGF4_BCL2L10      ccagcccctccacctcccagcgaatcagccgctgccatgagaggcatggc
Q9Z0F3_BCL2L10-01       ccagagccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgac
Q99M66_BCL2L10-01       cctgagccactgcccacgtctgttgaggcggccttgctgcgctctgtgac
G1QEX2_BCL2L10-01       gccccgcagcagccgtccacgcccgaggccaccgtgatgcgctccctggc
F1RZB9_BCL2L10-01       gccgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggc
W5QIG4_BCL2L10-01       ccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggc
E1B9B3_BCL2L10-01       ccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggc
F1MV39_BCL2L10-01       ccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggc
H0WZ06_BCL2L10-01       ccggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgac
G1T264_BCL2L10-01       cctgagccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggc
A0A2K6F2Q2_BCL2L10      ccggggctgccgccgtcctcgctcgaggccgccgcgatgcgcttcgcagc
A0A2K6TIT7_BCL2L10      cccgagtcgccaccggccacggccgaggccgctgtgctgcgcgccacggc
A0A2K5F974_BCL2L10      cccgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggc
F7CT87_BCL2L10-01       cccgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggc
A0A0D9RG38_BCL2L10      cctgagcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2K5TKG9_BCL2L10      cctgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
F7H6U5_BCL2L10-01       cctgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2K6B2D9_BCL2L10      cctgagccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2K5MMZ4_BCL2L10      cctgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagc
A0A096NM44_BCL2L10      cctgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagc
A0A2K5K3B0_BCL2L10      cccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2K6M5H5_BCL2L10      cccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2K6R5T5_BCL2L10      cccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggc
G1R3W6_BCL2L10-01       cccgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggc
H2NN92_BCL2L10-01       ccagagccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggc
Q9HD36_BCL2L10-01       cccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggc
Q9HD36_BCL2L10-02       cccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggc
G3QLU6_BCL2L10-01       cccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggc
A0A2R9BCD9_BCL2L10      cccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggc
H2Q9G4_BCL2L10-01       cccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggc
F6ZPD4_BCL2L10-01       -----------gccggccacgcccgaggtggccgtgctgcgctgcgtggc
A0A337RYG8_BCL2L10      cccgcgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggc
G1LKR4_BCL2L10-01       cctgcgcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggc
M3Y8D1_BCL2L10-01       cccgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggc
                                     *  *          *   *     *  *         

F6VJQ0_BCL2L10-01       gagcgagctccgccagatttaccaggacttcttcgagtgcgccctgaatc
D2IT42_BCL2L10-02       ccaggacatggagcggcagcactacgctcgcttc----caggc---tctg
A0A3B4AAV4_BCL2L10      ccaggacatggaggcccagcacaaggcacgcttc----cactc---tctg
A0A3B5MJ12_BCL2L10      ccaggacgtggaggccaagcaccaggctcgcttt----cactc---cctg
M4AUW7_BCL2L10-01       ccaggacgtggaggccaagcaccaggctcgcttt----cactc---cctg
A0A3B3TYN4_BCL2L10      ccaggacgtggaggcccagcaccaggctcgcttt----cactc---cctg
A0A096ME02_BCL2L10      ccaggacgtggaggcccagcaccaggctcgcttt----cactc---cctg
A0A3B3YT99_BCL2L10      ccaggacgtggaggcccagcaccaggctcgcttt----cactc---cctg
H2MBQ3_BCL2L10-01       ccaggacatggaggcgcagtaccagccccgcttc----tccac---ctta
A0A3B3C5I4_BCL2L10      ccaggacatggagacgcagtaccagccccgcttc----tccac---gcta
I3J363_BCL2L10-01       ctgggacatcgaaagacagcaccaagctcgcttc----gacaa---cctc
A0A3B4ETX9_BCL2L10      ctgggacatcgaaagacagcaccaagctcgcttc----gacaa---cctc
A0A3B5KD08_BCL2L10      tcaggacatggagaagcagcaccaggctcggttc----aactc---ccta
A0A3B4ZFS0_BCL2L10      ccaggacatggagaagcagcaccaggctcgcttc----cactc---cctc
A0A3B4TIY6_BCL2L10      ccaagacatggagacgcagcaccaggctcgcttc----cacac---cctt
A0A3B4WGF4_BCL2L10      ccaagacatggagacgcagcaccaggctcgcttc----cacac---cctt
Q9Z0F3_BCL2L10-01       taggcagatccagcaggagcaccaagaatttttt----tcctccttctgc
Q99M66_BCL2L10-01       tagtcagatccaacaggagcaccaggatcttttc----aactccttccgc
G1QEX2_BCL2L10-01       tgctcattcgtggctgggtaccccgcactcctgg----tcc-----cgga
F1RZB9_BCL2L10-01       tgcccagatacgggagtacaacgtgcgcaccttg----tctgtctaccgc
W5QIG4_BCL2L10-01       cgcccgtgtcctggaagcaaatcgaaacgtcttg----cccctataccgc
E1B9B3_BCL2L10-01       cgcacgtatccaggaagcaaatcgaaacgtcttg----cccctataccgc
F1MV39_BCL2L10-01       cgcacgtatccaggaagcaaatcgaaatgtcttg----cccctataccgc
H0WZ06_BCL2L10-01       cgcctatatacagcagcgccactggtcctttttc----tccgcctacata
G1T264_BCL2L10-01       cacgcagcttcagcgggtccactggcccttcttc----tccgtctaccgc
A0A2K6F2Q2_BCL2L10      caccaagatacggcggaagcacgcgtccttcttc----tccgcctacgtc
A0A2K6TIT7_BCL2L10      cgccgttgtacggaaactctacccgtccttcttc----tccgcttaccgc
A0A2K5F974_BCL2L10      cgccggtgtacggaaactctaccggtccttcttc----tccgcctacctc
F7CT87_BCL2L10-01       cgccagtgtgcggaaactctaccggtctttcttc----tccgcctacctc
A0A0D9RG38_BCL2L10      cgccaggttacggcagctccaccggtccttcttc----tccgcctacctc
A0A2K5TKG9_BCL2L10      cgccaggttacggcagctccaccggtccttcttc----tccgcctaccgc
F7H6U5_BCL2L10-01       cgccaggttacggcagctccaccggtccttcttc----tccgcctaccgc
A0A2K6B2D9_BCL2L10      cgccaggttacggcagctccaccggtccttcttc----tccgcctaccgc
A0A2K5MMZ4_BCL2L10      cgccaggttacggcagctccaccggtccttcttc----tccgcctaccgc
A0A096NM44_BCL2L10      cgccaggttacggcagctccaccggtccttcttc----tccgcctaccgc
A0A2K5K3B0_BCL2L10      ggcccgattacggcagctccatcggtccttcttc----tccgcctacctc
A0A2K6M5H5_BCL2L10      ggccaggttacggcagctccaccggtccttcttc----tctgcctacctc
A0A2K6R5T5_BCL2L10      ggccaggttacggcagctccaccggtccttcttc----tctgcctacctc
G1R3W6_BCL2L10-01       cgccaggttacggcagctccacccgtccttcttc----tccgcctacctc
H2NN92_BCL2L10-01       cgccaggttacggcagctccaccggtccttcttc----tccgcctacctc
Q9HD36_BCL2L10-01       cgccaggttacggcagattcaccggtcctttttc----tccgcctacctc
Q9HD36_BCL2L10-02       cgccaggttacggcagattcaccggtcctttttc----tccgcctacctc
G3QLU6_BCL2L10-01       cgccaggttacggcagattcaccggtccttcttc----tccgcctacctc
A0A2R9BCD9_BCL2L10      cgccaggttacggcagatccaccggtccttcttc----tccgcctacctc
H2Q9G4_BCL2L10-01       cgccaggttacggcagatccaccggtccttcttc----tccgcctacctc
F6ZPD4_BCL2L10-01       cgcccagatacagccccgcaaccagcgtgttctt----tcccgctaccgc
A0A337RYG8_BCL2L10      cgcccagatacggcagcgccaccagcgtttcttg----tcggcttaccgc
G1LKR4_BCL2L10-01       cgcccaggtacagcagcgtcacgagcgcttcttg----tccgattaccgc
M3Y8D1_BCL2L10-01       cgccgtcgtgcggcagcgtcacgagcgcttcttg----tcggattaccgc
                                                                          

F6VJQ0_BCL2L10-01       agctactcgaccgggaacctgagcaagtaa----------------tcgt
D2IT42_BCL2L10-02       gcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccg
A0A3B4AAV4_BCL2L10      agccagaccttcctcaagcagtgtgggccggacccctgctccagtctccg
A0A3B5MJ12_BCL2L10      gcccagggcttcctgaagcactgcgggtcggacctctgctccaacctcag
M4AUW7_BCL2L10-01       gcccagggcttcctgaagcactgcgggtcggacctctgctccaacctcag
A0A3B3TYN4_BCL2L10      gcccagggcttcctgaagcactgcgggacagacctctgctccaacctcag
A0A096ME02_BCL2L10      gcccagggcttcctgaagcactgcgggacagacctctgctccaacctcag
A0A3B3YT99_BCL2L10      gcccagggcttcctgaagcactgcgggacagacctctgctccaacctcag
H2MBQ3_BCL2L10-01       gcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcag
A0A3B3C5I4_BCL2L10      gctcaggacttcaggaagcactgcgggccggacctgtgctccagcctcag
I3J363_BCL2L10-01       gctcagaccttcctggtgcagtgtgggccggaccactgcctcagcctcag
A0A3B4ETX9_BCL2L10      gctcagaccttcctggtgcagtgtggaccagaccactgcctcagcctcag
A0A3B5KD08_BCL2L10      gctcagaccttcctgagacagtgcgggccggacctctgctccagcctcag
A0A3B4ZFS0_BCL2L10      actcagaccttcctgaggcagcccgggccggacctctgctccagcctcag
A0A3B4TIY6_BCL2L10      gctcaaaccttcgtaacgcagtgtgggctggacccctgctccagcctcag
A0A3B4WGF4_BCL2L10      gctcaaacctttgtaacgcagtgtgggctggacccctgctccagcctcag
Q9Z0F3_BCL2L10-01       gaaag---ccggggcaatcgcctggagctgg---------------tgaa
Q99M66_BCL2L10-01       gacta---ccagggcaaccgcctggagctgg---------------tgac
G1QEX2_BCL2L10-01       ggcag-------agaaaccgactcgagcaga---------------tggt
F1RZB9_BCL2L10-01       ggctt---ccgctggaaccgtgtcgaattgg---------------tggc
W5QIG4_BCL2L10-01       cgcta---ccgcaggcaccgcgtcgagctgg---------------tggc
E1B9B3_BCL2L10-01       cgctg---ccgcaggcaccgcgtcgagctgg---------------tggc
F1MV39_BCL2L10-01       cgctg---ccgcaggcaccgcgtcgagctgg---------------tggc
H0WZ06_BCL2L10-01       ggcta---ccccgggaatcgcgttcaggtgg---------------tgga
G1T264_BCL2L10-01       ggcta---ccccggcaaccgcatcgagctgg---------------cggc
A0A2K6F2Q2_BCL2L10      ggcta---ccccgggaaccgcgtctacctgc---------------tgga
A0A2K6TIT7_BCL2L10      ggcta---ccccaggaaccgcgtcgagctgg---------------tggc
A0A2K5F974_BCL2L10      ggcta---cccggggaaccgcgtcgagctgg---------------tggc
F7CT87_BCL2L10-01       ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A0D9RG38_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K5TKG9_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
F7H6U5_BCL2L10-01       ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K6B2D9_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K5MMZ4_BCL2L10      ggcta---ccgcgggaaccgcgtcgagctgg---------------tggc
A0A096NM44_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K5K3B0_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K6M5H5_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
A0A2K6R5T5_BCL2L10      ggcta---ccccgggaaccgcgtcgagctgg---------------tggc
G1R3W6_BCL2L10-01       ggcta---ccctgggaaccgcgtcgagctgg---------------tggt
H2NN92_BCL2L10-01       ggcta---ccccgggaaccgcgtcgaactgg---------------tggc
Q9HD36_BCL2L10-01       ggcta---ccccgggaaccgcttcgagctgg---------------tggc
Q9HD36_BCL2L10-02       ggcta---ccccgggaaccgcttcgagctgg---------------tggc
G3QLU6_BCL2L10-01       ggcta---ccccgggaaccgcttcgagctgg---------------tggc
A0A2R9BCD9_BCL2L10      ggcta---ccccgggaaccgcttcgagctgg---------------tggc
H2Q9G4_BCL2L10-01       ggcta---ccccgggaaccgcttcgagctgg---------------tggc
F6ZPD4_BCL2L10-01       ggctt---ccgcggggaccacgtcgggctgg---------------cggc
A0A337RYG8_BCL2L10      ggcta---ccgcggaaaccgcgtggaactgg---------------tggc
G1LKR4_BCL2L10-01       ggctacgccggcggcaaccgcgtggagctgg---------------tggc
M3Y8D1_BCL2L10-01       ggcta---cggcggcaaccgcgtcgagctgg---------------tggc
                                          *                               

F6VJQ0_BCL2L10-01       caacgtagcgga------gctcatggaccgaggcgagttcaactggggcc
D2IT42_BCL2L10-02       caaggtgatggaggagctggtgggagacggac---agttgaactggggga
A0A3B4AAV4_BCL2L10      gaaggtcatggaggagctggtgggagatggac---acttgaactggggaa
A0A3B5MJ12_BCL2L10      aaaggtgatggatgagatggtgggggacggac---actttaactggggga
M4AUW7_BCL2L10-01       aaaggtgatggatgagatggtgggggacggac---actttaactggggga
A0A3B3TYN4_BCL2L10      aaaggtgatggatgagatggtgggagatggac---attttaactggggga
A0A096ME02_BCL2L10      aaaggtgatggatgagatggtgggagatggac---attttaactggggga
A0A3B3YT99_BCL2L10      aaaggtgatggatgagatggtgggagatggac---attttaactggggga
H2MBQ3_BCL2L10-01       gaaggtgatggaggagctggtgggagatgaac---gcttgaactggggga
A0A3B3C5I4_BCL2L10      gaaggtgatggaggagctggtgggagatgaac---acttgaactggggga
I3J363_BCL2L10-01       aaaggtgatgaaggagctggttggagatggac---acttgaactggggga
A0A3B4ETX9_BCL2L10      aaaggtgatgaaggagctggttggggatggac---acttgaactggggga
A0A3B5KD08_BCL2L10      gaaagtgatggaggagctggtgggagatggac---acttgaactggggaa
A0A3B4ZFS0_BCL2L10      gagggtgatggaggagctggtgggagatggac---acttgaactggggga
A0A3B4TIY6_BCL2L10      gaaggtgatggaggagctggtgggagatggac---acttgaactggggga
A0A3B4WGF4_BCL2L10      gaaggtgatggaggagctggtgggagatggac---acttgaactggggga
Q9Z0F3_BCL2L10-01       acagatggcagataagttgctctccaaagaccaagacttcagctggagcc
Q99M66_BCL2L10-01       acagatggcggatgagttgctctccaatgaccaagagttcaactggggcc
G1QEX2_BCL2L10-01       cgaccagatagagtcgctagttccagacggcacagaccccaactggttga
F1RZB9_BCL2L10-01       ctggatggcacagaaactactcgcaagcccacgtggccccaactggtacc
W5QIG4_BCL2L10-01       caggatggcgcagaggctgctcgacgaagaccctggccccagctggggcc
E1B9B3_BCL2L10-01       caggatggcgcagaggctactcgacgaagaccctggccccagctggggcc
F1MV39_BCL2L10-01       caggatggcgcagaggctactcgacgaagaccctggccccagctggggcc
H0WZ06_BCL2L10-01       acggatggtgaaggctatgctctcagacaaccagagactcaactggggcc
G1T264_BCL2L10-01       gcgcgtggcggaggccgtgctctccgacggccacgacctcagctggggcc
A0A2K6F2Q2_BCL2L10      gcggatggcggaggccgtgctctgcgacagcctcag------ctggggcc
A0A2K6TIT7_BCL2L10      gaggatggcggaggccttgctctccgacagtcccggtcccacctggggca
A0A2K5F974_BCL2L10      gaggatggcggaggccctgctctccgacagtcccggccccacctggggca
F7CT87_BCL2L10-01       gaggatggcggaggccctgctctccgacagtcccggccccacctggggca
A0A0D9RG38_BCL2L10      gctgatggcggacgccgtgctctccgacagccccggccccacctggggca
A0A2K5TKG9_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
F7H6U5_BCL2L10-01       gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A2K6B2D9_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A2K5MMZ4_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A096NM44_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A2K5K3B0_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A2K6M5H5_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
A0A2K6R5T5_BCL2L10      gctgatggcggaggccgtgctctccgacagccccggccccacctggggca
G1R3W6_BCL2L10-01       gctgatggcggattccgtgctctccgacagccccggccccacctggggca
H2NN92_BCL2L10-01       gctgatggcggattccgtgctctccgacagccccagccccacctggggca
Q9HD36_BCL2L10-01       gctgatggcggattccgtgctctccgacagccccggccccacctggggca
Q9HD36_BCL2L10-02       gctgatggcggattccgtgctctccgacagccccggccccacctggggca
G3QLU6_BCL2L10-01       gctgatggcggattccgtgctctccgacagccccggccccacctggggca
A0A2R9BCD9_BCL2L10      gctgatggcggattccgtgctctccgacagccccggccccacctggggca
H2Q9G4_BCL2L10-01       gctgatggcggattccgtgctctccgacagccccggccccacctggggca
F6ZPD4_BCL2L10-01       acggatggcgcaggcgatcttcggagaccgccacgtccccagctggggcc
A0A337RYG8_BCL2L10      gcggttggagcaggatttactctccaacccccaaaccctcagttggggcc
G1LKR4_BCL2L10-01       tcaggtggagcgggagatactcgcccacccccagcccctaagctggggcc
M3Y8D1_BCL2L10-01       tcagttggagcgggagatactcgcccacccccaagccctaagctggggcc
                                            *                      ***    

F6VJQ0_BCL2L10-01       gggtggcggtgctagtggtttttgccggggcgctgctggagatg------
D2IT42_BCL2L10-02       gggtagtttccctcttcacctttaccgggg---tgctggccagacaactg
A0A3B4AAV4_BCL2L10      gggttgtgtcccttttcacctttgctgggg---tgctggccagacacata
A0A3B5MJ12_BCL2L10      gggtggtgtccctcttcgccttcgccggcg---tgctggccagacagctg
M4AUW7_BCL2L10-01       gggtggtgtccctcttcgccttcgccggcg---tgctggccagacagctg
A0A3B3TYN4_BCL2L10      gggtggtgtccctcttcgccttcgctggcg---tgctggccagacagctg
A0A096ME02_BCL2L10      gggtggtgtccctcttcgccttcgctggcg---tgctggccagacagctg
A0A3B3YT99_BCL2L10      gggtggtgtccctcttcgccttcgctggcg---tgctggccagacagctg
H2MBQ3_BCL2L10-01       gggtcgtttccctttttgcattcgtgggag---tgctggcgaggcagctg
A0A3B3C5I4_BCL2L10      gggttgtttccctttttgcattcgtgggag---tgctggcgagacagctg
I3J363_BCL2L10-01       gggttgtttctctttttgcctttactggag---tgctggccagaaagatc
A0A3B4ETX9_BCL2L10      gggttgtttctcttttcgcctttactggag---tgctggccagaaagatc
A0A3B5KD08_BCL2L10      gggttgtatcccttttcacctttactgggg---tgctggccagactgatg
A0A3B4ZFS0_BCL2L10      gggttgtttcccttttcacctttactgggg---tgctggccagacagctg
A0A3B4TIY6_BCL2L10      gggttgtttccattttcacctttactgggg---tgctggccagactgctg
A0A3B4WGF4_BCL2L10      gggttgtttccattttcacctttactgggg---tgctggccagactgctg
Q9Z0F3_BCL2L10-01       aactggtgatgctcctggccttcgcggggacgcttatgaatcaaggccct
Q99M66_BCL2L10-01       gcctggtgatgctcctggccttcgtggggacgctaatgaaccaag-----
G1QEX2_BCL2L10-01       gcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccg
F1RZB9_BCL2L10-01       gcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcct
W5QIG4_BCL2L10-01       gcgtggcctcactcgtgaccttcgcggggtctctgctggagaggcagccg
E1B9B3_BCL2L10-01       gcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccg
F1MV39_BCL2L10-01       gcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccg
H0WZ06_BCL2L10-01       gagtggtgacgctcgtgaccttcgcagggacgcttctacagag---gcct
G1T264_BCL2L10-01       gcgtggtgacgctcgtgaccttcgccgggacgcttctggacagagggccg
A0A2K6F2Q2_BCL2L10      gggtagtgatgctcgtgaccttcgcagggacgcttctagagagagggccg
A0A2K6TIT7_BCL2L10      acgtggtgatgctcctggccttcgcggggacgctgctagagagggggccg
A0A2K5F974_BCL2L10      acgtggtgatgctcctggccttcgcggggacgctgctagagagggggccg
F7CT87_BCL2L10-01       acgtggtgatgctcctggccttcgcggggacgctgctagagagggggccg
A0A0D9RG38_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K5TKG9_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
F7H6U5_BCL2L10-01       gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K6B2D9_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K5MMZ4_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A096NM44_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K5K3B0_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K6M5H5_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
A0A2K6R5T5_BCL2L10      gggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccg
G1R3W6_BCL2L10-01       gagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccg
H2NN92_BCL2L10-01       gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
Q9HD36_BCL2L10-01       gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
Q9HD36_BCL2L10-02       gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
G3QLU6_BCL2L10-01       gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
A0A2R9BCD9_BCL2L10      gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
H2Q9G4_BCL2L10-01       gagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggccg
F6ZPD4_BCL2L10-01       gcgtggcggcgctcgtgaccctggcggggacgctgctggagagagccccg
A0A337RYG8_BCL2L10      atgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccg
G1LKR4_BCL2L10-01       gtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccg
M3Y8D1_BCL2L10-01       gtgtggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccg
                           * *      *  *     *    **     *  *             

F6VJQ0_BCL2L10-01       ---ga---ggaactactgaaagaggagcaggtactg--------------
D2IT42_BCL2L10-02       ca-ggagaagaagggggtacaactggggcaggaccccgggacgggcaggg
A0A3B4AAV4_BCL2L10      aa-agagcagaagagtagcagaccagggctggaccctggacaagttcaag
A0A3B5MJ12_BCL2L10      cg-ggaacagacgggcaagaacccggtgccggactccgggaagcagcagg
M4AUW7_BCL2L10-01       cg-ggaacagacgggcaagaacccggtgccggactccgggaagcagcagg
A0A3B3TYN4_BCL2L10      cg-ggaacagacgggcaagaacccggggccggactctgggaagcagcagg
A0A096ME02_BCL2L10      cg-ggaacagacgggcaagaacccggggccggactccgggaagcagcagg
A0A3B3YT99_BCL2L10      cg-ggaacagacgggcaagaacccggggccggactccgggaagcagcagg
H2MBQ3_BCL2L10-01       ag-ggagcaaacagacatgaacccggggctggaccccggg------cggg
A0A3B3C5I4_BCL2L10      ag-ggagcaaacggacacgaacccggggctggacctcggg------cggg
I3J363_BCL2L10-01       ct-ggagcag---------aagccggggctggaccctgggcaacagcagg
A0A3B4ETX9_BCL2L10      ct-ggagcag---------aagccggggctggaccctggtcaacagcagg
A0A3B5KD08_BCL2L10      ca-ggagcagaagagcacaaagccggggctggaccctggacaagagcagc
A0A3B4ZFS0_BCL2L10      ca-ggagcagagggacacgaagccggggctggaacccgggaagcggcagg
A0A3B4TIY6_BCL2L10      ct-ggagcagaaccgtgtgaacccggggctggaccctggg----------
A0A3B4WGF4_BCL2L10      ct-ggagcagaaccgtgtgaacccggggctggaccctggg----------
Q9Z0F3_BCL2L10-01       ta-ca---tggctgtcaagcagaagagg----------------------
Q99M66_BCL2L10-01       -a-ca---ggactgttaagcggaggagg----------------------
G1QEX2_BCL2L10-01       ccagg---ccactcgcaggca-----------------------------
F1RZB9_BCL2L10-01       cg-gg---aggcctgtgggcggaagaagaag-------------------
W5QIG4_BCL2L10-01       ca-ga---cgacccgacggc---agaagagagac----------------
E1B9B3_BCL2L10-01       ca-ga---cgacccgacggcaggagaagagagac----------------
F1MV39_BCL2L10-01       ca-ga---ctacccgacggc---agaagagagac----------------
H0WZ06_BCL2L10-01       cc-ag---tagaagccaggcgggagaagcagga---------caagtcgc
G1T264_BCL2L10-01       cc-gg---tgaccacccagcgggtgaggaggaa-----------------
A0A2K6F2Q2_BCL2L10      cc-gg---tgaccgcctggtggaagaagtggggcct------ccagccgc
A0A2K6TIT7_BCL2L10      ct-gg---tgaccgcccggtggaagaagtggggctt------ccagtcgc
A0A2K5F974_BCL2L10      ct-gg---tgaccgcccggtggaagaagtggggctt------ccagtcgc
F7CT87_BCL2L10-01       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagtctc
A0A0D9RG38_BCL2L10      ct-ga---tgacagcctggtggaagaagcagagctt------ccagccgc
A0A2K5TKG9_BCL2L10      ct-gg---tgacagcctggtggaagaagcggggctt------ccagccgc
F7H6U5_BCL2L10-01       ct-gg---tgacagcctggtggaagaagcggggctt------ccagccgc
A0A2K6B2D9_BCL2L10      ct-gg---tgacagcctggtggaagaagcggggctt------ccagccgc
A0A2K5MMZ4_BCL2L10      ct-gg---tgacagcctggtggaagaagcggggctt------ccagccgc
A0A096NM44_BCL2L10      ct-gg---tgacagcctggtggaagaagcggagctt------ccagccgc
A0A2K5K3B0_BCL2L10      ct-gg---tgacagcctggtggaagaagcggagctt------ccagccgc
A0A2K6M5H5_BCL2L10      ct-gg---tgacagcctggtggaagaagcggagctt------ccagccgc
A0A2K6R5T5_BCL2L10      ct-gg---tgacagcctggtggaagaagcggagctt------ccagccgc
G1R3W6_BCL2L10-01       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagccgc
H2NN92_BCL2L10-01       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagccgc
Q9HD36_BCL2L10-01       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagccgc
Q9HD36_BCL2L10-02       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagccgc
G3QLU6_BCL2L10-01       ct-gg---tgaccgcccggtggaagaagtggggctt------ccagccgc
A0A2R9BCD9_BCL2L10      ct-gg---tgaccacccggtggaagaagtggggctt------ccagccgc
H2Q9G4_BCL2L10-01       ct-gg---tgaccacccggtggaagaagtggggctt------ccagccgc
F6ZPD4_BCL2L10-01       cg-gg---gaacctaccgaaagccgaagcggggcta------caagctgg
A0A337RYG8_BCL2L10      cc-gg---ggacctacttgaacctgacgccggacca------gcaacagg
G1LKR4_BCL2L10-01       tc-gg---ggacctactcgaacctggggccggacca------ggaactgg
M3Y8D1_BCL2L10-01       tc-gg---gggcctgctcgaacttggggccggacccggaactggaactgg
                                                                          

F6VJQ0_BCL2L10-01       -------------------ca-gcttcggagggaaacgagccggcgtctg
D2IT42_BCL2L10-02       cactgggacaggttcccggcgggagctgcagggggctggcggagacgata
A0A3B4AAV4_BCL2L10      gtttgggacaggtgcc---ctcagactgcaggcggctggcacaaactata
A0A3B5MJ12_BCL2L10      aactgcaacaagagcc---cgtaagctgccgggcgctggcggagaccatt
M4AUW7_BCL2L10-01       aactgcaacaagagcc---cgtaagctgccgggcgctggcggagaccatt
A0A3B3TYN4_BCL2L10      aactgcaacaagagcc---cgtaagctgccgggcgctggcggagaccatt
A0A096ME02_BCL2L10      aactgcaacaagagcc---cgtaagctgccgggcgctggcggagaccatt
A0A3B3YT99_BCL2L10      aactgcaacaagagcc---cgtaagctgccgggcgctggcggagaccatt
H2MBQ3_BCL2L10-01       aagtggcgcccgggcc---tgtgagctgccaggcgctggcagaaactgta
A0A3B3C5I4_BCL2L10      aagcggcacccggacc---tgtgagctgccaggcgctggcagaaactgta
I3J363_BCL2L10-01       aactgggacaggagcc---catgagctgcagaaggctggcagagaccata
A0A3B4ETX9_BCL2L10      aactgggacaggagcc---catgagctgcagaaggctggcagagaccata
A0A3B5KD08_BCL2L10      aactgggacaggtgcc---cgaaaactgcaggggactcgcggagaccata
A0A3B4ZFS0_BCL2L10      aactgggacaggggcc---cgtaaactgcaggggactggcagagaccata
A0A3B4TIY6_BCL2L10      --cagggacaggggct---cggaaactgcaggggactggcagagaccata
A0A3B4WGF4_BCL2L10      --cagggacaggggct---cagaaactgcaggggactggcagagaccata
Q9Z0F3_BCL2L10-01       gatctggggaatcg--tgtca-tagtgacccgagactgctg--tctcata
Q99M66_BCL2L10-01       gatcaaagaaaccg--tctcc-tactggagcgagactgcta--tctcata
G1QEX2_BCL2L10-01       --cgcagggaatgggatgcca-ccgttgaccaggactgcca--gcgcctg
F1RZB9_BCL2L10-01       --------------gagggca-acgttagcagggactgccg--actcctg
W5QIG4_BCL2L10-01       --------------gacggca-gcgttagcagggactgtcg--gctcctc
E1B9B3_BCL2L10-01       --------------gacgacg-gcgttagcagggactgtcg--gctcctg
F1MV39_BCL2L10-01       --------------gacgacg-gcgttagcagggactgtcg--gctcctg
H0WZ06_BCL2L10-01       aactgaaggagggagaagacg-aagtcgccagggattgcca--gcgccta
G1T264_BCL2L10-01       -------------------tg-aaatcgcccgggactgcca--gcgcttg
A0A2K6F2Q2_BCL2L10      agccgaaggagggggatcccg-aagtcgcccgggaccgcca--gcgcctg
A0A2K6TIT7_BCL2L10      ggttgaaggagccggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K5F974_BCL2L10      ggctgaaggagccggagggcg-acgtcgcccgggactgcca--gcgcctg
F7CT87_BCL2L10-01       ggctgaaggagccggaaggcg-acgtcgcccgggactgcca--gcgcctg
A0A0D9RG38_BCL2L10      ggct---ggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K5TKG9_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
F7H6U5_BCL2L10-01       ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K6B2D9_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K5MMZ4_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A096NM44_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K5K3B0_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K6M5H5_BCL2L10      ggctgaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2K6R5T5_BCL2L10      ggctgaaggagcaggagggcg-aggtcgcccgggactgcca--gcgcctg
G1R3W6_BCL2L10-01       ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
H2NN92_BCL2L10-01       ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
Q9HD36_BCL2L10-01       ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
Q9HD36_BCL2L10-02       ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
G3QLU6_BCL2L10-01       ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
A0A2R9BCD9_BCL2L10      ggctaaaggagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
H2Q9G4_BCL2L10-01       ggctaaatgagcaggagggcg-acgtcgcccgggactgcca--gcgcctg
F6ZPD4_BCL2L10-01       agctgagggagtggaaggccg-gcgtggaccgggactggctgcgcgcctg
A0A337RYG8_BCL2L10      agct---ggagtgggagacca-acgttggccaggactgcca--gcacctg
G1LKR4_BCL2L10-01       agctgggggagtgggaggccg-gcgtccgccaggactgccg--gcacctg
M3Y8D1_BCL2L10-01       agctgggggagtgggaggcca-gcgttcgccaagactgccg--gcgcctg
                                                                        * 

F6VJQ0_BCL2L10-01       accgaaaaactctgcaactatctggtggag---aggaagggcgcgtggct
D2IT42_BCL2L10-02       gcggactacctagg------------ggag---gagaagagggactggct
A0A3B4AAV4_BCL2L10      gctgattacttggg------------ggaa---gagaagagggactggct
A0A3B5MJ12_BCL2L10      gctgattacctgga------------gaag---cacaaaaaggactggct
M4AUW7_BCL2L10-01       gctgattacctgga------------gaag---cacaaaaaggactggct
A0A3B3TYN4_BCL2L10      gctgattacctgga------------gaag---cacaaaaaagactggct
A0A096ME02_BCL2L10      gctgattacctgga------------gaag---cacaaaaaagactggct
A0A3B3YT99_BCL2L10      gctgattacctgga------------gaag---cacaaaaaagactggct
H2MBQ3_BCL2L10-01       gctgatttcctggg------------agga---gacaagaaagaatggat
A0A3B3C5I4_BCL2L10      gctgatttcctggg------------agga---gacaagaaagagtggat
I3J363_BCL2L10-01       gctgattacctggg------------agaa---gagaagaaagactggct
A0A3B4ETX9_BCL2L10      gctgattacctggg------------agaa---gagaagaaagactggct
A0A3B5KD08_BCL2L10      gcagactatctagg------------agag---gagaagaaagactggct
A0A3B4ZFS0_BCL2L10      gctgattacctggg------------agag---gagaagaaagactggct
A0A3B4TIY6_BCL2L10      gctgattacctggg------------agaa---gagaagaaagactggct
A0A3B4WGF4_BCL2L10      gctgattacctggg------------agaa---gagaagaaagactggct
Q9Z0F3_BCL2L10-01       gtgaactttctgtataatctgctcatggggcgtcggcaccgcgccaggct
Q99M66_BCL2L10-01       gtgagcttgctgtacaatcgactcacagga---cggcatcgctcctggct
G1QEX2_BCL2L10-01       gtcaccttcctgtgcagttggctcacggag---acgcaccgcacctggat
F1RZB9_BCL2L10-01       gtggctttgctgtgcgctcagctctcaggg---cagcatcgcacctggct
W5QIG4_BCL2L10-01       gtggcccttctctgcgctcagttctgcgaa---aggcaccgcgcctggct
E1B9B3_BCL2L10-01       gtggcccttctgtgtgctcagttctgcgaa---aggcaccgcgcctggct
F1MV39_BCL2L10-01       gtggcccttctgtgtgctcagttctgcgaa---aggcaccgcgcctggct
H0WZ06_BCL2L10-01       gtggccctactgagctctcggctggtgggg---cagcaccgcgtttggct
G1T264_BCL2L10-01       gtggccttgctgtgcgctcgcctcgcaggg---cagcaccgcgcctggct
A0A2K6F2Q2_BCL2L10      gtggccctgctgtgcgcccggctggcgggg---cagcaccgcgcctggct
A0A2K6TIT7_BCL2L10      gtgggcttgctgagctcgcggctcgtgggg---cagcaccgtgcctggct
A0A2K5F974_BCL2L10      gtggccttgctgagctcgcggctcgtgggg---cagcaccgtgcctggct
F7CT87_BCL2L10-01       gtggccttgctgagttcgcggctcgtgggg---cagcaccgtgcctggct
A0A0D9RG38_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A2K5TKG9_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
F7H6U5_BCL2L10-01       gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A2K6B2D9_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A2K5MMZ4_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A096NM44_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A2K5K3B0_BCL2L10      gtggccttgctgagctcgcggctcgcgggg---cagcaccgcgcctggct
A0A2K6M5H5_BCL2L10      gtggccttgctgagctcgcggctcacgggg---cagcaccgcgcctggct
A0A2K6R5T5_BCL2L10      gtggccttgctgagctcgcggctcacgggg---cagcaccgcgcctggct
G1R3W6_BCL2L10-01       gtggccttgctgagctcgcgcctcgtgggg---cagcaccgcgcctggct
H2NN92_BCL2L10-01       gtggccttgctgagctcgcggctcgtgggg---cagcaccgcgcctggct
Q9HD36_BCL2L10-01       gtggccttgctgagctcgcggctcatgggg---cagcaccgcgcctggct
Q9HD36_BCL2L10-02       gtggccttgctgagctcgcggctcatgggg---cagcaccgcgcctggct
G3QLU6_BCL2L10-01       gtggccttgctgagctcgcggctcatgggg---cagcaccgcgcctggct
A0A2R9BCD9_BCL2L10      gtggccttgctgagctcgcggctcgtgggg---cagcaccgcgcctggct
H2Q9G4_BCL2L10-01       gtggccttgctgagctcgcggctcgtgggg---cagcaccgcgcctggct
F6ZPD4_BCL2L10-01       gtggacttcctgtgcgcatggctcaagggg---cggcaccgcgcctggct
A0A337RYG8_BCL2L10      gtggctttgctctgcaatcggctcaccgga---cggcatcgcgcctggct
G1LKR4_BCL2L10-01       gtggacttcctctgcaatcggctcacggga---cagcatcgcgcctggct
M3Y8D1_BCL2L10-01       gtggacttcctctgcggtcggctcacaggg---cagcaccgcgcctggct
                                  *                          *        ** *

F6VJQ0_BCL2L10-01       gcatgagaacggaggctg--------------------------------
D2IT42_BCL2L10-02       gctggagaacgggggctg--------------------------------
A0A3B4AAV4_BCL2L10      gttggaaaacggtggctg--------------------------------
A0A3B5MJ12_BCL2L10      acaggaaaataatggatg--------------------------------
M4AUW7_BCL2L10-01       acaggaaaataatggatg--------------------------------
A0A3B3TYN4_BCL2L10      gcaggaaaataatggatg--------------------------------
A0A096ME02_BCL2L10      gcaggaaaataatggatg--------------------------------
A0A3B3YT99_BCL2L10      gcaggaaaataatggatg--------------------------------
H2MBQ3_BCL2L10-01       gctagaaaatgatggatg--------------------------------
A0A3B3C5I4_BCL2L10      gctagaaaatgatggatg--------------------------------
I3J363_BCL2L10-01       gttggataatgatggatg--------------------------------
A0A3B4ETX9_BCL2L10      gttggataatgatggatg--------------------------------
A0A3B5KD08_BCL2L10      gctggagaatggcggatg--------------------------------
A0A3B4ZFS0_BCL2L10      gttggagaacgatggatg--------------------------------
A0A3B4TIY6_BCL2L10      gctggagaacggtggatg--------------------------------
A0A3B4WGF4_BCL2L10      gctggagaacggtggatg--------------------------------
Q9Z0F3_BCL2L10-01       ggaggctctcggcggctg--------------------------------
Q99M66_BCL2L10-01       ggaggctcacggtggctg--------------------------------
G1QEX2_BCL2L10-01       ggaggcgcaaggtggctg--------------------------------
F1RZB9_BCL2L10-01       attggcgaacggcggctg--------------------------------
W5QIG4_BCL2L10-01       gatggcgaacggcggctg--------------------------------
E1B9B3_BCL2L10-01       gatgactaacggcggctgggtgagcgcgaaggacgcggggctggtgggca
F1MV39_BCL2L10-01       gatggctaacggcggctg--------------------------------
H0WZ06_BCL2L10-01       ggaggctcaaggcggctg--------------------------------
G1T264_BCL2L10-01       gcaggctcaaggcggctg--------------------------------
A0A2K6F2Q2_BCL2L10      gcaggctcaaggcggctg--------------------------------
A0A2K6TIT7_BCL2L10      ggaggctcagggcggctgggtgagcacgcggagg-----aggacgtgggg
A0A2K5F974_BCL2L10      ggaggctcagggcggctgggtgagcatgcggagg-----gggacacgggc
F7CT87_BCL2L10-01       ggaggctcagggcggctgggtgagca--aggagg-----gggacacgggg
A0A0D9RG38_BCL2L10      tcaggctcaaggcggctg--------------------------------
A0A2K5TKG9_BCL2L10      tcaggctcagggcggctg--------------------------------
F7H6U5_BCL2L10-01       tcaggctcagggcggctg--------------------------------
A0A2K6B2D9_BCL2L10      tcaggctcagggcggctg--------------------------------
A0A2K5MMZ4_BCL2L10      tcaggctcagggcggctg--------------------------------
A0A096NM44_BCL2L10      tcaggctcagggcggctgggtgagcacgcggcggacaccgggacgcgggg
A0A2K5K3B0_BCL2L10      tcaggctcagggcggttg--------------------------------
A0A2K6M5H5_BCL2L10      tcaggctcagggcggctg--------------------------------
A0A2K6R5T5_BCL2L10      tcaggctcagggcggctgggtgagcacgcggcggacaccgggacgcgggg
G1R3W6_BCL2L10-01       gcaggctcagggcggctgggtgagcacgcggcggacaccgggacacgggg
H2NN92_BCL2L10-01       gcaggctcagggcggctg--------------------------------
Q9HD36_BCL2L10-01       gcaggctcagggcggctg--------------------------------
Q9HD36_BCL2L10-02       gcaggctcagggcggctgggtgagcacgcggcggacaccgggacacgggg
G3QLU6_BCL2L10-01       gcaggctcagggcggctg--------------------------------
A0A2R9BCD9_BCL2L10      gcaggctcagggcggctg--------------------------------
H2Q9G4_BCL2L10-01       gcaggctcagggcggctg--------------------------------
F6ZPD4_BCL2L10-01       ggaggctcactat-------------------------------------
A0A337RYG8_BCL2L10      ggaggctcacgacggctg--------------------------------
G1LKR4_BCL2L10-01       ggaggcgcacgacggctg--------------------------------
M3Y8D1_BCL2L10-01       ggaggcgcacggcggctg--------------------------------
                                                                          

F6VJQ0_BCL2L10-01       -----------------------------------------gactgg---
D2IT42_BCL2L10-02       -----------------------------------------ggaagg---
A0A3B4AAV4_BCL2L10      -----------------------------------------ggtagg---
A0A3B5MJ12_BCL2L10      -----------------------------------------ggaagg---
M4AUW7_BCL2L10-01       -----------------------------------------ggaagg---
A0A3B3TYN4_BCL2L10      -----------------------------------------ggacgg---
A0A096ME02_BCL2L10      -----------------------------------------ggacgg---
A0A3B3YT99_BCL2L10      -----------------------------------------ggacgg---
H2MBQ3_BCL2L10-01       -----------------------------------------ggaagg---
A0A3B3C5I4_BCL2L10      -----------------------------------------ggaagg---
I3J363_BCL2L10-01       -----------------------------------------ggaagg---
A0A3B4ETX9_BCL2L10      -----------------------------------------ggaagg---
A0A3B5KD08_BCL2L10      -----------------------------------------ggaggg---
A0A3B4ZFS0_BCL2L10      -----------------------------------------ggaagg---
A0A3B4TIY6_BCL2L10      -----------------------------------------ggaggg---
A0A3B4WGF4_BCL2L10      -----------------------------------------ggaggg---
Q9Z0F3_BCL2L10-01       -----------------------------------------ggatgg---
Q99M66_BCL2L10-01       -----------------------------------------ggatgg---
G1QEX2_BCL2L10-01       -----------------------------------------ggatgg---
F1RZB9_BCL2L10-01       -----------------------------------------ggatgg---
W5QIG4_BCL2L10-01       -----------------------------------------ggatgg---
E1B9B3_BCL2L10-01       gcctgggacgcgcccacgctgcc------------------ggatgg---
F1MV39_BCL2L10-01       -----------------------------------------ggatgg---
H0WZ06_BCL2L10-01       -----------------------------------------ggatgg---
G1T264_BCL2L10-01       -----------------------------------------ggatgg---
A0A2K6F2Q2_BCL2L10      -----------------------------------------ggatgg---
A0A2K6TIT7_BCL2L10      cg---ggatgggcacctgggaagggcccgccag--------gtggggtat
A0A2K5F974_BCL2L10      ctcccgagtag----ctgggaa-------tata--------ggatgg---
F7CT87_BCL2L10-01       cg---ggataggcacctgggaaccgcccgccca--------cgatgg---
A0A0D9RG38_BCL2L10      -----------------------------------------ggatgg---
A0A2K5TKG9_BCL2L10      -----------------------------------------ggatgg---
F7H6U5_BCL2L10-01       -----------------------------------------ggatgg---
A0A2K6B2D9_BCL2L10      -----------------------------------------ggatgg---
A0A2K5MMZ4_BCL2L10      -----------------------------------------ggatgg---
A0A096NM44_BCL2L10      cg---ggacgggcatccgggaagcgcccacgaggccggcacggatgg---
A0A2K5K3B0_BCL2L10      -----------------------------------------ggatgg---
A0A2K6M5H5_BCL2L10      -----------------------------------------ggatgg---
A0A2K6R5T5_BCL2L10      cg---ggacgggcatccgggaagcgcccacgaggccggcacggatgg---
G1R3W6_BCL2L10-01       cg---ggacgggcagccgggaagcgcccacgaggccggcacggatgg---
H2NN92_BCL2L10-01       -----------------------------------------ggatgg---
Q9HD36_BCL2L10-01       -----------------------------------------ggatgg---
Q9HD36_BCL2L10-02       cg---ggacgggcagccgggaagcgcccacgaggctggcacggatgg---
G3QLU6_BCL2L10-01       -----------------------------------------ggatgg---
A0A2R9BCD9_BCL2L10      -----------------------------------------ggatgg---
H2Q9G4_BCL2L10-01       -----------------------------------------ggatgg---
F6ZPD4_BCL2L10-01       -----------------------------------------ggatgg---
A0A337RYG8_BCL2L10      -----------------------------------------ggatgg---
G1LKR4_BCL2L10-01       -----------------------------------------ggatgg---
M3Y8D1_BCL2L10-01       -----------------------------------------ggatgg---
                                                                     **   

F6VJQ0_BCL2L10-01       ----ctttcaccaccacttcgaaaaaaggcaatctcctccaccaagtgac
D2IT42_BCL2L10-02       ----gttttgtaagttctccaggatcgcccgagaggtgaaccaagagtct
A0A3B4AAV4_BCL2L10      ----cttctgtgagttctcctgtcatgccaggaaggtggaccaggactcg
A0A3B5MJ12_BCL2L10      ----gttttgtagctatgcccgcaacgccagagaagcaagtcaggactcc
M4AUW7_BCL2L10-01       ----gttttgtagctatgcccgcaacgccagagaagcaagtcaggactcc
A0A3B3TYN4_BCL2L10      ----gttttgtagctacgcccacaacgccagagaagtaagtcaggactcc
A0A096ME02_BCL2L10      ----gttttgtagctacgcccacaacgccagagaagtaagtcaggactcc
A0A3B3YT99_BCL2L10      ----gttttgtagctacgcccacaacgccagagaagtaagtcaggactcc
H2MBQ3_BCL2L10-01       ----cttctgtaagttctccagaacagccagagaggtgagtcaggactcg
A0A3B3C5I4_BCL2L10      ----cttctgtaagttctccagaacagccagagaggtgagccaggactcg
I3J363_BCL2L10-01       ----cttctgtaagttctcccgcagtgccagagaagtgagccaggactca
A0A3B4ETX9_BCL2L10      ----cttctgtaagttctcccgcagtgccagagaagtgagccaggactca
A0A3B5KD08_BCL2L10      ----gttctgtaagtactccctcgctgccagggaggtgaatcacgactcg
A0A3B4ZFS0_BCL2L10      ----cttcgttaagttctccctcagtgccagagaggtgagtcaggacttg
A0A3B4TIY6_BCL2L10      ----gttctgtaaattctcccacagtgccagagaggtgagccaggacttg
A0A3B4WGF4_BCL2L10      ----gttctgtaagttctcccacagtgccagagaggtgagccaggacttg
Q9Z0F3_BCL2L10-01       ----cttttgccgcttcttcaagaatcct-------ttaccgctcggctt
Q99M66_BCL2L10-01       ----cttttgccaattcttcaagaacccc-------ttaccacccggctt
G1QEX2_BCL2L10-01       ----cttttgtcacaacttcatgcctgca-------ccgccgc------c
F1RZB9_BCL2L10-01       ----attttgtctcttcttccaaggttca-------ttgcaacaaac---
W5QIG4_BCL2L10-01       ----attttgtctctccttcag---ccac-------tcattgcaaccatc
E1B9B3_BCL2L10-01       ----attttgtctcttcttcag---ccac-------tcattccagccatc
F1MV39_BCL2L10-01       ----attttgtctctttttcag---ccag-------tcattccagccatc
H0WZ06_BCL2L10-01       ----cttttgtcagttcttcaggacaccc-------ttaccgctagcttt
G1T264_BCL2L10-01       ----cttttgtgtcttctaccggactccc-------ttaccgctgacctt
A0A2K6F2Q2_BCL2L10      ----cttttgtgacttattcaggaaaccc-------ttgccgctagctgt
A0A2K6TIT7_BCL2L10      ttttctcctgtgcctattaaatgacctcc-------tactcgctggc---
A0A2K5F974_BCL2L10      ----cttttgttacttcttcaggacctcc-------tcctcgctggcatt
F7CT87_BCL2L10-01       ----cttttgttacttcttcaggacctcc-------tccttgctggcatt
A0A0D9RG38_BCL2L10      ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
A0A2K5TKG9_BCL2L10      ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
F7H6U5_BCL2L10-01       ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
A0A2K6B2D9_BCL2L10      ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
A0A2K5MMZ4_BCL2L10      ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
A0A096NM44_BCL2L10      ----cttttgtcacttcttcaggagcccc-------tttccgctggcttt
A0A2K5K3B0_BCL2L10      ----cttctgtcacttcttcaggaccccc-------tttccgctggcttt
A0A2K6M5H5_BCL2L10      ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
A0A2K6R5T5_BCL2L10      ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
G1R3W6_BCL2L10-01       ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
H2NN92_BCL2L10-01       ----cttttgtcacttcttcaggaccccc-------cttccgctggcttt
Q9HD36_BCL2L10-01       ----cttttgtcacttcttcaggaccccc-------tttccactggcttt
Q9HD36_BCL2L10-02       ----cttttgtcacttcttcaggaccccc-------tttccactggcttt
G3QLU6_BCL2L10-01       ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
A0A2R9BCD9_BCL2L10      ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
H2Q9G4_BCL2L10-01       ----cttttgtcacttcttcaggaccccc-------tttccgctggcttt
F6ZPD4_BCL2L10-01       ----cttttgtgacttct------cactc-------acactgccagcttc
A0A337RYG8_BCL2L10      ----cttttgtctcttcttc---tcaccc-------atgctgccatcttc
G1LKR4_BCL2L10-01       ----cttttgtctcttcttc---acaccc-------atgctgccgtcgtc
M3Y8D1_BCL2L10-01       ----cttttgtctcttcttc---acaccc-------gcgctgc---tgtc
                             *                                            

F6VJQ0_BCL2L10-01       tcaagtaataataca--------ctgtgctgcataatggcagcagcagca
D2IT42_BCL2L10-02       tcgatgaagacggcg---ctgttcgcggccgc----------------cg
A0A3B4AAV4_BCL2L10      tcgatgaagaccgct---ctgtttgctgctgc----------------tg
A0A3B5MJ12_BCL2L10      tccatgaagacggcg---ctggttgctgtcgc----------------cg
M4AUW7_BCL2L10-01       tccatgaagacggcg---ctggttgctgtcgc----------------cg
A0A3B3TYN4_BCL2L10      tccatgaagacggcg---ctggttgctgtcgc----------------cg
A0A096ME02_BCL2L10      tccatgaagacggcg---ctggttgctgtcgc----------------cg
A0A3B3YT99_BCL2L10      tccatgaagacggcg---ctggttgctgtcgc----------------cg
H2MBQ3_BCL2L10-01       tccatgaagactgcg---ctcttcgcggcggc----------------ca
A0A3B3C5I4_BCL2L10      tccatgaagacggcg---ctctttgcagcggc----------------ca
I3J363_BCL2L10-01       tccatgaagaaagcg---ctgtttgctgccgc----------------cg
A0A3B4ETX9_BCL2L10      tccatgaagaaagcg---ctgtttgctgccgc----------------cg
A0A3B5KD08_BCL2L10      tccatgaagaccgca---ctgttcgccgctgc----------------cg
A0A3B4ZFS0_BCL2L10      tccatgaagacagcg---ctgtttgctgctgc----------------tg
A0A3B4TIY6_BCL2L10      tcgatgaagacagca---ctgtttgctgctgc----------------tg
A0A3B4WGF4_BCL2L10      tcgatgaagacagca---ctatttgctgctgc----------------tg
Q9Z0F3_BCL2L10-01       ctggagaagattgctgattcaggcttttctgt----------------ca
Q99M66_BCL2L10-01       ctggagaagattgctgatccgggctattctgt----------------cc
G1QEX2_BCL2L10-01       tggggacagactgctggctccgcttctgaggg----------------ca
F1RZB9_BCL2L10-01       ttggacaagacacatggtctgggtttttgtgt----------------ca
W5QIG4_BCL2L10-01       ttgggaaagacagctggtctggtttttcctct----------------ca
E1B9B3_BCL2L10-01       ttgggaaagacagctggtctggtttttcctct----------------ca
F1MV39_BCL2L10-01       ttgggaaagacagctggtctggtttttcctcg----------------ca
H0WZ06_BCL2L10-01       ttggagaagattgctgttcgaagttttactgt----------------tg
G1T264_BCL2L10-01       ctggagaagactgctggtccgcacttttctgt----------------cc
A0A2K6F2Q2_BCL2L10      ttggaggagactgctggtccaggttcttttgt----------------ca
A0A2K6TIT7_BCL2L10      atggagaaaactgctggtcccggttttcctgt----------------ca
A0A2K5F974_BCL2L10      atggagaaaactgctggtccaggttttcctgt----------------ca
F7CT87_BCL2L10-01       atggagaaaagtgctggtccaggttttcctgt----------------ca
A0A0D9RG38_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K5TKG9_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
F7H6U5_BCL2L10-01       ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K6B2D9_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K5MMZ4_BCL2L10      ttggagaacactgctgatccaggctttcctgg----------------ca
A0A096NM44_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K5K3B0_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K6M5H5_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
A0A2K6R5T5_BCL2L10      ttggagaaaactgctgatccaggctttcctgg----------------ca
G1R3W6_BCL2L10-01       ttggagaaaacagctggtccaggcttttctgt----------------ca
H2NN92_BCL2L10-01       ttggagaaaacagctggtccaggcttttctgt----------------ca
Q9HD36_BCL2L10-01       ttggagaaaacagctggtccaggcttttctgt----------------ca
Q9HD36_BCL2L10-02       ttggagaaaacagctggtccaggcttttctgt----------------ca
G3QLU6_BCL2L10-01       ttggagaaaacagctggtccaggcttttctgt----------------ca
A0A2R9BCD9_BCL2L10      ttggagaaaacagctggtccaggcttttctgt----------------ca
H2Q9G4_BCL2L10-01       ttggagaaaacagctggtccaggcttttctgt----------------ca
F6ZPD4_BCL2L10-01       tcagaggatactgctggtccggtttcttctgt----------------ca
A0A337RYG8_BCL2L10      ttggagaagactgctggtccaggctcttctgt----------------ca
G1LKR4_BCL2L10-01       ttggaaaagactgctggcccaggctcttctgt----------------cc
M3Y8D1_BCL2L10-01       ttggaaaagactgctggtccaggctcttctgt----------------ca
                               * *                                        

F6VJQ0_BCL2L10-01       ggatttggactagtgggattagctcttttattag-----tcgtacga-ta
D2IT42_BCL2L10-02       gggtgggcatcgcaggcctgacgttccttttggt-----gcgctag----
A0A3B4AAV4_BCL2L10      gggtgggtttagctgggcttacctttctcttggt-----gcgctag----
A0A3B5MJ12_BCL2L10      gggtcggcatcgctggactcaccttcctcctggt-----gcgctag----
M4AUW7_BCL2L10-01       gggtcggcatcgctggactcaccttcctcctggt-----gcgctag----
A0A3B3TYN4_BCL2L10      gagtcggcatcgcagggctcaccttccttctggt-----gcgctag----
A0A096ME02_BCL2L10      gagtcggcatcgcagggctcaccttccttctggt-----gcgctag----
A0A3B3YT99_BCL2L10      gagtcggcatcgcagggctcaccttccttctggt-----gcgctag----
H2MBQ3_BCL2L10-01       gcgtgggcctggctggactcaccttcctcctggt-----gcgctag----
A0A3B3C5I4_BCL2L10      gcgtgggcctggccggactcaccttcctcctggt-----gcgctag----
I3J363_BCL2L10-01       gtgtcggccttgctgggcttaccttcctcttggtcaaaggcttcagattt
A0A3B4ETX9_BCL2L10      gtgtcggccttgctgggcttaccttcctcttggt-----gcgctag----
A0A3B5KD08_BCL2L10      gggtcggtctcgccgggctcacgttcctcctggt-----gcgctag----
A0A3B4ZFS0_BCL2L10      gtgtcggcctcgctggactcaccttcctcctggt-----gcgctag----
A0A3B4TIY6_BCL2L10      gtgtgggcctcgctggactcacctttctcctggt-----gcgctag----
A0A3B4WGF4_BCL2L10      gtgtgggcctcgctggactcacctttctcctggt-----gcgctag----
Q9Z0F3_BCL2L10-01       ggcttctttgcaacagccatcttttttatctgga--------aacgt-tt
Q99M66_BCL2L10-01       tgtttctttgcaacggccatcttttatatctgga--------aatgt-tt
G1QEX2_BCL2L10-01       tgccttgtactcataatcttaatctgcttgtgga--------taaaaatc
F1RZB9_BCL2L10-01       tactgtacagcagtggtcttactctacttgtgga--------gaaaa-tt
W5QIG4_BCL2L10-01       tactggacagcaataatcataatctacttctgga--------taaaa-tt
E1B9B3_BCL2L10-01       tactggacagcaataatcataatctacttctgga--------taaaa-tt
F1MV39_BCL2L10-01       tactggacagcaataatcataatctacttctgga--------taaaa-tt
H0WZ06_BCL2L10-01       tgctttttagcaacggtcttcatctatttctgga--------cacgactt
G1T264_BCL2L10-01       tgctttgtagctacagccttactcttcgcctgga--------cgcgc-gt
A0A2K6F2Q2_BCL2L10      tgctttttagcaacgaccgtcatctatttctgga--------cacga-tt
A0A2K6TIT7_BCL2L10      tggttgttaacagcagcattcatctacttctgga--------cacga-ta
A0A2K5F974_BCL2L10      tggttgttaacagcagcattcatctacttctgga--------cacga-ta
F7CT87_BCL2L10-01       tggttgttaacagcagtattcatctacttctgga--------cacga-ta
A0A0D9RG38_BCL2L10      tgcttgttagcaacagccttcggttatctctgga--------caaga-tt
A0A2K5TKG9_BCL2L10      tgcttgttagcaacagccttcggttatctctgga--------cacga-tt
F7H6U5_BCL2L10-01       tgcttgttagcaacagccttcggttatctctgga--------cacga-tt
A0A2K6B2D9_BCL2L10      tgcttgttagcaacagccttcggttatctctgga--------cacga-tt
A0A2K5MMZ4_BCL2L10      tgcttgttagcaacagccttcggttatctctgga--------cacga-tt
A0A096NM44_BCL2L10      tgcttgttagcaacagccttcggttatctctgga--------cacga-tt
A0A2K5K3B0_BCL2L10      tgcttgttaacaacagccttcggttatctctgga--------cacga-tt
A0A2K6M5H5_BCL2L10      tgcttgttaacaacagccttcggttacctctgga--------cacga-tt
A0A2K6R5T5_BCL2L10      tgcttgttaacaacagccttcggttacctctgga--------cacga-tt
G1R3W6_BCL2L10-01       tgcttgttaacaacagccttcatttatttctgga--------cacga-tt
H2NN92_BCL2L10-01       tgcttgttaacaacagccttcatttatctctgga--------cacga-tt
Q9HD36_BCL2L10-01       tgcttgttaacaacagccttcatttatctctgga--------cacga-tt
Q9HD36_BCL2L10-02       tgcttgttaacaacagccttcatttatctctgga--------cacga-tt
G3QLU6_BCL2L10-01       tgcttgttagcaacagccttcatttatctctgga--------cacga-tt
A0A2R9BCD9_BCL2L10      tgcttgttaacaacagccttcatttatctctgga--------cacga-tt
H2Q9G4_BCL2L10-01       tgcttgttaacaacagccttcatttatctctgga--------cacga-tt
F6ZPD4_BCL2L10-01       tgcttttcagcatcagtcttaatctacctctgga--------caaaa-tt
A0A337RYG8_BCL2L10      tgctttacagtaatgatcttaatctacttctgga--------gaaga-tt
G1LKR4_BCL2L10-01       tgcttcacagcggtgatcttaatctacttctgga--------aaagg-tt
M3Y8D1_BCL2L10-01       tgctttacggcagtgatcttaatctacttctgga--------aaaga-tt
                                                      *                   

F6VJQ0_BCL2L10-01       a-------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       tga-----------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       ata---------a-------------------------------------
Q99M66_BCL2L10-01       ata---------a-------------------------------------
G1QEX2_BCL2L10-01       atg-----------------------------------------------
F1RZB9_BCL2L10-01       att---------gtga----------------------------------
W5QIG4_BCL2L10-01       atc---------gtga----------------------------------
E1B9B3_BCL2L10-01       atc---------gtgagttctaaaattcttatttctacctgcctaactct
F1MV39_BCL2L10-01       att---------gtga----------------------------------
H0WZ06_BCL2L10-01       act-----------------------------------------------
G1T264_BCL2L10-01       gta---------t-------------------------------------
A0A2K6F2Q2_BCL2L10      att---------atga----------------------------------
A0A2K6TIT7_BCL2L10      att---------aggagttttaaaatttttagcccacttctgcctgccca
A0A2K5F974_BCL2L10      att---------aggagtttttaa--------------------------
F7CT87_BCL2L10-01       atg---------aggagttttaaaagttttagcccacttctacctgccca
A0A0D9RG38_BCL2L10      att---------atga----------------------------------
A0A2K5TKG9_BCL2L10      att---------atga----------------------------------
F7H6U5_BCL2L10-01       att---------atga----------------------------------
A0A2K6B2D9_BCL2L10      att---------atga----------------------------------
A0A2K5MMZ4_BCL2L10      att---------atga----------------------------------
A0A096NM44_BCL2L10      att---------atgagttttaacatttttaacccacttctacctgccca
A0A2K5K3B0_BCL2L10      att---------atga----------------------------------
A0A2K6M5H5_BCL2L10      att---------atga----------------------------------
A0A2K6R5T5_BCL2L10      att---------atgagttttaaaatttttaacccacttctacctgccca
G1R3W6_BCL2L10-01       att---------atgagttttaaaacttttaacccgcttctacctgcaca
H2NN92_BCL2L10-01       att---------atga----------------------------------
Q9HD36_BCL2L10-01       att---------atga----------------------------------
Q9HD36_BCL2L10-02       att---------atgagttttaaaacttttaacccgcttctacctgccca
G3QLU6_BCL2L10-01       att---------atga----------------------------------
A0A2R9BCD9_BCL2L10      att---------atga----------------------------------
H2Q9G4_BCL2L10-01       att---------atga----------------------------------
F6ZPD4_BCL2L10-01       atc---------atga----------------------------------
A0A337RYG8_BCL2L10      att---------gtga----------------------------------
G1LKR4_BCL2L10-01       att---------gtga----------------------------------
M3Y8D1_BCL2L10-01       accatttattgggtga----------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
A0A3B3YT99_BCL2L10      --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------------------------
A0A3B5KD08_BCL2L10      --------------------------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       gagcaaccaagcaaaattgaaatgtgaaagaccaaatcagagtaaaccac
F1MV39_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      actgtga-------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       actgtga-------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      actgtga-------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      actgtga-------------------------------------------
G1R3W6_BCL2L10-01       gctgtga-------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       actgtga-------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------
D2IT42_BCL2L10-02       --------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------
A0A3B5MJ12_BCL2L10      --------------------------------
M4AUW7_BCL2L10-01       --------------------------------
A0A3B3TYN4_BCL2L10      --------------------------------
A0A096ME02_BCL2L10      --------------------------------
A0A3B3YT99_BCL2L10      --------------------------------
H2MBQ3_BCL2L10-01       --------------------------------
A0A3B3C5I4_BCL2L10      --------------------------------
I3J363_BCL2L10-01       --------------------------------
A0A3B4ETX9_BCL2L10      --------------------------------
A0A3B5KD08_BCL2L10      --------------------------------
A0A3B4ZFS0_BCL2L10      --------------------------------
A0A3B4TIY6_BCL2L10      --------------------------------
A0A3B4WGF4_BCL2L10      --------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------
Q99M66_BCL2L10-01       --------------------------------
G1QEX2_BCL2L10-01       --------------------------------
F1RZB9_BCL2L10-01       --------------------------------
W5QIG4_BCL2L10-01       --------------------------------
E1B9B3_BCL2L10-01       cttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01       --------------------------------
H0WZ06_BCL2L10-01       --------------------------------
G1T264_BCL2L10-01       --------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------
A0A2K5F974_BCL2L10      --------------------------------
F7CT87_BCL2L10-01       --------------------------------
A0A0D9RG38_BCL2L10      --------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------
F7H6U5_BCL2L10-01       --------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------
A0A096NM44_BCL2L10      --------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------
G1R3W6_BCL2L10-01       --------------------------------
H2NN92_BCL2L10-01       --------------------------------
Q9HD36_BCL2L10-01       --------------------------------
Q9HD36_BCL2L10-02       --------------------------------
G3QLU6_BCL2L10-01       --------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------
H2Q9G4_BCL2L10-01       --------------------------------
F6ZPD4_BCL2L10-01       --------------------------------
A0A337RYG8_BCL2L10      --------------------------------
G1LKR4_BCL2L10-01       --------------------------------
M3Y8D1_BCL2L10-01       --------------------------------
                                                        

© 1998-2019