Dataset for CDS BCL2L10 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

40 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       atgggtgtggcggcccctccctgggcggaggcgcagcgggacctagaaaa
                                                                          

F6VJQ0_BCL2L10-01       -------------------------------------atgga--------
D2IT42_BCL2L10-02       -------------------------------------atgtc--------
A0A096ME02_BCL2L10      -------------------------------------atgca--------
M4AUW7_BCL2L10-01       --------------------------------------------------
I3J363_BCL2L10-01       -------------------------------------atgtcgagaggcg
H2MBQ3_BCL2L10-01       -------------------------------------atgtc--------
A0A1U7QVA0_BCL2L10      -------------------------------------atggc--------
Q9Z0F3_BCL2L10-01       -------------------------------------atggc--------
Q99M66_BCL2L10-01       -------------------------------------atgg---------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       ----------ggtcggccccccggtagaggcggagccatggt--------
E1B9B3_BCL2L10-01       -------------------------------ggagccatggt--------
F1MV39_BCL2L10-01       -------------------------------ggagccatggt--------
F1RZB9_BCL2L10-01       -------------------------------------atggc--------
H0WZ06_BCL2L10-01       -------------------------------------atggc--------
G1T264_BCL2L10-01       -------aggccccagcggaggctggcc---------atggc--------
A0A2K6F2Q2_BCL2L10      -------------------------------------atggg--------
A0A2K6TIT7_BCL2L10      -------------------------------------atggc--------
A0A2K5F974_BCL2L10      -------------------------------------atggc--------
F7CT87_BCL2L10-01       -------------------------------------atggc--------
A0A0D9RG38_BCL2L10      -------------------------------------atggc--------
A0A2K5TKG9_BCL2L10      -------------------------------------atggc--------
F7H6U5_BCL2L10-01       -------------------------------------atggc--------
A0A2K6B2D9_BCL2L10      -------------------------------------atggc--------
A0A2K5MMZ4_BCL2L10      -------------------------------------atggc--------
A0A096NM44_BCL2L10      -------------------------------------atggc--------
A0A2K5K3B0_BCL2L10      -------atggctgaccagttgcgggagcgcaccaacgtggc--------
A0A2K6M5H5_BCL2L10      -------atggctgacccgttgcgggagcgcaccaccgtggc--------
A0A2K6R5T5_BCL2L10      -------------------------------------atggc--------
G1R3W6_BCL2L10-01       -------atggttgaccagt------------------------------
H2NN92_BCL2L10-01       -------atggttgaccagttgcgggagcgcactatcacggc--------
Q9HD36_BCL2L10-01       -------atggttgaccagttgcgggagcgcaccaccatggc--------
Q9HD36_BCL2L10-02       -------atggttgaccagttgcgggagcgcaccaccatggc--------
G3QLU6_BCL2L10-01       -------atggttgaccagtggcgggagcgcaccaccatggc--------
A0A2R9BCD9_BCL2L10      -------atggttgaccagtggcgtgagcgcactaccatggc--------
H2Q9G4_BCL2L10-01       -------atggttgaccagtggcgtgagcgcaccaccatggc--------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      -------------------------------------atggc--------
G1LKR4_BCL2L10-01       -------------------------------------atggc--------
M3Y8D1_BCL2L10-01       ccgggtcgggtcgggcagcgcggggagaggtcgggccatggc--------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A096ME02_BCL2L10      -------------------------------------------ccgaggt
M4AUW7_BCL2L10-01       --------------------------------------------------
I3J363_BCL2L10-01       gagtcacacattctctatcagctgaagggaagactcaactgtaccgacgc
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A096ME02_BCL2L10      tctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggag
M4AUW7_BCL2L10-01       --------------------------------------------------
I3J363_BCL2L10-01       tctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggag
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       ---------------ttacaagtgtgctcttagggaagagacggcgcggc
D2IT42_BCL2L10-02       ------------g---------tgtaggctgtggaaagagaccctggccc
A0A096ME02_BCL2L10      gaaaatg---tcc---------tgtgggctgtggaaagagaccgtggctg
M4AUW7_BCL2L10-01       ----atg---tcc---------tgtgggctgtggaaagagaccgtggttg
I3J363_BCL2L10-01       gaaaatgaaattc---------tgtgggctgtggaaagagaccctgcttt
H2MBQ3_BCL2L10-01       ------------t---------tgtgggctgaggaaagagaccctagctg
A0A1U7QVA0_BCL2L10      ------------c---------gacccgctgcgggtccgcactagactgc
Q9Z0F3_BCL2L10-01       ------------cgactcgcaggacccactgcatgaacgcactagacggc
Q99M66_BCL2L10-01       --------------------gtgacccgctgcaggatcgcactagacggc
G1QEX2_BCL2L10-01       ----------------------gacgagttgaagttgcgcacccgacggc
W5QIG4_BCL2L10-01       ------------g---------gacccgtttagggagcgcacggcccggc
E1B9B3_BCL2L10-01       ------------g---------gacccgtttagggagcgcaccgcccggc
F1MV39_BCL2L10-01       ------------g---------gacccgtttagggagcgcaccgcccggc
F1RZB9_BCL2L10-01       ------------g---------gacgcgttcagggagcgcacagcccggc
H0WZ06_BCL2L10-01       ------------a---------gacccgttgagggagcgcaccgagcggc
G1T264_BCL2L10-01       ------------a---------gacgctttggaggagcgcactgcgcgcc
A0A2K6F2Q2_BCL2L10      ------------t---------gaccggttcagggagcgcaccgagcggc
A0A2K6TIT7_BCL2L10      ------------t---------gacccgctgcagcagcgcaccgagcagc
A0A2K5F974_BCL2L10      ------------t---------gacccgctgcggcagcgcaccgagcggc
F7CT87_BCL2L10-01       ------------t---------gacccgctgcggcagcgcaccgagcagc
A0A0D9RG38_BCL2L10      ------------t---------gacccgttgcgggagcgcaccgagcggc
A0A2K5TKG9_BCL2L10      ------------t---------gacccgttgcgggagcgcaccgagcggc
F7H6U5_BCL2L10-01       ------------t---------gacccgttgcgggagcgcaccgagcggc
A0A2K6B2D9_BCL2L10      ------------t---------gacccgttgcgggagcgcaccgagcggc
A0A2K5MMZ4_BCL2L10      ------------t---------gacccgttgcgggagcgcaccgagcggc
A0A096NM44_BCL2L10      ------------t---------gacccgttgcgggagcgcaccgagcggc
A0A2K5K3B0_BCL2L10      ------------t---------gacccgttgcgcgagcgcaccgagcggc
A0A2K6M5H5_BCL2L10      ------------t---------gacccgttgcgcgagcgcaccgagcggt
A0A2K6R5T5_BCL2L10      ------------t---------gacccgttgcgcgagcgcaccgagcggt
G1R3W6_BCL2L10-01       -----------------------------tgcgggagcgcaccgagcggc
H2NN92_BCL2L10-01       ------------c---------gacctgctgagggagcgcaccgagcggc
Q9HD36_BCL2L10-01       ------------c---------gacccgctgcgggagcgcaccgagctgt
Q9HD36_BCL2L10-02       ------------c---------gacccgctgcgggagcgcaccgagctgt
G3QLU6_BCL2L10-01       ------------c---------gacccgctgcgggagcgcaccgagcggt
A0A2R9BCD9_BCL2L10      ------------c---------gacccgctgcgggagcgcaccgagcggt
H2Q9G4_BCL2L10-01       ------------c---------gacccgctgcgggagcgcaccgagcggt
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      ------------t---------gacgcgttgagggagcgcacggcgcagc
G1LKR4_BCL2L10-01       ------------g---------gacgcgttgaggg---gcacggcgcggc
M3Y8D1_BCL2L10-01       ------------g---------gacgctttgagggagcgcacggcgcagc
                                                                          

F6VJQ0_BCL2L10-01       tggtaactgactacctggaatattgttgc-cggagggaag-gcgtccagg
D2IT42_BCL2L10-02       tgtcagaggactacctgttgtcctgcactgc--aagcacaggcacagccc
A0A096ME02_BCL2L10      ttgcagaggattacatcc--acctgcgctgctcaagcccacacccagccc
M4AUW7_BCL2L10-01       ttgcagaggattacatcc--gcctgcgctgctcaagcccacacccagccc
I3J363_BCL2L10-01       tggccgaggactacctgt--ccttttgctgcacgagtccacatcaagccc
H2MBQ3_BCL2L10-01       tggccctggattacctgt--ccctgagctgcaggagcccactccaggccc
A0A1U7QVA0_BCL2L10      tgctaactgactacttgacgttctgtgca-cgggagccgg-gtgaccccg
Q9Z0F3_BCL2L10-01       tgctgtctgactacatattcttctgcgca-cgggagccgg-acaccccag
Q99M66_BCL2L10-01       tgctgactgactacatattgttctgcgca-cgggcgccga-acacccctg
G1QEX2_BCL2L10-01       tgctgaccgagttcctggaacaccgcacc-cgaaggcgcg-gcactgccc
W5QIG4_BCL2L10-01       tgctgatggactggctggagttctgcgcc-cgggagcccg-gcactccag
E1B9B3_BCL2L10-01       tgctgatggactacctggagttctgcgcc-cgggagccgg-gcactccag
F1MV39_BCL2L10-01       tgctgatggactacctggagttctgcgcc-cgggagccgg-gcactccag
F1RZB9_BCL2L10-01       ttctgaccgactacctggagtactgcgcc-cgggagcccg-gcaccgccg
H0WZ06_BCL2L10-01       tgctgactgactacctggagtactgcgcg-cgggatccga-ctgccccgg
G1T264_BCL2L10-01       tgctcaccgactacctggagtgctgcgcc-cgcgagcccg-gcacccctg
A0A2K6F2Q2_BCL2L10      tgctggccgactacctggagtactgcaca-agggagccgg-gcgccccgg
A0A2K6TIT7_BCL2L10      tggtggcggactacctggagtactgctcc-cgggagcccg-gcacccccg
A0A2K5F974_BCL2L10      tggtggcggactacctggagtactgctcc-caggagcctg-gcacccccg
F7CT87_BCL2L10-01       tggtgacggactacctggagtactgctcc-cgggagcctg-gcacccccg
A0A0D9RG38_BCL2L10      tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
A0A2K5TKG9_BCL2L10      tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
F7H6U5_BCL2L10-01       tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
A0A2K6B2D9_BCL2L10      tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
A0A2K5MMZ4_BCL2L10      tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
A0A096NM44_BCL2L10      tcctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccctg
A0A2K5K3B0_BCL2L10      tgctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccccg
A0A2K6M5H5_BCL2L10      tgctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccccg
A0A2K6R5T5_BCL2L10      tgctggccgactatctggggtgctgcgcc-cgggaacccg-gcacccccg
G1R3W6_BCL2L10-01       tgctggccgactacctggggtgctgcgcc-cgggaacccg-gcacccccg
H2NN92_BCL2L10-01       tgctggccgactacctggggtgctgcgcc-cgggaacccg-gcaccccag
Q9HD36_BCL2L10-01       tgctggccgactacctggggtactgcgcc-cgggaacccg-gcacccccg
Q9HD36_BCL2L10-02       tgctggccgactacctggggtactgcgcc-cgggaacccg-gcacccccg
G3QLU6_BCL2L10-01       tgctggccgactacctggggtactgcgcc-cgggaacccg-gcacccccg
A0A2R9BCD9_BCL2L10      tgctggccgactacctggggtactgcgcc-cgggaacccg-gcacccccg
H2Q9G4_BCL2L10-01       tgctggccgactacctggggtactgcgcc-cgggaacccg-gcacccccg
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      tactgactgactacctggagtactgcgcc-cgggagcccg-gcagccccg
G1LKR4_BCL2L10-01       tgctgaccgactacctggagtactgcgcc-cgggagcccg-gcacccctg
M3Y8D1_BCL2L10-01       tgctgaccgactacctggagtactgcgcc-cgcggccccg-gcacccccg
                                                                          

F6VJQ0_BCL2L10-01       agctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagc
D2IT42_BCL2L10-02       cgccgcctcccagcgagtcagccgcggccatgaggggac---tggcccag
A0A096ME02_BCL2L10      ctccacctcccagcgagccggctgccgccatgaggcgcc---tggcccag
M4AUW7_BCL2L10-01       ctccacctcccagcgagccggccgccgccatgaggcgcc---tggcccag
I3J363_BCL2L10-01       ctccacctcccagcgaatcagccgctgccatgaggcgtc---tgggctgg
H2MBQ3_BCL2L10-01       ccccacctcccagcgagtcagctgctgccatgaggcgcc---tggcccag
A0A1U7QVA0_BCL2L10      agccaccgcccacgtcggcagaggcggccttgctgcgctctgtggcagag
Q9Z0F3_BCL2L10-01       agccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgactagg
Q99M66_BCL2L10-01       agccactgcccacgtctgttgaggcggccttgctgcgctctgtgactagt
G1QEX2_BCL2L10-01       cgcagcagccgtccacgcccgaggccaccgtgatgcgctccctggctgct
W5QIG4_BCL2L10-01       ctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgcc
E1B9B3_BCL2L10-01       ctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgca
F1MV39_BCL2L10-01       ctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgca
F1RZB9_BCL2L10-01       cgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcc
H0WZ06_BCL2L10-01       agccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcc
G1T264_BCL2L10-01       agccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggccacg
A0A2K6F2Q2_BCL2L10      ggctgccgccgtcctcgctcgaggccgccgcgatgcgcttcgcagccacc
A0A2K6TIT7_BCL2L10      agtcgccaccggccacggccgaggccgctgtgctgcgcgccacggccgcc
A0A2K5F974_BCL2L10      agtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgcc
F7CT87_BCL2L10-01       agtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgcc
A0A0D9RG38_BCL2L10      agcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
A0A2K5TKG9_BCL2L10      agccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
F7H6U5_BCL2L10-01       agccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
A0A2K6B2D9_BCL2L10      agccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
A0A2K5MMZ4_BCL2L10      agccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgcc
A0A096NM44_BCL2L10      agccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgcc
A0A2K5K3B0_BCL2L10      agccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggcc
A0A2K6M5H5_BCL2L10      agccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggcc
A0A2K6R5T5_BCL2L10      agccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggcc
G1R3W6_BCL2L10-01       agccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgcc
H2NN92_BCL2L10-01       agccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggccgcc
Q9HD36_BCL2L10-01       agccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccgcc
Q9HD36_BCL2L10-02       agccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccgcc
G3QLU6_BCL2L10-01       agccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
A0A2R9BCD9_BCL2L10      agccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
H2Q9G4_BCL2L10-01       agccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccgcc
F6ZPD4_BCL2L10-01       --------ccggccacgcccgaggtggccgtgctgcgctgcgtggccgcc
A0A337RYG8_BCL2L10      cgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcc
G1LKR4_BCL2L10-01       cgcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcc
M3Y8D1_BCL2L10-01       cgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgcc
                                 *          *  *   *        *             

F6VJQ0_BCL2L10-01       gagctccgccagatttaccaggacttcttcgagtgcgccctgaatcagct
D2IT42_BCL2L10-02       gacatggagcggcagcactacgctcgcttc----caggc---tctggccc
A0A096ME02_BCL2L10      gacgtggaggcccagcaccaggctcgcttt----cactc---cctggccc
M4AUW7_BCL2L10-01       gacgtggaggccaagcaccaggctcgcttt----cactc---cctggccc
I3J363_BCL2L10-01       gacatcgaaagacagcaccaagctcgcttc----gacaa---cctcgctc
H2MBQ3_BCL2L10-01       gacatggaggcgcagtaccagccccgcttc----tccac---cttagcac
A0A1U7QVA0_BCL2L10      cagatccaacagcagcaccacttttttttc----tcctccttcgtcggct
Q9Z0F3_BCL2L10-01       cagatccagcaggagcaccaagaatttttt----tcctccttctgcgaaa
Q99M66_BCL2L10-01       cagatccaacaggagcaccaggatcttttc----aactccttccgcgact
G1QEX2_BCL2L10-01       cattcgtggctgggtaccccgcactcctgg----tcc-----cggaggca
W5QIG4_BCL2L10-01       cgtgtcctggaagcaaatcgaaacgtcttg----cccctataccgccgct
E1B9B3_BCL2L10-01       cgtatccaggaagcaaatcgaaacgtcttg----cccctataccgccgct
F1MV39_BCL2L10-01       cgtatccaggaagcaaatcgaaatgtcttg----cccctataccgccgct
F1RZB9_BCL2L10-01       cagatacgggagtacaacgtgcgcaccttg----tctgtctaccgcggct
H0WZ06_BCL2L10-01       tatatacagcagcgccactggtcctttttc----tccgcctacataggct
G1T264_BCL2L10-01       cagcttcagcgggtccactggcccttcttc----tccgtctaccgcggct
A0A2K6F2Q2_BCL2L10      aagatacggcggaagcacgcgtccttcttc----tccgcctacgtcggct
A0A2K6TIT7_BCL2L10      gttgtacggaaactctacccgtccttcttc----tccgcttaccgcggct
A0A2K5F974_BCL2L10      ggtgtacggaaactctaccggtccttcttc----tccgcctacctcggct
F7CT87_BCL2L10-01       agtgtgcggaaactctaccggtctttcttc----tccgcctacctcggct
A0A0D9RG38_BCL2L10      aggttacggcagctccaccggtccttcttc----tccgcctacctcggct
A0A2K5TKG9_BCL2L10      aggttacggcagctccaccggtccttcttc----tccgcctaccgcggct
F7H6U5_BCL2L10-01       aggttacggcagctccaccggtccttcttc----tccgcctaccgcggct
A0A2K6B2D9_BCL2L10      aggttacggcagctccaccggtccttcttc----tccgcctaccgcggct
A0A2K5MMZ4_BCL2L10      aggttacggcagctccaccggtccttcttc----tccgcctaccgcggct
A0A096NM44_BCL2L10      aggttacggcagctccaccggtccttcttc----tccgcctaccgcggct
A0A2K5K3B0_BCL2L10      cgattacggcagctccatcggtccttcttc----tccgcctacctcggct
A0A2K6M5H5_BCL2L10      aggttacggcagctccaccggtccttcttc----tctgcctacctcggct
A0A2K6R5T5_BCL2L10      aggttacggcagctccaccggtccttcttc----tctgcctacctcggct
G1R3W6_BCL2L10-01       aggttacggcagctccacccgtccttcttc----tccgcctacctcggct
H2NN92_BCL2L10-01       aggttacggcagctccaccggtccttcttc----tccgcctacctcggct
Q9HD36_BCL2L10-01       aggttacggcagattcaccggtcctttttc----tccgcctacctcggct
Q9HD36_BCL2L10-02       aggttacggcagattcaccggtcctttttc----tccgcctacctcggct
G3QLU6_BCL2L10-01       aggttacggcagattcaccggtccttcttc----tccgcctacctcggct
A0A2R9BCD9_BCL2L10      aggttacggcagatccaccggtccttcttc----tccgcctacctcggct
H2Q9G4_BCL2L10-01       aggttacggcagatccaccggtccttcttc----tccgcctacctcggct
F6ZPD4_BCL2L10-01       cagatacagccccgcaaccagcgtgttctt----tcccgctaccgcggct
A0A337RYG8_BCL2L10      cagatacggcagcgccaccagcgtttcttg----tcggcttaccgcggct
G1LKR4_BCL2L10-01       caggtacagcagcgtcacgagcgcttcttg----tccgattaccgcggct
M3Y8D1_BCL2L10-01       gtcgtgcggcagcgtcacgagcgcttcttg----tcggattaccgcggct
                                                                          

F6VJQ0_BCL2L10-01       actcgaccgggaacctgagcaagtaa----------------tcgtcaac
D2IT42_BCL2L10-02       agagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaag
A0A096ME02_BCL2L10      agggcttcctgaagcactgcgggacagacctctgctccaacctcagaaag
M4AUW7_BCL2L10-01       agggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaag
I3J363_BCL2L10-01       agaccttcctggtgcagtgtgggccggaccactgcctcagcctcagaaag
H2MBQ3_BCL2L10-01       agaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaag
A0A1U7QVA0_BCL2L10      a---ccagggcaaccgcgtggagctga---------------tgacacag
Q9Z0F3_BCL2L10-01       g---ccggggcaatcgcctggagctgg---------------tgaaacag
Q99M66_BCL2L10-01       a---ccagggcaaccgcctggagctgg---------------tgacacag
G1QEX2_BCL2L10-01       g-------agaaaccgactcgagcaga---------------tggtcgac
W5QIG4_BCL2L10-01       a---ccgcaggcaccgcgtcgagctgg---------------tggccagg
E1B9B3_BCL2L10-01       g---ccgcaggcaccgcgtcgagctgg---------------tggccagg
F1MV39_BCL2L10-01       g---ccgcaggcaccgcgtcgagctgg---------------tggccagg
F1RZB9_BCL2L10-01       t---ccgctggaaccgtgtcgaattgg---------------tggcctgg
H0WZ06_BCL2L10-01       a---ccccgggaatcgcgttcaggtgg---------------tggaacgg
G1T264_BCL2L10-01       a---ccccggcaaccgcatcgagctgg---------------cggcgcgc
A0A2K6F2Q2_BCL2L10      a---ccccgggaaccgcgtctacctgc---------------tggagcgg
A0A2K6TIT7_BCL2L10      a---ccccaggaaccgcgtcgagctgg---------------tggcgagg
A0A2K5F974_BCL2L10      a---cccggggaaccgcgtcgagctgg---------------tggcgagg
F7CT87_BCL2L10-01       a---ccccgggaaccgcgtcgagctgg---------------tggcgagg
A0A0D9RG38_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K5TKG9_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
F7H6U5_BCL2L10-01       a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K6B2D9_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K5MMZ4_BCL2L10      a---ccgcgggaaccgcgtcgagctgg---------------tggcgctg
A0A096NM44_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K5K3B0_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K6M5H5_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
A0A2K6R5T5_BCL2L10      a---ccccgggaaccgcgtcgagctgg---------------tggcgctg
G1R3W6_BCL2L10-01       a---ccctgggaaccgcgtcgagctgg---------------tggtgctg
H2NN92_BCL2L10-01       a---ccccgggaaccgcgtcgaactgg---------------tggcgctg
Q9HD36_BCL2L10-01       a---ccccgggaaccgcttcgagctgg---------------tggcgctg
Q9HD36_BCL2L10-02       a---ccccgggaaccgcttcgagctgg---------------tggcgctg
G3QLU6_BCL2L10-01       a---ccccgggaaccgcttcgagctgg---------------tggcgctg
A0A2R9BCD9_BCL2L10      a---ccccgggaaccgcttcgagctgg---------------tggcgctg
H2Q9G4_BCL2L10-01       a---ccccgggaaccgcttcgagctgg---------------tggcgctg
F6ZPD4_BCL2L10-01       t---ccgcggggaccacgtcgggctgg---------------cggcacgg
A0A337RYG8_BCL2L10      a---ccgcggaaaccgcgtggaactgg---------------tggcgcgg
G1LKR4_BCL2L10-01       acgccggcggcaaccgcgtggagctgg---------------tggctcag
M3Y8D1_BCL2L10-01       a---cggcggcaaccgcgtcgagctgg---------------tggctcag
                                      *                                   

F6VJQ0_BCL2L10-01       gtagcgga------gctcatggaccgaggcgagttcaactggggccgggt
D2IT42_BCL2L10-02       gtgatggaggagctggtgggagacggac---agttgaactgggggagggt
A0A096ME02_BCL2L10      gtgatggatgagatggtgggagatggac---attttaactgggggagggt
M4AUW7_BCL2L10-01       gtgatggatgagatggtgggggacggac---actttaactgggggagggt
I3J363_BCL2L10-01       gtgatgaaggagctggttggagatggac---acttgaactgggggagggt
H2MBQ3_BCL2L10-01       gtgatggaggagctggtgggagatgaac---gcttgaactgggggagggt
A0A1U7QVA0_BCL2L10      atggtagacgccgtgctccccgatggccaagacctcaactggggccgcct
Q9Z0F3_BCL2L10-01       atggcagataagttgctctccaaagaccaagacttcagctggagccaact
Q99M66_BCL2L10-01       atggcggatgagttgctctccaatgaccaagagttcaactggggccgcct
G1QEX2_BCL2L10-01       cagatagagtcgctagttccagacggcacagaccccaactggttgagcgt
W5QIG4_BCL2L10-01       atggcgcagaggctgctcgacgaagaccctggccccagctggggccgcgt
E1B9B3_BCL2L10-01       atggcgcagaggctactcgacgaagaccctggccccagctggggccgcgt
F1MV39_BCL2L10-01       atggcgcagaggctactcgacgaagaccctggccccagctggggccgcgt
F1RZB9_BCL2L10-01       atggcacagaaactactcgcaagcccacgtggccccaactggtaccgcgt
H0WZ06_BCL2L10-01       atggtgaaggctatgctctcagacaaccagagactcaactggggccgagt
G1T264_BCL2L10-01       gtggcggaggccgtgctctccgacggccacgacctcagctggggccgcgt
A0A2K6F2Q2_BCL2L10      atggcggaggccgtgctctgcgacagcctcag------ctggggccgggt
A0A2K6TIT7_BCL2L10      atggcggaggccttgctctccgacagtcccggtcccacctggggcaacgt
A0A2K5F974_BCL2L10      atggcggaggccctgctctccgacagtcccggccccacctggggcaacgt
F7CT87_BCL2L10-01       atggcggaggccctgctctccgacagtcccggccccacctggggcaacgt
A0A0D9RG38_BCL2L10      atggcggacgccgtgctctccgacagccccggccccacctggggcagggt
A0A2K5TKG9_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
F7H6U5_BCL2L10-01       atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A2K6B2D9_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A2K5MMZ4_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A096NM44_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A2K5K3B0_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A2K6M5H5_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
A0A2K6R5T5_BCL2L10      atggcggaggccgtgctctccgacagccccggccccacctggggcagggt
G1R3W6_BCL2L10-01       atggcggattccgtgctctccgacagccccggccccacctggggcagagt
H2NN92_BCL2L10-01       atggcggattccgtgctctccgacagccccagccccacctggggcagagt
Q9HD36_BCL2L10-01       atggcggattccgtgctctccgacagccccggccccacctggggcagagt
Q9HD36_BCL2L10-02       atggcggattccgtgctctccgacagccccggccccacctggggcagagt
G3QLU6_BCL2L10-01       atggcggattccgtgctctccgacagccccggccccacctggggcagagt
A0A2R9BCD9_BCL2L10      atggcggattccgtgctctccgacagccccggccccacctggggcagagt
H2Q9G4_BCL2L10-01       atggcggattccgtgctctccgacagccccggccccacctggggcagagt
F6ZPD4_BCL2L10-01       atggcgcaggcgatcttcggagaccgccacgtccccagctggggccgcgt
A0A337RYG8_BCL2L10      ttggagcaggatttactctccaacccccaaaccctcagttggggccatgt
G1LKR4_BCL2L10-01       gtggagcgggagatactcgcccacccccagcccctaagctggggccgtgt
M3Y8D1_BCL2L10-01       ttggagcgggagatactcgcccacccccaagccctaagctggggccgtgt
                                        *                      ***       *

F6VJQ0_BCL2L10-01       ggcggtgctagtggtttttgccggggcgctgctggagatg---------g
D2IT42_BCL2L10-02       agtttccctcttcacctttaccggggtgctggccagacaactgcagga-g
A0A096ME02_BCL2L10      ggtgtccctcttcgccttcgctggcgtgctggccagacagctgcggga-a
M4AUW7_BCL2L10-01       ggtgtccctcttcgccttcgccggcgtgctggccagacagctgcggga-a
I3J363_BCL2L10-01       tgtttctctttttgcctttactggagtgctggccagaaagatcctgga-g
H2MBQ3_BCL2L10-01       cgtttccctttttgcattcgtgggagtgctggcgaggcagctgaggga-g
A0A1U7QVA0_BCL2L10      ggtgttgctcttagcctttgcggggacaattgtgagtcaag---------
Q9Z0F3_BCL2L10-01       ggtgatgctcctggccttcgcggggacgcttatgaatcaaggccctta-c
Q99M66_BCL2L10-01       ggtgatgctcctggccttcgtggggacgctaatgaaccaag------a-c
G1QEX2_BCL2L10-01       ggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccag
W5QIG4_BCL2L10-01       ggcctcactcgtgaccttcgcggggtctctgctggagaggcagccgca-g
E1B9B3_BCL2L10-01       ggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgca-g
F1MV39_BCL2L10-01       ggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgca-g
F1RZB9_BCL2L10-01       ggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcg-g
H0WZ06_BCL2L10-01       ggtgacgctcgtgaccttcgcagggacgcttctacagag---gcctcc-a
G1T264_BCL2L10-01       ggtgacgctcgtgaccttcgccgggacgcttctggacagagggccgcc-g
A0A2K6F2Q2_BCL2L10      agtgatgctcgtgaccttcgcagggacgcttctagagagagggccgcc-g
A0A2K6TIT7_BCL2L10      ggtgatgctcctggccttcgcggggacgctgctagagagggggccgct-g
A0A2K5F974_BCL2L10      ggtgatgctcctggccttcgcggggacgctgctagagagggggccgct-g
F7CT87_BCL2L10-01       ggtgatgctcctggccttcgcggggacgctgctagagagggggccgct-g
A0A0D9RG38_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K5TKG9_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
F7H6U5_BCL2L10-01       ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K6B2D9_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K5MMZ4_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A096NM44_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K5K3B0_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K6M5H5_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
A0A2K6R5T5_BCL2L10      ggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgct-g
G1R3W6_BCL2L10-01       ggtgacgctcgtggccttcgcagggacgctgctggagagagggccgct-g
H2NN92_BCL2L10-01       ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
Q9HD36_BCL2L10-01       ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
Q9HD36_BCL2L10-02       ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
G3QLU6_BCL2L10-01       ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
A0A2R9BCD9_BCL2L10      ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
H2Q9G4_BCL2L10-01       ggtgacgctcgtgaccttcgcagggacgctgctggagagagggccgct-g
F6ZPD4_BCL2L10-01       ggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcg-g
A0A337RYG8_BCL2L10      ggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgcc-g
G1LKR4_BCL2L10-01       ggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtc-g
M3Y8D1_BCL2L10-01       ggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccgtc-g
                         *     **  *     *    **     *                    

F6VJQ0_BCL2L10-01       aggaactactgaaagaggagcaggtact----------gcagcttcggag
D2IT42_BCL2L10-02       aagaagggggtacaactggggcaggaccccgg---------gacgggcag
A0A096ME02_BCL2L10      cagacgggcaagaacccggggccggactccgg---------gaagcagca
M4AUW7_BCL2L10-01       cagacgggcaagaacccggtgccggactccgg---------gaagcagca
I3J363_BCL2L10-01       ca---------gaagccggggctggaccctgg---------gcaacagca
H2MBQ3_BCL2L10-01       caaacagacatgaacccggggctggaccccgg---------------gcg
A0A1U7QVA0_BCL2L10      ----------agcagagaaac---------------------cgtctgaa
Q9Z0F3_BCL2L10-01       atggctgtcaagcagaagagg---------------------gatctggg
Q99M66_BCL2L10-01       aggactgttaagcggaggagg---------------------gatcaaag
G1QEX2_BCL2L10-01       gccactcgcaggca-------------------------------cgcag
W5QIG4_BCL2L10-01       acgacccgacggc---agaagagagac-----------------------
E1B9B3_BCL2L10-01       acgacccgacggcaggagaagagagac-----------------------
F1MV39_BCL2L10-01       actacccgacggc---agaagagagac-----------------------
F1RZB9_BCL2L10-01       gaggcctgtgggcggaaga-------------------------------
H0WZ06_BCL2L10-01       gtagaagccaggcgggagaagcagga---------caagtcgcaactgaa
G1T264_BCL2L10-01       gtgaccacccagcgggtgaggaggaa------------------------
A0A2K6F2Q2_BCL2L10      gtgaccgcctggtggaagaagtggggcct------ccagccgcagccgaa
A0A2K6TIT7_BCL2L10      gtgaccgcccggtggaagaagtggggctt------ccagtcgcggttgaa
A0A2K5F974_BCL2L10      gtgaccgcccggtggaagaagtggggctt------ccagtcgcggctgaa
F7CT87_BCL2L10-01       gtgaccgcccggtggaagaagtggggctt------ccagtctcggctgaa
A0A0D9RG38_BCL2L10      atgacagcctggtggaagaagcagagctt------ccagccgcggct---
A0A2K5TKG9_BCL2L10      gtgacagcctggtggaagaagcggggctt------ccagccgcggctgaa
F7H6U5_BCL2L10-01       gtgacagcctggtggaagaagcggggctt------ccagccgcggctgaa
A0A2K6B2D9_BCL2L10      gtgacagcctggtggaagaagcggggctt------ccagccgcggctgaa
A0A2K5MMZ4_BCL2L10      gtgacagcctggtggaagaagcggggctt------ccagccgcggctgaa
A0A096NM44_BCL2L10      gtgacagcctggtggaagaagcggagctt------ccagccgcggctgaa
A0A2K5K3B0_BCL2L10      gtgacagcctggtggaagaagcggagctt------ccagccgcggctgaa
A0A2K6M5H5_BCL2L10      gtgacagcctggtggaagaagcggagctt------ccagccgcggctgaa
A0A2K6R5T5_BCL2L10      gtgacagcctggtggaagaagcggagctt------ccagccgcggctgaa
G1R3W6_BCL2L10-01       gtgaccgcccggtggaagaagtggggctt------ccagccgcggctaaa
H2NN92_BCL2L10-01       gtgaccgcccggtggaagaagtggggctt------ccagccgcggctaaa
Q9HD36_BCL2L10-01       gtgaccgcccggtggaagaagtggggctt------ccagccgcggctaaa
Q9HD36_BCL2L10-02       gtgaccgcccggtggaagaagtggggctt------ccagccgcggctaaa
G3QLU6_BCL2L10-01       gtgaccgcccggtggaagaagtggggctt------ccagccgcggctaaa
A0A2R9BCD9_BCL2L10      gtgaccacccggtggaagaagtggggctt------ccagccgcggctaaa
H2Q9G4_BCL2L10-01       gtgaccacccggtggaagaagtggggctt------ccagccgcggctaaa
F6ZPD4_BCL2L10-01       ggaacctaccgaaagccgaagcggggcta------caagctggagctgag
A0A337RYG8_BCL2L10      gggacctacttgaacctgacgccggacca------gcaacaggagct---
G1LKR4_BCL2L10-01       gggacctactcgaacctggggccggacca------ggaactggagctggg
M3Y8D1_BCL2L10-01       ggggcctgctcgaacttggggccggacccggaactggaactggagctggg
                                                                          

F6VJQ0_BCL2L10-01       ggaaacga---------------------gccggcgtctgaccgaaaaac
D2IT42_BCL2L10-02       ggcactgggacaggttcccggcgggagctgcagggggctggcggagacga
A0A096ME02_BCL2L10      ggaactgcaacaagagcc---cgtaagctgccgggcgctggcggagacca
M4AUW7_BCL2L10-01       ggaactgcaacaagagcc---cgtaagctgccgggcgctggcggagacca
I3J363_BCL2L10-01       ggaactgggacaggagcc---catgagctgcagaaggctggcagagacca
H2MBQ3_BCL2L10-01       ggaagtggcgcccgggcc---tgtgagctgccaggcgctggcagaaactg
A0A1U7QVA0_BCL2L10      ggata---aaatgaaagtgctccaagactgccaactcatagtggccttgc
Q9Z0F3_BCL2L10-01       gaatc---gtgtcatagtgacccgagactgctgtctcatagtgaactttc
Q99M66_BCL2L10-01       aaacc---gtctcctactggagcgagactgctatctcatagtgagcttgc
G1QEX2_BCL2L10-01       ggaatgggatgccaccgttgaccaggactgccagcgcctggtcaccttcc
W5QIG4_BCL2L10-01       -------gacggcagcgttagcagggactgtcggctcctcgtggcccttc
E1B9B3_BCL2L10-01       -------gacgacggcgttagcagggactgtcggctcctggtggcccttc
F1MV39_BCL2L10-01       -------gacgacggcgttagcagggactgtcggctcctggtggcccttc
F1RZB9_BCL2L10-01       --agaaggagggcaacgttagcagggactgccgactcctggtggctttgc
H0WZ06_BCL2L10-01       ggagggagaagacgaagtcgccagggattgccagcgcctagtggccctac
G1T264_BCL2L10-01       ------------tgaaatcgcccgggactgccagcgcttggtggccttgc
A0A2K6F2Q2_BCL2L10      ggagggggatcccgaagtcgcccgggaccgccagcgcctggtggccctgc
A0A2K6TIT7_BCL2L10      ggagccggagggcgacgtcgcccgggactgccagcgcctggtgggcttgc
A0A2K5F974_BCL2L10      ggagccggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
F7CT87_BCL2L10-01       ggagccggaaggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A0D9RG38_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K5TKG9_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
F7H6U5_BCL2L10-01       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K6B2D9_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K5MMZ4_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A096NM44_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K5K3B0_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K6M5H5_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2K6R5T5_BCL2L10      ggagcaggagggcgaggtcgcccgggactgccagcgcctggtggccttgc
G1R3W6_BCL2L10-01       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
H2NN92_BCL2L10-01       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
Q9HD36_BCL2L10-01       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
Q9HD36_BCL2L10-02       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
G3QLU6_BCL2L10-01       ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
A0A2R9BCD9_BCL2L10      ggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
H2Q9G4_BCL2L10-01       tgagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
F6ZPD4_BCL2L10-01       ggagtggaaggccggcgtggaccgggacgctgcgcgcctggtggacttcc
A0A337RYG8_BCL2L10      ggagtgggagaccaacgttggccaggactgccagcacctggtggctttgc
G1LKR4_BCL2L10-01       ggagtgggaggccggcgtccgccaggactgccggcacctggtggacttcc
M3Y8D1_BCL2L10-01       ggagtgggaggccagcgttcgccaagactgccggcgcctggtggacttcc
                                                              *           

F6VJQ0_BCL2L10-01       tctgcaactatctggtggag---aggaagggcgcgtggctgcatgagaac
D2IT42_BCL2L10-02       tagcggactacctaggggag---gagaagagggactggctgctggagaac
A0A096ME02_BCL2L10      ttgctgattacctggagaag---cacaaaaaagactggctgcaggaaaat
M4AUW7_BCL2L10-01       ttgctgattacctggagaag---cacaaaaaggactggctacaggaaaat
I3J363_BCL2L10-01       tagctgattacctgggagaa---gagaagaaagactggctgttggataat
H2MBQ3_BCL2L10-01       tagctgatttcctgggagga---gacaagaaagaatggatgctagaaaat
A0A1U7QVA0_BCL2L10      tgtgcaatcgactcctgagg---cggcatcgctcctggctggaggctcaa
Q9Z0F3_BCL2L10-01       tgtataatctgctcatggggcgtcggcaccgcgccaggctggaggctctc
Q99M66_BCL2L10-01       tgtacaatcgactcacagga---cggcatcgctcctggctggaggctcac
G1QEX2_BCL2L10-01       tgtgcagttggctcacggag---acgcaccgcacctggatggaggcgcaa
W5QIG4_BCL2L10-01       tctgcgctcagttctgcgaa---aggcaccgcgcctggctgatggcgaac
E1B9B3_BCL2L10-01       tgtgtgctcagttctgcgaa---aggcaccgcgcctggctgatgactaac
F1MV39_BCL2L10-01       tgtgtgctcagttctgcgaa---aggcaccgcgcctggctgatggctaac
F1RZB9_BCL2L10-01       tgtgcgctcagctctcaggg---cagcatcgcacctggctattggcgaac
H0WZ06_BCL2L10-01       tgagctctcggctggtgggg---cagcaccgcgtttggctggaggctcaa
G1T264_BCL2L10-01       tgtgcgctcgcctcgcaggg---cagcaccgcgcctggctgcaggctcaa
A0A2K6F2Q2_BCL2L10      tgtgcgcccggctggcgggg---cagcaccgcgcctggctgcaggctcaa
A0A2K6TIT7_BCL2L10      tgagctcgcggctcgtgggg---cagcaccgtgcctggctggaggctcag
A0A2K5F974_BCL2L10      tgagctcgcggctcgtgggg---cagcaccgtgcctggctggaggctcag
F7CT87_BCL2L10-01       tgagttcgcggctcgtgggg---cagcaccgtgcctggctggaggctcag
A0A0D9RG38_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcaa
A0A2K5TKG9_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
F7H6U5_BCL2L10-01       tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
A0A2K6B2D9_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
A0A2K5MMZ4_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
A0A096NM44_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
A0A2K5K3B0_BCL2L10      tgagctcgcggctcgcgggg---cagcaccgcgcctggcttcaggctcag
A0A2K6M5H5_BCL2L10      tgagctcgcggctcacgggg---cagcaccgcgcctggcttcaggctcag
A0A2K6R5T5_BCL2L10      tgagctcgcggctcacgggg---cagcaccgcgcctggcttcaggctcag
G1R3W6_BCL2L10-01       tgagctcgcgcctcgtgggg---cagcaccgcgcctggctgcaggctcag
H2NN92_BCL2L10-01       tgagctcgcggctcgtgggg---cagcaccgcgcctggctgcaggctcag
Q9HD36_BCL2L10-01       tgagctcgcggctcatgggg---cagcaccgcgcctggctgcaggctcag
Q9HD36_BCL2L10-02       tgagctcgcggctcatgggg---cagcaccgcgcctggctgcaggctcag
G3QLU6_BCL2L10-01       tgagctcgcggctcatgggg---cagcaccgcgcctggctgcaggctcag
A0A2R9BCD9_BCL2L10      tgagctcgcggctcgtgggg---cagcaccgcgcctggctgcaggctcag
H2Q9G4_BCL2L10-01       tgagctcgcggctcgtgggg---cagcaccgcgcctggctgcaggctcag
F6ZPD4_BCL2L10-01       tgtgcgcatggctcaagggg---cggcaccgcgcctggctggaggctcac
A0A337RYG8_BCL2L10      tctgcaatcggctcaccgga---cggcatcgcgcctggctggaggctcac
G1LKR4_BCL2L10-01       tctgcaatcggctcacggga---cagcatcgcgcctggctggaggcgcac
M3Y8D1_BCL2L10-01       tctgcggtcggctcacaggg---cagcaccgcgcctggctggaggcgcac
                        *           *              *        ** *          

F6VJQ0_BCL2L10-01       ggaggctg------------------------------------------
D2IT42_BCL2L10-02       gggggctg------------------------------------------
A0A096ME02_BCL2L10      aatggatg------------------------------------------
M4AUW7_BCL2L10-01       aatggatg------------------------------------------
I3J363_BCL2L10-01       gatggatg------------------------------------------
H2MBQ3_BCL2L10-01       gatggatg------------------------------------------
A0A1U7QVA0_BCL2L10      ggtggctg------------------------------------------
Q9Z0F3_BCL2L10-01       ggcggctg------------------------------------------
Q99M66_BCL2L10-01       ggtggctg------------------------------------------
G1QEX2_BCL2L10-01       ggtggctg------------------------------------------
W5QIG4_BCL2L10-01       ggcggctg------------------------------------------
E1B9B3_BCL2L10-01       ggcggctg------------------------------------------
F1MV39_BCL2L10-01       ggcggctg------------------------------------------
F1RZB9_BCL2L10-01       ggcggctg------------------------------------------
H0WZ06_BCL2L10-01       ggcggctg------------------------------------------
G1T264_BCL2L10-01       ggcggctg------------------------------------------
A0A2K6F2Q2_BCL2L10      ggcggctg------------------------------------------
A0A2K6TIT7_BCL2L10      ggcggctgggtgagcacgcggagg-----aggacgtggggcg---ggatg
A0A2K5F974_BCL2L10      ggcggctgggtgagcatgcggagg-----gggacacgggcctcccgagta
F7CT87_BCL2L10-01       ggcggctgggtgagca--aggagg-----gggacacggggcg---ggata
A0A0D9RG38_BCL2L10      ggcggctg------------------------------------------
A0A2K5TKG9_BCL2L10      ggcggctg------------------------------------------
F7H6U5_BCL2L10-01       ggcggctg------------------------------------------
A0A2K6B2D9_BCL2L10      ggcggctg------------------------------------------
A0A2K5MMZ4_BCL2L10      ggcggctg------------------------------------------
A0A096NM44_BCL2L10      ggcggctgggtgagcacgcggcggacaccgggacgcggggcg---ggacg
A0A2K5K3B0_BCL2L10      ggcggttg------------------------------------------
A0A2K6M5H5_BCL2L10      ggcggctg------------------------------------------
A0A2K6R5T5_BCL2L10      ggcggctgggtgagcacgcggcggacaccgggacgcggggcg---ggacg
G1R3W6_BCL2L10-01       ggcggctgggtgagcacgcggcggacaccgggacacggggcg---ggacg
H2NN92_BCL2L10-01       ggcggctg------------------------------------------
Q9HD36_BCL2L10-01       ggcggctg------------------------------------------
Q9HD36_BCL2L10-02       ggcggctgggtgagcacgcggcggacaccgggacacggggcg---ggacg
G3QLU6_BCL2L10-01       ggcggctg------------------------------------------
A0A2R9BCD9_BCL2L10      ggcggctg------------------------------------------
H2Q9G4_BCL2L10-01       ggcggctg------------------------------------------
F6ZPD4_BCL2L10-01       tatggctg------------------------------------------
A0A337RYG8_BCL2L10      gacggctg------------------------------------------
G1LKR4_BCL2L10-01       gacggctg------------------------------------------
M3Y8D1_BCL2L10-01       ggcggctg------------------------------------------
                           ** **                                          

F6VJQ0_BCL2L10-01       -------------------------------gactgg-------ctttca
D2IT42_BCL2L10-02       -------------------------------ggaagg-------gttttg
A0A096ME02_BCL2L10      -------------------------------ggacgg-------gttttg
M4AUW7_BCL2L10-01       -------------------------------ggaagg-------gttttg
I3J363_BCL2L10-01       -------------------------------ggaagg-------cttctg
H2MBQ3_BCL2L10-01       -------------------------------ggaagg-------cttctg
A0A1U7QVA0_BCL2L10      -------------------------------ggatgg-------cttttg
Q9Z0F3_BCL2L10-01       -------------------------------ggatgg-------cttttg
Q99M66_BCL2L10-01       -------------------------------ggatgg-------cttttg
G1QEX2_BCL2L10-01       -------------------------------ggatgg-------cttttg
W5QIG4_BCL2L10-01       -------------------------------ggatgg-------attttg
E1B9B3_BCL2L10-01       -------------------------------ggatgg-------attttg
F1MV39_BCL2L10-01       -------------------------------ggatgg-------attttg
F1RZB9_BCL2L10-01       -------------------------------ggatgg-------attttg
H0WZ06_BCL2L10-01       -------------------------------ggatgg-------cttttg
G1T264_BCL2L10-01       -------------------------------ggatgg-------cttttg
A0A2K6F2Q2_BCL2L10      -------------------------------ggatgg-------cttttg
A0A2K6TIT7_BCL2L10      ggcacctgggaagggcccgccag--------gtggggtatttttctcctg
A0A2K5F974_BCL2L10      g----ctgggaa-------tata--------ggatgg-------cttttg
F7CT87_BCL2L10-01       ggcacctgggaaccgcccgccca--------cgatgg-------cttttg
A0A0D9RG38_BCL2L10      -------------------------------ggatgg-------cttttg
A0A2K5TKG9_BCL2L10      -------------------------------ggatgg-------cttttg
F7H6U5_BCL2L10-01       -------------------------------ggatgg-------cttttg
A0A2K6B2D9_BCL2L10      -------------------------------ggatgg-------cttttg
A0A2K5MMZ4_BCL2L10      -------------------------------ggatgg-------cttttg
A0A096NM44_BCL2L10      ggcatccgggaagcgcccacgaggccggcacggatgg-------cttttg
A0A2K5K3B0_BCL2L10      -------------------------------ggatgg-------cttctg
A0A2K6M5H5_BCL2L10      -------------------------------ggatgg-------cttttg
A0A2K6R5T5_BCL2L10      ggcatccgggaagcgcccacgaggccggcacggatgg-------cttttg
G1R3W6_BCL2L10-01       ggcagccgggaagcgcccacgaggccggcacggatgg-------cttttg
H2NN92_BCL2L10-01       -------------------------------ggatgg-------cttttg
Q9HD36_BCL2L10-01       -------------------------------ggatgg-------cttttg
Q9HD36_BCL2L10-02       ggcagccgggaagcgcccacgaggctggcacggatgg-------cttttg
G3QLU6_BCL2L10-01       -------------------------------ggatgg-------cttttg
A0A2R9BCD9_BCL2L10      -------------------------------ggatgg-------cttttg
H2Q9G4_BCL2L10-01       -------------------------------ggatgg-------cttttg
F6ZPD4_BCL2L10-01       -------------------------------ggtggg-------cttttg
A0A337RYG8_BCL2L10      -------------------------------ggatgg-------cttttg
G1LKR4_BCL2L10-01       -------------------------------ggatgg-------cttttg
M3Y8D1_BCL2L10-01       -------------------------------ggatgg-------cttttg
                                                           **        *    

F6VJQ0_BCL2L10-01       ccaccacttcgaaaaa---------------aggcaatctcctccaccaa
D2IT42_BCL2L10-02       taagttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaaga
A0A096ME02_BCL2L10      tagctacgcccacaacgccagagaagtaagtcaggactcctccatgaaga
M4AUW7_BCL2L10-01       tagctatgcccgcaacgccagagaagcaagtcaggactcctccatgaaga
I3J363_BCL2L10-01       taagttctcccgcagtgccagagaagtgagccaggactcatccatgaaga
H2MBQ3_BCL2L10-01       taagttctccagaacagccagagaggtgagtcaggactcgtccatgaaga
A0A1U7QVA0_BCL2L10      tgtcatctttgggagtccctta---------ccactcgatttttggagca
Q9Z0F3_BCL2L10-01       ccgcttcttcaagaatccttta---------ccgctcggcttctggagaa
Q99M66_BCL2L10-01       ccaattcttcaagaacccctta---------ccacccggcttctggagaa
G1QEX2_BCL2L10-01       tcacaacttcatgcctgcaccg---------ccgc------ctggggaca
W5QIG4_BCL2L10-01       tctctccttcagccactcattg---------caac---catcttgggaaa
E1B9B3_BCL2L10-01       tctcttcttcagccactcattc---------cagc---catcttgggaaa
F1MV39_BCL2L10-01       tctctttttcagccagtcattc---------cagc---catcttgggaaa
F1RZB9_BCL2L10-01       tctcttcttccaaggttcattg---------caacaaac---ttggacaa
H0WZ06_BCL2L10-01       tcagttcttcaggacaccctta---------ccgctagctttttggagaa
G1T264_BCL2L10-01       tgtcttctaccggactccctta---------ccgctgaccttctggagaa
A0A2K6F2Q2_BCL2L10      tgacttattcaggaaacccttg---------ccgctagctgtttggagga
A0A2K6TIT7_BCL2L10      tgcctattaaatgacctcctac---------tcgctggc---atggagaa
A0A2K5F974_BCL2L10      ttacttcttcaggacctcctcc---------tcgctggcattatggagaa
F7CT87_BCL2L10-01       ttacttcttcaggacctcctcc---------ttgctggcattatggagaa
A0A0D9RG38_BCL2L10      tcacttcttcaggagccccttt---------ccgctggctttttggagaa
A0A2K5TKG9_BCL2L10      tcacttcttcaggagccccttt---------ccgctggctttttggagaa
F7H6U5_BCL2L10-01       tcacttcttcaggagccccttt---------ccgctggctttttggagaa
A0A2K6B2D9_BCL2L10      tcacttcttcaggagccccttt---------ccgctggctttttggagaa
A0A2K5MMZ4_BCL2L10      tcacttcttcaggagccccttt---------ccgctggctttttggagaa
A0A096NM44_BCL2L10      tcacttcttcaggagccccttt---------ccgctggctttttggagaa
A0A2K5K3B0_BCL2L10      tcacttcttcaggacccccttt---------ccgctggctttttggagaa
A0A2K6M5H5_BCL2L10      tcacttcttcaggacccccttt---------ccgctggctttttggagaa
A0A2K6R5T5_BCL2L10      tcacttcttcaggacccccttt---------ccgctggctttttggagaa
G1R3W6_BCL2L10-01       tcacttcttcaggacccccttt---------ccgctggctttttggagaa
H2NN92_BCL2L10-01       tcacttcttcaggacccccctt---------ccgctggctttttggagaa
Q9HD36_BCL2L10-01       tcacttcttcaggacccccttt---------ccactggctttttggagaa
Q9HD36_BCL2L10-02       tcacttcttcaggacccccttt---------ccactggctttttggagaa
G3QLU6_BCL2L10-01       tcacttcttcaggacccccttt---------ccgctggctttttggagaa
A0A2R9BCD9_BCL2L10      tcacttcttcaggacccccttt---------ccgctggctttttggagaa
H2Q9G4_BCL2L10-01       tcacttcttcaggacccccttt---------ccgctggctttttggagaa
F6ZPD4_BCL2L10-01       tgacttct------cactcaca---------ctgccagcttctcagagga
A0A337RYG8_BCL2L10      tctcttcttc---tcacccatg---------ctgccatcttcttggagaa
G1LKR4_BCL2L10-01       tctcttcttc---acacccatg---------ctgccgtcgtcttggaaaa
M3Y8D1_BCL2L10-01       tctcttcttc---acacccgcg---------ctgc---tgtcttggaaaa
                                                                         *

F6VJQ0_BCL2L10-01       g-----tgactcaagtaataatacactgtgctgcataatggcagcagcag
D2IT42_BCL2L10-02       cggcgctgttcgcggc-----cgccggggtgggcatcgcaggcctgac--
A0A096ME02_BCL2L10      cggcgctggttgctgt-----cgccggagtcggcatcgcagggctcac--
M4AUW7_BCL2L10-01       cggcgctggttgctgt-----cgccggggtcggcatcgctggactcac--
I3J363_BCL2L10-01       aagcgctgtttgctgc-----cgccggtgtcggccttgctgggcttac--
H2MBQ3_BCL2L10-01       ctgcgctcttcgcggc-----ggccagcgtgggcctggctggactcac--
A0A1U7QVA0_BCL2L10      cactgctgatcaagac-----ttttctgtcctgtgtcattgcaacagc--
Q9Z0F3_BCL2L10-01       gattgctgattcaggc-----ttttctgtcaggcttctttgcaacagc--
Q99M66_BCL2L10-01       gattgctgatccgggc-----tattctgtcctgtttctttgcaacggc--
G1QEX2_BCL2L10-01       gactgctggctccgct-----tctgagggcatgccttgtactcataat--
W5QIG4_BCL2L10-01       gacagctggtctggtt-----tttcctctcatactggacagcaataat--
E1B9B3_BCL2L10-01       gacagctggtctggtt-----tttcctctcatactggacagcaataat--
F1MV39_BCL2L10-01       gacagctggtctggtt-----tttcctcgcatactggacagcaataat--
F1RZB9_BCL2L10-01       gacacatggtctgggt-----ttttgtgtcatactgtacagcagtggt--
H0WZ06_BCL2L10-01       gattgctgttcgaagt-----tttactgttgtgctttttagcaacggt--
G1T264_BCL2L10-01       gactgctggtccgcac-----ttttctgtcctgctttgtagctacagc--
A0A2K6F2Q2_BCL2L10      gactgctggtccaggt-----tcttttgtcatgctttttagcaacgac--
A0A2K6TIT7_BCL2L10      aactgctggtcccggt-----tttcctgtcatggttgttaacagcagc--
A0A2K5F974_BCL2L10      aactgctggtccaggt-----tttcctgtcatggttgttaacagcagc--
F7CT87_BCL2L10-01       aagtgctggtccaggt-----tttcctgtcatggttgttaacagcagt--
A0A0D9RG38_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
A0A2K5TKG9_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
F7H6U5_BCL2L10-01       aactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
A0A2K6B2D9_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
A0A2K5MMZ4_BCL2L10      cactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
A0A096NM44_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttagcaacagc--
A0A2K5K3B0_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttaacaacagc--
A0A2K6M5H5_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttaacaacagc--
A0A2K6R5T5_BCL2L10      aactgctgatccaggc-----tttcctggcatgcttgttaacaacagc--
G1R3W6_BCL2L10-01       aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
H2NN92_BCL2L10-01       aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
Q9HD36_BCL2L10-01       aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
Q9HD36_BCL2L10-02       aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
G3QLU6_BCL2L10-01       aacagctggtccaggc-----ttttctgtcatgcttgttagcaacagc--
A0A2R9BCD9_BCL2L10      aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
H2Q9G4_BCL2L10-01       aacagctggtccaggc-----ttttctgtcatgcttgttaacaacagc--
F6ZPD4_BCL2L10-01       tactgctggtccggtt-----tcttctgtcatgcttttcagcatcagt--
A0A337RYG8_BCL2L10      gactgctggtccaggc-----tcttctgtcatgctttacagtaatgat--
G1LKR4_BCL2L10-01       gactgctggcccaggc-----tcttctgtcctgcttcacagcggtgat--
M3Y8D1_BCL2L10-01       gactgctggtccaggc-----tcttctgtcatgctttacggcagtgat--
                              *                                           

F6VJQ0_BCL2L10-01       caggatttggactagtgggattagctcttttattagtcgtacgataa---
D2IT42_BCL2L10-02       gttccttttggt-----gcgctag--------------------------
A0A096ME02_BCL2L10      cttccttctggt-----gcgctag--------------------------
M4AUW7_BCL2L10-01       cttcctcctggt-----gcgctag--------------------------
I3J363_BCL2L10-01       cttcctcttggtcaaaggcttcagattttga-------------------
H2MBQ3_BCL2L10-01       cttcctcctggt-----gcgctag--------------------------
A0A1U7QVA0_BCL2L10      catcctgtttgtct---ggaaaaga-ctatt---------ataa------
Q9Z0F3_BCL2L10-01       catcttttttatct---ggaaacg----ttt---------ataa------
Q99M66_BCL2L10-01       catcttttatatct---ggaaatg----ttt---------ataa------
G1QEX2_BCL2L10-01       cttaatctgcttgt---ggataaaaatcatg-------------------
W5QIG4_BCL2L10-01       cataatctacttct---ggataaaa-ttatc---------gtga------
E1B9B3_BCL2L10-01       cataatctacttct---ggataaaa-ttatc---------agccaacatg
F1MV39_BCL2L10-01       cataatctacttct---ggataaaa-tta---------------------
F1RZB9_BCL2L10-01       cttactctacttgt---ggagaaaa-ttatt---------gtga------
H0WZ06_BCL2L10-01       cttcatctatttct---ggacacgacttact-------------------
G1T264_BCL2L10-01       cttactcttcgcct---ggacgcgc-gtgta---------t---------
A0A2K6F2Q2_BCL2L10      cgtcatctatttct---ggacacga-ttatt---------atga------
A0A2K6TIT7_BCL2L10      attcatctacttct---ggacacga-taatt---------aggagtttta
A0A2K5F974_BCL2L10      attcatctacttct---ggacacga-taatt---------aggagttttt
F7CT87_BCL2L10-01       attcatctacttct---ggacacga-taatg---------aggagtttta
A0A0D9RG38_BCL2L10      cttcggttatctct---ggacaaga-ttatt---------atga------
A0A2K5TKG9_BCL2L10      cttcggttatctct---ggacacga-ttatt---------atga------
F7H6U5_BCL2L10-01       cttcggttatctct---ggacacga-ttatt---------atga------
A0A2K6B2D9_BCL2L10      cttcggttatctct---ggacacga-ttatt---------atga------
A0A2K5MMZ4_BCL2L10      cttcggttatctct---ggacacga-ttatt---------atga------
A0A096NM44_BCL2L10      cttcggttatctct---ggacacga-ttatt---------atgagtttta
A0A2K5K3B0_BCL2L10      cttcggttatctct---ggacacga-ttatt---------atga------
A0A2K6M5H5_BCL2L10      cttcggttacctct---ggacacga-ttatt---------atga------
A0A2K6R5T5_BCL2L10      cttcggttacctct---ggacacga-ttatt---------atgagtttta
G1R3W6_BCL2L10-01       cttcatttatttct---ggacacga-ttatt---------atgagtttta
H2NN92_BCL2L10-01       cttcatttatctct---ggacacga-ttatt---------atga------
Q9HD36_BCL2L10-01       cttcatttatctct---ggacacga-ttatt---------atga------
Q9HD36_BCL2L10-02       cttcatttatctct---ggacacga-ttatt---------atgagtttta
G3QLU6_BCL2L10-01       cttcatttatctct---ggacacga-ttatt---------atga------
A0A2R9BCD9_BCL2L10      cttcatttatctct---ggacacga-ttatt---------atga------
H2Q9G4_BCL2L10-01       cttcatttatctct---ggacacga-ttatt---------atga------
F6ZPD4_BCL2L10-01       cttaatctacctct---ggacaaaa-tta---------------------
A0A337RYG8_BCL2L10      cttaatctacttct---ggagaaga-ttatt---------gtga------
G1LKR4_BCL2L10-01       cttaatctacttct---ggaaaagg-ttatt---------gtga------
M3Y8D1_BCL2L10-01       cttaatctacttct---ggaaaaga-ttaccatttattgggtga------
                                         *                                

F6VJQ0_BCL2L10-01       --------------------------------------------------
D2IT42_BCL2L10-02       --------------------------------------------------
A0A096ME02_BCL2L10      --------------------------------------------------
M4AUW7_BCL2L10-01       --------------------------------------------------
I3J363_BCL2L10-01       --------------------------------------------------
H2MBQ3_BCL2L10-01       --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
Q9Z0F3_BCL2L10-01       --------------------------------------------------
Q99M66_BCL2L10-01       --------------------------------------------------
G1QEX2_BCL2L10-01       --------------------------------------------------
W5QIG4_BCL2L10-01       --------------------------------------------------
E1B9B3_BCL2L10-01       gacccagccaagcttgtcagcagccaggggaataacatctgtgtggataa
F1MV39_BCL2L10-01       --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
H0WZ06_BCL2L10-01       --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
A0A2K6F2Q2_BCL2L10      --------------------------------------------------
A0A2K6TIT7_BCL2L10      aaatttttagcccacttctgcctgcccaactgtga---------------
A0A2K5F974_BCL2L10      aa------------------------------------------------
F7CT87_BCL2L10-01       aaagttttagcccacttctacctgcccaactgtga---------------
A0A0D9RG38_BCL2L10      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A096NM44_BCL2L10      acatttttaacccacttctacctgcccaactgtga---------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6R5T5_BCL2L10      aaatttttaacccacttctacctgcccaactgtga---------------
G1R3W6_BCL2L10-01       aaacttttaacccgcttctacctgcacagctgtga---------------
H2NN92_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       aaacttttaacccgcttctacctgcccaactgtga---------------
G3QLU6_BCL2L10-01       --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
G1LKR4_BCL2L10-01       --------------------------------------------------
M3Y8D1_BCL2L10-01       --------------------------------------------------
                                                                          

F6VJQ0_BCL2L10-01       -------------
D2IT42_BCL2L10-02       -------------
A0A096ME02_BCL2L10      -------------
M4AUW7_BCL2L10-01       -------------
I3J363_BCL2L10-01       -------------
H2MBQ3_BCL2L10-01       -------------
A0A1U7QVA0_BCL2L10      -------------
Q9Z0F3_BCL2L10-01       -------------
Q99M66_BCL2L10-01       -------------
G1QEX2_BCL2L10-01       -------------
W5QIG4_BCL2L10-01       -------------
E1B9B3_BCL2L10-01       aaagccagcctag
F1MV39_BCL2L10-01       -------------
F1RZB9_BCL2L10-01       -------------
H0WZ06_BCL2L10-01       -------------
G1T264_BCL2L10-01       -------------
A0A2K6F2Q2_BCL2L10      -------------
A0A2K6TIT7_BCL2L10      -------------
A0A2K5F974_BCL2L10      -------------
F7CT87_BCL2L10-01       -------------
A0A0D9RG38_BCL2L10      -------------
A0A2K5TKG9_BCL2L10      -------------
F7H6U5_BCL2L10-01       -------------
A0A2K6B2D9_BCL2L10      -------------
A0A2K5MMZ4_BCL2L10      -------------
A0A096NM44_BCL2L10      -------------
A0A2K5K3B0_BCL2L10      -------------
A0A2K6M5H5_BCL2L10      -------------
A0A2K6R5T5_BCL2L10      -------------
G1R3W6_BCL2L10-01       -------------
H2NN92_BCL2L10-01       -------------
Q9HD36_BCL2L10-01       -------------
Q9HD36_BCL2L10-02       -------------
G3QLU6_BCL2L10-01       -------------
A0A2R9BCD9_BCL2L10      -------------
H2Q9G4_BCL2L10-01       -------------
F6ZPD4_BCL2L10-01       -------------
A0A337RYG8_BCL2L10      -------------
G1LKR4_BCL2L10-01       -------------
M3Y8D1_BCL2L10-01       -------------
                                     

© 1998-2018