Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

200 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcaggg
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      ccgagcggacgtaggaggatacgtgcgagcacacacactcgtgaacacaa
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      agtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccg
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      agcgacagacggactggagacagcgtcacggagcggaggacagcttcccg
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      ggaatcccgtgcttttgtttcggttcttgctgggcctgagctggtttgtc
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      agccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagc
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      ggaccatggtggtctgagcagagggcagcaggaaggcagcctggcacagt
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        ----------------------cgaagtcaccccggagcaaagtcaaaag
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        -------------------------------------------------a
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      gtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -----------------atgaaccagtttagttcaagatatttagtggca
A0A346RRN1_BCL2L1-      -----------------atgaaccagtacagttcacgttatttagtggtc
Q6GLI5_BCL2L1-01        -----------------atggagggcagcagt---agagatctggtggag
Q2TAP5_BCL2L1-01        -----------------atggagggcagcagt---agagatctggtggag
Q91828_BCL2L1-01        -----------------atggagggcagcagt---agagatctggtggag
H9GHK7_BCL2L1-01        -----------------atgtcgagcagtaac---cgagcgctcgtggtg
F6WA14_BCL2L1-01        -----------------atgtcgcacagtaac---cgggagctggtgatt
G3WKX6_BCL2L1-01        -----------------atgtctcacagtaac---cgggagctggtggtt
A0A452FIG6_BCL2L1-      -----------------atgtctcagagcaac---cgagagctggtggtt
A0A452FIG6_BCL2L1-      -----------------atgtctcagagcaac---cgagagctggtggtt
A0A3Q1LRT3_BCL2L1-      -----------------atgtctcagagcaat---cgggaactagtggtt
A0A452E1B1_BCL2L1-      -----------------atgtctcagagcaac---cgggaactagtggtt
W5PSA5_BCL2L1-01        -----------------atgtctcagagcaac---cgggaactagtggtt
G3SPN0_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
H0X6V2_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
P53563_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
P53563_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
P53563_BCL2L1-04        -----------------atgtctcagagcaac---cgggagctggtggtt
P53563_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
O35843_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtc
Q64373_BCL2L1-09        -----------------atgtctcagagcaac---cgggagctggtggtc
Q64373_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtc
Q64373_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtc
Q64373_BCL2L1-04        -----------------atgtctcagagcaac---cgggagctggtggtc
B2Z3Z4_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctagtggtt
Q9MYW4_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
O77737_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A286Y5D6_BCL2L1-      -----------------atgtctcaaagcaac---tgggagctggtggtt
G1P9D2_BCL2L1-01        -----------------atgtctcagagcaac---cgggaactggtggtt
Q05KJ0_BCL2L1-02        -----------------atgtctcagagtaac---cgggagctggtggtt
Q05KJ0_BCL2L1-01        -----------------atgtctcagagtaac---cgggagctggtggtt
A0A452FWV3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
Q9MZS7_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
F6WQI0_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2U3V0P1_BCL2L1-      -----------------atgtctcagagcaat---cgggagctggtggtt
A0A1L5BWY3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A287CZ07_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
F6WQI0_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV76_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
G1RER8_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2J8VIH3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
Q07817_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q07817_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
Q07817_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -----------------atgtctcagagcaac---cgggagctagtggtt
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5VPG2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
F6UKR4_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A0D9RJZ8_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6QFA2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6QFA2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5YR37_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6UWY8_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV77_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV75_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
F7IT34_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
F7IT34_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q76LT7_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q8SQ42_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
M3XA94_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A452SDS4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A384D3U1_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A452ILL8_BCL2L1-      -----------------atgtcgaacactaac---agggaattagtgatt
A0A452ILL8_BCL2L1-      -----------------atgtcgaacactaac---agggaattagtgatt
K7F655_BCL2L1-01        -----------------atgtcgaacactaac---agggaattagtgatt
U3JSL7_BCL2L1-01        -----------------atgtacagcagtaat---cgggagttagtgatt
Q4U2V6_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
H0Z8G3_BCL2L1-01        -----------------atgtacagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-04        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-03        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-02        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
G1N5N5_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
H3ANS8_BCL2L1-01        --------------aaaatgtccttca---ac---aggttgctggtggtg
A0A3B5K6B9_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtcatt
A0A3B5K6B9_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtcatt
H3CH49_BCL2L1-01        gcgcatctacgcagaggatgtctctaa---ac---agagaactggtcatt
C1BLI0_BCL2L1-01        -----------------atgtcttacagtaac---cgtgagctggtggtg
A0A3P8XFS0_BCL2L1-      -----------------atgtcttacagtaat---agggaactggtggtg
A0A3P8XFS0_BCL2L1-      -----------------atgtcttacagtaat---agggaactggtggtg
A0A286MU87_BCL2L1-      -----------------atgtcttacagtaac---agggaactggtggtg
C0HAD8_BCL2L1-01        -----------------atgtcttacagtaac---agggaactggtggtg
A0A345BSW9_BCL2L1-      -----------------atgtcttactataac---agagaactagtggta
Q90Z98_BCL2L1-01        -----------------atgtcttactataac---cgagaactggtggta
Q90Z98_BCL2L1-02        -----------------atgtcttactataac---cgagaactggtggta
A0A059PJI5_BCL2L1-      -----------------atgtcttactacaac---agagaacttgtcgtg
A0A3B3ZN55_BCL2L1-      -----------------atgtccctca---ac---agagaactggtggaa
A0A3B3ZN55_BCL2L1-      -----------------atgtccctca---ac---agagaactggtggaa
D2ITA2_BCL2L1-02        tgagcattgacacaagcatgtcgatcagtaac---agagaactggtgttc
A0A3P8UWG7_BCL2L1-      -----------actttgacctttaatattaac---agaaaactggtggtc
A0A3B3QRZ2_BCL2L1-      -----------------atgtcttacagcaac---agagaactggtgatg
A0A3B1JJ42_BCL2L1-      --------------gttatgtcgtactataac---cgagaattagtggtg
A0A3B4DTL9_BCL2L1-      -----------------atgtcttactacaac---agagaactggttgtg
A0A3P8XYL5_BCL2L1-      -----------------atgacttacaacaac---aaagaactggtggca
B5XAY3_BCL2L1-01        --------------atgatgacttacaacaac---agagaactggtggtg
A0A3B3TFR4_BCL2L1-      -----------------atgtcctacagcaat---agggagctggtagag
A0A3Q3DUT7_BCL2L1-      -----------------atgtctcaaa---at---cgagaactggttttg
A0A3Q3DUT7_BCL2L1-      -----------------atgtctcaaa---at---cgagaactggttttg
A0A3Q3DUT7_BCL2L1-      -----------------atgtctcaaa---at---cgagaactggttttg
W5MG74_BCL2L1-01        --------------aagatgtcatacagcaac---agagacctcgtcgtc
A0A3Q3WIW8_BCL2L1-      -----------------atgtctgtaa---ac---agagaactggtggct
A0A2U9BY16_BCL2L1-      -----------------atgtctcaga---ac---aaagaactggtggtt
A0A3B5PQJ0_BCL2L1-      -----------------atgtcacgaa---ac---agagaactggtgctt
A0A3P9N9Y4_BCL2L1-      -----------------atgtcacgaa---ac---agagaactggtgctt
A0A3B3WI27_BCL2L1-      -----------------atgtcacgaa---ac---agagaactggtgctt
A0A087X9B7_BCL2L1-      -----------------atgtcacgaa---ac---agagaactggtgctt
A0A3B3TUS7_BCL2L1-      -----------------atgtcacgaa---ac---agagaactagtgctt
A0A3Q2FR43_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtcctt
A0A3Q2QPL9_BCL2L1-      -----------------atgtctcaaa---ac---cgagaactggtgctg
A0A3Q3B3X5_BCL2L1-      -----------------atgtctcaaa---ac---aaagaactggtgctt
A0A3Q0RTF8_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtgctt
I3IZK7_BCL2L1-01        -----------tacaaaatgtctcaaa---ac---agagaactggtgctt
A0A3Q4N4B5_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
A0A3Q2X557_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
A0A3P8P0F1_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
A0A3P9D632_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
A0A3P9D632_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
A0A3B4FNX1_BCL2L1-      -----------------atgtctcaaa---ac---agagaacttgtgctt
G3NJY1_BCL2L1-01        -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3B3IB64_BCL2L1-      -----------------atgtcccgga---ac---agagaactggttgtt
A0A3P9JYH1_BCL2L1-      -----------------atgtcccgga---ac---agagaactggttgtt
A0A3B3DHA1_BCL2L1-      -----------------atgtcccgca---ac---agagaactggttgtt
C3VIT1_BCL2L1-01        -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3B4Z3X2_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3B4Z3X2_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3Q1GS47_BCL2L1-      acacattggcacgcaacatgtctcaga---ac---agagaactggtggtt
A0A3Q1GS47_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A3P8TL99_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A3P8TL99_BCL2L1-      -----------------atgtctcaga---ac---agagaactggtggtt
A0A219P0Y3_BCL2L1-      -----------------atgtgtcaaa---ac---agagaactggtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctcaaa---ac---agagaactagtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctcaaa---ac---agagaactagtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctcaaa---ac---agagaactagtggtt
A0A3B4V3T1_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtcgtt
A0A3B4XU17_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtcgtt
A0A3Q3IVF5_BCL2L1-      -----------------atgtctcaaa---ac---aaagaactggtggtt
A0A3Q3MX20_BCL2L1-      -----------------atgtctcaaa---ac---agggaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A0D6DR75_BCL2L1-      -----------------atgtctcaaa---ac---agagaactggtggtt
A0A3B3E2W4_BCL2L1-      -----------------atgtcccactgtaac---cgagagctggtgcag
A0A3B3ICL7_BCL2L1-      -----------------atgactaagtggaag---aaatcatgg------
A0A3B3ICL7_BCL2L1-      -----------------atgtcccactgtaac---agagagctggtccgg
A0A3B4BFZ8_BCL2L1-      -----------------atgtctcccagtaac---cgagagctggttgaa
A0A3P8VMA1_BCL2L1-      -----------------atgtcgtgcagtaac---agagaattggttaag
A0A0F7L1T6_BCL2L1-      -----------------atgtcgtataacaac---agagagctggtggag
H2U5I3_BCL2L1-01        -----------------atgtcgtataacaac---agagagctggtggag
H2U5I3_BCL2L1-02        -----------------atgtcgtataacaac---agagagctggtggag
G3P7B4_BCL2L1-01        -----------------atggcgaacattaac---agggagctggtggag
A0A3Q3FUB6_BCL2L1-      -----------------atgtcatacagtaac---agagagctggtggag
A0A3Q3X5M5_BCL2L1-      -----------------atgtcgcacagtaac---agagagctggtggag
A0A2U9BIG9_BCL2L1-      -----------------atgtcggacagtaac---agagagctggtcgag
A0A3Q1JZ46_BCL2L1-      --------atggaagaaatgtcgaacagtaac---agagagctggtggag
A0A3Q1JZ46_BCL2L1-      --------atggaagaaatgtcgaacagtaac---agagagctggtggag
A0A3Q3NFM4_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3Q3NFM4_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3Q3J5K3_BCL2L1-      -----------------atgtcgtacagtcac---agagagctggtggag
A0A3B4V9K8_BCL2L1-      -----------------atgtcgtacagcaac---agagagctggtggag
A0A3B4XS24_BCL2L1-      -----------------atgtcgtacagcaac---agagagctggtggag
A0A3B5B4X7_BCL2L1-      --------atggaaataatgtcgtacagtaac---agagagctagtggag
A0A3Q1EVP6_BCL2L1-      -----------------atgtcgtgcagtaac---agagagctggtggag
A0A3Q1BQA0_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3P8U812_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
E6ZFR0_BCL2L1-01        -----------------atgtcgtacagtaac---agagagctggtggag
A0A0B4KJI5_BCL2L1-      -----------------atgtcgtacagtaac---agagagctagtggag
A0A3Q3BEB7_BCL2L1-      -----------------atgtcacacagcaac---agagatctggtgcag
A0A3Q2C6K4_BCL2L1-      -----------------atgtcatacagtaac---agagaactggtagag
A0A3Q2NRP4_BCL2L1-      -----------------atgtcatatagtaac---agagaactggtggag
A0A3B5MGS2_BCL2L1-      -----------------atggcctacagcaac---agagaactggtggag
M4A558_BCL2L1-01        -----------------atggcctacagcaac---agagaactggtggag
A0A3P9QFB3_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A3B3XN57_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A087YBW4_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A3B3VWI7_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
                                                                          

R4JQR8_BCL2L1-01        gactttattaatgaccgactt----cgaaaacat----------------
A0A346RRN1_BCL2L1-      gattttgtgaacgaccgacta----agaaagaat----------------
Q6GLI5_BCL2L1-01        aagtttgtttgcaagaaactgtcccagaaaggagcctgcggggagttctc
Q2TAP5_BCL2L1-01        aagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
Q91828_BCL2L1-01        aagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
H9GHK7_BCL2L1-01        gacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
F6WA14_BCL2L1-01        gactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
G3WKX6_BCL2L1-01        gactttctttcttacaagctttcacagaagggatacaattggagtcagtt
A0A452FIG6_BCL2L1-      gactttctctcttacaagctttcccagaaaggattcagctggag------
A0A452FIG6_BCL2L1-      gactttctctcttacaagctttcccagaaaggattcagctggag------
A0A3Q1LRT3_BCL2L1-      gactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
A0A452E1B1_BCL2L1-      gactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
W5PSA5_BCL2L1-01        gactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
G3SPN0_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
H0X6V2_BCL2L1-01        gactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
P53563_BCL2L1-03        gactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
P53563_BCL2L1-02        gactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
P53563_BCL2L1-04        gactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
P53563_BCL2L1-01        gactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
O35843_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q64373_BCL2L1-09        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q64373_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q64373_BCL2L1-03        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q64373_BCL2L1-04        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
B2Z3Z4_BCL2L1-01        gactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
Q9MYW4_BCL2L1-01        gactttctctcctacaagctttcgcagaaaggatacagctggagtcagtt
O77737_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A286Y5D6_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
G1P9D2_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q05KJ0_BCL2L1-02        gactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
Q05KJ0_BCL2L1-01        gactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
A0A452FWV3_BCL2L1-      gactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
Q9MZS7_BCL2L1-01        gactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
F6WQI0_BCL2L1-02        gactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
A0A2U3V0P1_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A1L5BWY3_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A287CZ07_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
I3MUP5_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
I3MUP5_BCL2L1-02        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
I3MUP5_BCL2L1-03        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
F6WQI0_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
E2IV76_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
G1RER8_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2J8VIH3_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-03        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-02        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        gactttctctcctataagctttcccagaaaggatacagctggagtcagtt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K5VPG2_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
F6UKR4_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
A0A0D9RJZ8_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K6QFA2_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K6QFA2_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K5YR37_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K6UWY8_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
E2IV77_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
E2IV75_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
F7IT34_BCL2L1-02        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
F7IT34_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q76LT7_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q8SQ42_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
M3XA94_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A452SDS4_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A384D3U1_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A452ILL8_BCL2L1-      gactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
A0A452ILL8_BCL2L1-      gactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
K7F655_BCL2L1-01        gacttcctctcctacaagctatcgcagaggggacacagctggagctggtt
U3JSL7_BCL2L1-01        gactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
Q4U2V6_BCL2L1-01        gactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
H0Z8G3_BCL2L1-01        gactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
Q07816_BCL2L1-04        gactttgtttcctacaagctctcacagagggggcactgctggagcgagct
Q07816_BCL2L1-03        gactttgtttcctacaagctctcacagagggggcactgctggagcgagct
Q07816_BCL2L1-02        gactttgtttcctacaagctctcacagagggggcactgctggagcgagct
Q07816_BCL2L1-01        gactttgtttcctacaagctctcacagagggggcactgctggagcgagct
G1N5N5_BCL2L1-01        gactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
H3ANS8_BCL2L1-01        gaccatatatcccagaagctgatgcagcggggataccagtgga-------
A0A3B5K6B9_BCL2L1-      ttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaa
A0A3B5K6B9_BCL2L1-      ttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaa
H3CH49_BCL2L1-01        ttctacattaaatacaaactttcccaaagaaactaccctttgagtcacat
C1BLI0_BCL2L1-01        ttcttcataagctataaactttcacagaggaattatcctatttctcagtt
A0A3P8XFS0_BCL2L1-      ttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
A0A3P8XFS0_BCL2L1-      ttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
A0A286MU87_BCL2L1-      ttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
C0HAD8_BCL2L1-01        ttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
A0A345BSW9_BCL2L1-      ttttttattaaatataaactctcgcagaggaactacccctgcaaccacat
Q90Z98_BCL2L1-01        ttttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
Q90Z98_BCL2L1-02        ttttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
A0A059PJI5_BCL2L1-      tacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
A0A3B3ZN55_BCL2L1-      ttctacatccagtacaaactgtctcagcgggactgtcct---------ct
A0A3B3ZN55_BCL2L1-      ttctacatccagtacaaactgtctcagcgggactgtcctctgcagcacct
D2ITA2_BCL2L1-02        ttcttcctaagccataaactgtctcagaggaattacaggcctattccctt
A0A3P8UWG7_BCL2L1-      gactacatacagtataaactttcccagaggaactttcccgtccaccacct
A0A3B3QRZ2_BCL2L1-      gacttcataacgtataaactgtcccagaggaacta---caatggccactt
A0A3B1JJ42_BCL2L1-      tactttattaagtacaaactctcacagaggaactatcctactaatcacat
A0A3B4DTL9_BCL2L1-      tactttatcaagtacaaactctcccagaggaactatccctataaccacat
A0A3P8XYL5_BCL2L1-      tactatattacctataaactatcccagagaaactaccccatcaatcacac
B5XAY3_BCL2L1-01        tactatattacctataaactatcacagagggactaccccttcaaccacat
A0A3B3TFR4_BCL2L1-      tactttgtcagctataagctggcccagaagaattactccattgcccacat
A0A3Q3DUT7_BCL2L1-      ttttacattaggtacaaactttcccagaaaaactacccgctcaaccacat
A0A3Q3DUT7_BCL2L1-      ttttacattaggtacaaactttcccagaaaaactacccgctcaaccacat
A0A3Q3DUT7_BCL2L1-      ttttacattaggtacaaactttcccagaaaaactacccgctcaaccacat
W5MG74_BCL2L1-01        tactacatcaactataaactctcgcagaagaactactcctgggaccagtt
A0A3Q3WIW8_BCL2L1-      tactacataaactataaactctcccatagaggctgtcctctcaaccacat
A0A2U9BY16_BCL2L1-      ttctacatacagtataaactctcccagaggaaatatcctctcaaccatat
A0A3B5PQJ0_BCL2L1-      ttctacattaagtttaaactgtctcagaggaactatccgatccaacacat
A0A3P9N9Y4_BCL2L1-      ttctacattaagtttaaactatctcagaggaactatccgatccaacacat
A0A3B3WI27_BCL2L1-      ttctacattaagtttaaactgtctcagaggaactatccgatccaacacat
A0A087X9B7_BCL2L1-      ttctacattaagtttaaactgtctcagaggaactatccgatccaacacat
A0A3B3TUS7_BCL2L1-      ttctacattaagtttaaactgtctcagaggaactatccgatccaacacat
A0A3Q2FR43_BCL2L1-      ttctacattaagttcaaactgtctcagaggaactatcccgtcaaccacat
A0A3Q2QPL9_BCL2L1-      tcctacgtcaagtttaaactgtctcagaggaactatcccgtcaaccacat
A0A3Q3B3X5_BCL2L1-      ttctatattatgtataaactgtcacagagaaactatcctgtcaatcacat
A0A3Q0RTF8_BCL2L1-      ttctacataacgtataaactatcccagagaaactatcctctcaaccacat
I3IZK7_BCL2L1-01        ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3Q4N4B5_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3Q2X557_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3P8P0F1_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3P9D632_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3P9D632_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
A0A3B4FNX1_BCL2L1-      ttctacataaggtataaactctcccagagaaactatcctctcaaccacat
G3NJY1_BCL2L1-01        ttctacataaactataaactctcccagaggaacttacccctcaaccacat
A0A3B3IB64_BCL2L1-      ttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacat
A0A3P9JYH1_BCL2L1-      ttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacat
A0A3B3DHA1_BCL2L1-      ttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacat
C3VIT1_BCL2L1-01        ttctacataaagtataaactctcccagagaaactatcctctcaaccacat
A0A3B4Z3X2_BCL2L1-      tactacataaagtataaactctcccagagaaactatcccctcaatcacat
A0A3B4Z3X2_BCL2L1-      tactacataaagtataaactctcccagagaaactatcccctcaatcacat
A0A3Q1GS47_BCL2L1-      ttctacataaagtataaactgtcccagagaaactatcccctcaaccacat
A0A3Q1GS47_BCL2L1-      ttctacataaagtataaactgtcccagagaaactatcccctcaaccacat
A0A3Q1DHJ3_BCL2L1-      ttctacataaagtataaactctcccagagaaactatcccctcaaccacat
A0A3Q1DHJ3_BCL2L1-      ttctacataaagtataaactctcccagagaaactatcccctcaaccacat
A0A3Q1DHJ3_BCL2L1-      ttctacataaagtataaactctcccagagaaactatcccctcaaccacat
A0A3P8TL99_BCL2L1-      ttctacataaagtataaactctcccagagaaactatcccctcaaccacat
A0A3P8TL99_BCL2L1-      ttctacataaagtataaactctcccagagaaactatcccctcaaccacat
A0A219P0Y3_BCL2L1-      tgctacataaaatataaactaacccagagaaactatcctctcaaccacat
A0A3Q3G2E1_BCL2L1-      ttctacataacctataaattctctcagagaaattatcctcttaatcacat
A0A3Q3G2E1_BCL2L1-      ttctacataacctataaattctctcagagaaattatcctcttaatcacat
A0A3Q3G2E1_BCL2L1-      ttctacataacctataaattctctcagagaaattatcctcttaatcacat
A0A3B4V3T1_BCL2L1-      ttctacataaagcataagctctcccagagaaactatcctctcacccacat
A0A3B4XU17_BCL2L1-      ttctacataaagtataagctctcccagagaaactatcctctcacccacat
A0A3Q3IVF5_BCL2L1-      ttctacataacatataaactctcccagaaaaactatcctctcagccactt
A0A3Q3MX20_BCL2L1-      ttctacataaaatataaactctcccagagaaactatcctctcatctacat
A0A3Q1GZ93_BCL2L1-      ttctacataacatataaactatcccagagaaactatcctctcaaccactt
A0A3Q1GZ93_BCL2L1-      ttctacataacatataaactatcccagagaaactatcctctcaaccactt
A0A3Q1GZ93_BCL2L1-      ttctacataacatataaactatcccagagaaactatcctctcaaccactt
A0A0D6DR75_BCL2L1-      tactacataacatataaactgtcggagaaaaactatcctctcaaccactt
A0A3B3E2W4_BCL2L1-      ttctatttaggctataagatgtcatccagagactatcctgtgtccctgct
A0A3B3ICL7_BCL2L1-      ---catctgacctataagatgtcatgcagggactatcctgtgtccctgct
A0A3B3ICL7_BCL2L1-      ttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
A0A3B4BFZ8_BCL2L1-      ttcttcataagctacaaattatcacagaaaaactacccaagttcgctgct
A0A3P8VMA1_BCL2L1-      ttctttttaggttataagctttctcagaggaactacccagaatctcttct
A0A0F7L1T6_BCL2L1-      cacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
H2U5I3_BCL2L1-01        cacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
H2U5I3_BCL2L1-02        cacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
G3P7B4_BCL2L1-01        ttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
A0A3Q3FUB6_BCL2L1-      ttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
A0A3Q3X5M5_BCL2L1-      ttctttataagctacaaactgactcaaaagaactacccaacctctctgtt
A0A2U9BIG9_BCL2L1-      ttcttcatcggctataagctgtcccagaggaactacccgacctctctact
A0A3Q1JZ46_BCL2L1-      ttcttcataatgtacaaactgtctcaaagaaaccacccagcctctcttct
A0A3Q1JZ46_BCL2L1-      ttcttcataatgtacaaactgtctcaaagaaaccacccagcctctcttct
A0A3Q3NFM4_BCL2L1-      ttctttattagctacaagctgtctcagaagaactacccgacctctctgct
A0A3Q3NFM4_BCL2L1-      ttctttattagctacaagctgtctcagaagaactacccgacctctctgct
A0A3Q3J5K3_BCL2L1-      ttctatataagctacaagttgtctcagagaaactactcaacctctctgct
A0A3B4V9K8_BCL2L1-      ttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
A0A3B4XS24_BCL2L1-      ttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
A0A3B5B4X7_BCL2L1-      ttctttataagctacaagctgtctcaaaggaactatccaacgtctctgct
A0A3Q1EVP6_BCL2L1-      ttctttataagctacaagctgtctcaaaggaactatccgatgtctctgct
A0A3Q1BQA0_BCL2L1-      ttctttgtaagcgacaagctgtctcaaaggaactatccgacgtctctgct
A0A3P8U812_BCL2L1-      ttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
E6ZFR0_BCL2L1-01        ttctttataagctataaactgtctcagaggaaccacccaacctctctact
A0A0B4KJI5_BCL2L1-      tcctttttaagctacaaactgtctcagaggaactatccaactgccctgct
A0A3Q3BEB7_BCL2L1-      ttctacataagctataagttgtctcagaggaactgttcgaagtctctgct
A0A3Q2C6K4_BCL2L1-      ttctatataagctacaaactgtctcagacaaactgcccaaactctctgct
A0A3Q2NRP4_BCL2L1-      ttctacataagctacaaattgtcccagacaaactgtccaaactctctgct
A0A3B5MGS2_BCL2L1-      ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
M4A558_BCL2L1-01        ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
A0A3P9QFB3_BCL2L1-      ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
A0A3B3XN57_BCL2L1-      ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
A0A087YBW4_BCL2L1-      ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
A0A3B3VWI7_BCL2L1-      ttctacataagctacaaattgtctcagagaaactattcaagctctctgct
                                                                          

R4JQR8_BCL2L1-01        ---------------------------ggaatgcg---------------
A0A346RRN1_BCL2L1-      ---------------------------ggattaca---------------
Q6GLI5_BCL2L1-01        cagcaac-------------------------------------------
Q2TAP5_BCL2L1-01        caataat-------------------------------------------
Q91828_BCL2L1-01        caataat-------------------------------------------
H9GHK7_BCL2L1-01        tga-gatg------------gagagcgggga-------------------
F6WA14_BCL2L1-01        tgaagat-------------gagaacaggactgag---------------
G3WKX6_BCL2L1-01        tgaagat-------------gagaacaggactgag---------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      tagtg---------------------------------------------
A0A452E1B1_BCL2L1-      tagtgata-------tggaagagaacagaactgag---------------
W5PSA5_BCL2L1-01        tagtgaca-------tggaagagaacagaactgag---------------
G3SPN0_BCL2L1-01        tagtgatg-------tggaggagaataggactggg---------------
H0X6V2_BCL2L1-01        tagcgatg-------tggaagagaacaggactgag---------------
P53563_BCL2L1-03        tagcgatg-------tcgaagagaacaggactgaa---------------
P53563_BCL2L1-02        tagcgatg-------tcgaagagaacaggactgaa---------------
P53563_BCL2L1-04        tagcgatg-------tcgaagagaacaggactgaa---------------
P53563_BCL2L1-01        tagcgatg-------tcgaagagaacaggactgaa---------------
O35843_BCL2L1-01        tagtgatg-------ttgaagagaataggactgag---------------
Q64373_BCL2L1-09        tagtgatg-------tcgaagagaataggactgag---------------
Q64373_BCL2L1-01        tagtgatg-------tcgaagagaataggactgag---------------
Q64373_BCL2L1-03        tagtgatg-------tcgaagagaataggactgag---------------
Q64373_BCL2L1-04        tagtgatg-------tcgaagagaataggactgag---------------
B2Z3Z4_BCL2L1-01        tagtgatg-------tcgaagagaacaggactgag---------------
Q9MYW4_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
O77737_BCL2L1-01        tactgatg-------tggaagagaacagaactgag---------------
A0A286Y5D6_BCL2L1-      tagtgatg-------tggaagagaacaggactgaa---------------
G1P9D2_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
Q05KJ0_BCL2L1-02        tagtgatg-------tggaagagaacagaactgag---------------
Q05KJ0_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
A0A452FWV3_BCL2L1-      tagtgatg-------tggaagagaacagaactgag---------------
Q9MZS7_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
F6WQI0_BCL2L1-02        tagtgacg-------tggaagagaacagaactgag---------------
A0A2U3V0P1_BCL2L1-      tagcgatg-------tggacgagaacagaactgag---------------
A0A1L5BWY3_BCL2L1-      tagtgatg-------tggaagagaataggactgag---------------
A0A287CZ07_BCL2L1-      tagcgatg-------tggaagagaacaggactgaa---------------
I3MUP5_BCL2L1-01        tagcgatg-------tggaagagaacaggactgaa---------------
I3MUP5_BCL2L1-02        tagcgatg-------tggaagagaacaggactgaa---------------
I3MUP5_BCL2L1-03        tagcgatg-------tggaagagaacaggactgaa---------------
F6WQI0_BCL2L1-01        tagtgacg-------tggaagagaacagaactgag---------------
E2IV76_BCL2L1-01        tatcgatg-------cagaagagaacaggactgag---------------
A0A2K6G3C5_BCL2L1-      -----atg-------cagaagagaacaggactgag---------------
A0A2K6G3C5_BCL2L1-      tatcgatg-------cagaagagaacaggactgag---------------
G1RER8_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
A0A2J8VIH3_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
Q07817_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
Q07817_BCL2L1-03        tagtgatg-------tggaagagaacaggactgag---------------
Q07817_BCL2L1-02        tagtgatg-------tggaagagaacaggactgag---------------
G3RY91_BCL2L1-02        -----atg-------tggaagagaacaggactgag---------------
G3RY91_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
A0A2K5H963_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K5H963_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K5M8B1_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K6LPM4_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K6QFA2_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K5VPG2_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
F6UKR4_BCL2L1-02        -----atg-------tggaagagaacaggactgag---------------
A0A2K5YR37_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K5YR37_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K5VPG2_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
F6UKR4_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
A0A0D9RJZ8_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
I7GKS6_BCL2L1-01        -----atg-------tggaagagaacaggactgag---------------
A0A2K6LPM4_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K6QFA2_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K6QFA2_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K5YR37_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
A0A2K6UWY8_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
E2IV77_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
A0A2K6UWY8_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
A0A2K5EBP4_BCL2L1-      tagtgatg-------tggaagagaacaggactgag---------------
E2IV75_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
F7IT34_BCL2L1-02        tagtgatg-------tggaagagaacaggactgag---------------
F7IT34_BCL2L1-01        tagtgatg-------tggaagagaacaggactgag---------------
A0A2K5EBP4_BCL2L1-      -----atg-------tggaagagaacaggactgag---------------
M3Z2H9_BCL2L1-01        tagtgatg-------cagaagagaacagaactgag---------------
Q76LT7_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
Q8SQ42_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
M3XA94_BCL2L1-01        tagtgatg-------tggaagagaacagaactgag---------------
A0A452SDS4_BCL2L1-      tagtgatg-------tggaagagaacagaactgag---------------
A0A384D3U1_BCL2L1-      tagtgatg-------tggaagagaacagaactgag---------------
A0A452ILL8_BCL2L1-      cgaagggg-------aggatgagatcaggactgat---------------
A0A452ILL8_BCL2L1-      cgaagggg-------aggatgagatcaggactgat---------------
K7F655_BCL2L1-01        cgaggggg-------aggatgagatcaggactgag---------------
U3JSL7_BCL2L1-01        ggaggagg-------aggatgagaacaggactgac---------------
Q4U2V6_BCL2L1-01        ggaagagg-------aggatgagaacaggactgac---------------
H0Z8G3_BCL2L1-01        ggaagagg-------aggatgagaacaggactgac---------------
Q07816_BCL2L1-04        ggaggaag-------aggatgagaacaggactgac---------------
Q07816_BCL2L1-03        ggaggaag-------aggatgagaacaggactgac---------------
Q07816_BCL2L1-02        ggaggaag-------aggatgagaacaggactgac---------------
Q07816_BCL2L1-01        ggaggaag-------aggatgagaacaggactgac---------------
G1N5N5_BCL2L1-01        ggaggaag-------aggatgagaacaggactgac---------------
H3ANS8_BCL2L1-01        -----------gggaggttggtgagcaggaccacg------------gtg
A0A3B5K6B9_BCL2L1-      tggactcatattag-agcctccaagtaggactgat---------------
A0A3B5K6B9_BCL2L1-      tggactcatattag-agcctccaagtaggactgat---------------
H3CH49_BCL2L1-01        tg---------tag-agccttcaagtaggactgaa---------------
C1BLI0_BCL2L1-01        gggactgg---aagatgccagtgaac-ggactaat------------gtt
A0A3P8XFS0_BCL2L1-      ggagctgg---agggtgcaagtggac-ggactgag------------gga
A0A3P8XFS0_BCL2L1-      ggagctgg---agggtgcaagtggac-ggactgag------------gga
A0A286MU87_BCL2L1-      ggggctgg---agggtgcaagtggac-ggactgac------------gga
C0HAD8_BCL2L1-01        ggggctgg---agggtgcaagtggac-ggactgag------------gga
A0A345BSW9_BCL2L1-      tgggctta---cag-aagacacaaatcggactgat------------ggg
Q90Z98_BCL2L1-01        tggactta---cag-aagacacaaatcggactgat------------ggg
Q90Z98_BCL2L1-02        tggactta---cag-aagacacaaatcggactgat------------ggg
A0A059PJI5_BCL2L1-      cggcctca---cgg-aagaggtgaac-ggccaggt------------ggc
A0A3B3ZN55_BCL2L1-      ggggctgg---agg----------atggtacgga-------------gat
A0A3B3ZN55_BCL2L1-      ggggctgg---ggg----------acagga--------------------
D2ITA2_BCL2L1-02        ccagcccg---agg-gggcaggtgaggggactgat---------------
A0A3P8UWG7_BCL2L1-      gggactcg---gtg-attctccaaacaggactgat------------ggg
A0A3B3QRZ2_BCL2L1-      tgggcttc---ctgaagac-----aggggtcggac------------aga
A0A3B1JJ42_BCL2L1-      cggactca---tgg-aagaaacaaatcgaactgaa------------ggg
A0A3B4DTL9_BCL2L1-      tgggctta---tgg-aagacacaaatcggactgaa------------ggg
A0A3P8XYL5_BCL2L1-      tgggctca---cag-gagcatttgatcggactgag------------ggg
B5XAY3_BCL2L1-01        ggagctca---cgg-aagcccagaatcggactgag------------gtg
A0A3B3TFR4_BCL2L1-      catacagg---acgaagccgacgagcaga------------------cag
A0A3Q3DUT7_BCL2L1-      aggactca---gac-aggcattgaacaggactgat------------ggc
A0A3Q3DUT7_BCL2L1-      aggactca---gac-aggcattgaacaggactgat------------ggc
A0A3Q3DUT7_BCL2L1-      aggactca---gac-aggcattgaacaggactgat------------ggc
W5MG74_BCL2L1-01        cagcctgg---agg----------gcaggaccgga------------ggc
A0A3Q3WIW8_BCL2L1-      gggactca---tag-agcctcccaacaggactgag------------ggg
A0A2U9BY16_BCL2L1-      gggactta---atg-agcctccgaacaggactgat------------cgg
A0A3B5PQJ0_BCL2L1-      attgccca---acg-agcccccggacggcaccgct------------gcc
A0A3P9N9Y4_BCL2L1-      attgccca---atg-agcccccggacagcaccgctgccagggacgcggcc
A0A3B3WI27_BCL2L1-      attgccca---atg-agcccccggacagcaccgctgctggggacgcggcc
A0A087X9B7_BCL2L1-      attgccca---atg-agcccccggacagcaccgctgctggggacgcggcc
A0A3B3TUS7_BCL2L1-      attgccca---atg-agcccccggacagcaccgctgctggggacgcggcc
A0A3Q2FR43_BCL2L1-      aatgctca---acg-agccgcccaacggcaccggc------------gcc
A0A3Q2QPL9_BCL2L1-      aatgctca---acg-agccgcccagcgacggcggc------------gcc
A0A3Q3B3X5_BCL2L1-      aatactca---gtg-atcctccgaatagaactgat------------gca
A0A3Q0RTF8_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
I3IZK7_BCL2L1-01        agtactca---acg-agcctttgaacaggactgat------------ggg
A0A3Q4N4B5_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
A0A3Q2X557_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
A0A3P8P0F1_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
A0A3P9D632_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
A0A3P9D632_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
A0A3B4FNX1_BCL2L1-      agtactca---acg-agccttcgaacaggactgat------------ggg
G3NJY1_BCL2L1-01        agggctgt---ccg-agcctcccaacaggactggc------------ggg
A0A3B3IB64_BCL2L1-      agtgctca---atg-agtctccgaacaggactgct------------gcg
A0A3P9JYH1_BCL2L1-      agtgctca---atg-agtctccgaacaggactgct------------gcg
A0A3B3DHA1_BCL2L1-      agtgctca---atg-agtctccgaacaggactgct------------gcg
C3VIT1_BCL2L1-01        agtgctca---atg-agcctccgaacaggactggt------------gcc
A0A3B4Z3X2_BCL2L1-      ggtgctca---atg-aggctcccaacaggactgac------------ggg
A0A3B4Z3X2_BCL2L1-      ggtgctca---atg-aggctcccaacaggactgac------------ggg
A0A3Q1GS47_BCL2L1-      ggtgctga---acg-aggctcccaacaggactgat------------ggg
A0A3Q1GS47_BCL2L1-      ggtgctga---acg-aggctcccaacaggactgat------------ggg
A0A3Q1DHJ3_BCL2L1-      ggtgctga---atg-aggctcccagcaggactgac------------ggg
A0A3Q1DHJ3_BCL2L1-      ggtgctga---atg-aggctcccagcaggactgac------------ggg
A0A3Q1DHJ3_BCL2L1-      ggtgctga---atg-aggctcccagcaggactgac------------ggg
A0A3P8TL99_BCL2L1-      ggtgctga---atg-aggctcccagcaggactgac------------ggg
A0A3P8TL99_BCL2L1-      ggtgctga---atg-aggctcccagcaggactgac------------ggg
A0A219P0Y3_BCL2L1-      gggactca---tag-agcctccaaacaggactgat------------ggg
A0A3Q3G2E1_BCL2L1-      ggaactct---tag-agcctccaaacaggactgat------------ggg
A0A3Q3G2E1_BCL2L1-      ggaactct---tag-agcctccaaacaggactgat------------ggg
A0A3Q3G2E1_BCL2L1-      ggaactct---tag-agcctccaaacaggactgat------------ggg
A0A3B4V3T1_BCL2L1-      ggaactca---atg-agtctcccaacaggactgat------------ggc
A0A3B4XU17_BCL2L1-      ggaactca---atg-agtctcccaacaggactgat------------ggc
A0A3Q3IVF5_BCL2L1-      gggactaa---atg-agtctccaaacaggactgat------------gga
A0A3Q3MX20_BCL2L1-      agaactca---atg-agcaacagaacaggactgat------------ggg
A0A3Q1GZ93_BCL2L1-      gggactca---atg-agactcccaacaggactgat------------ggg
A0A3Q1GZ93_BCL2L1-      gggactca---atg-agactcccaacaggactgat------------ggg
A0A3Q1GZ93_BCL2L1-      gggactca---atg-agactcccaacaggactgat------------ggg
A0A0D6DR75_BCL2L1-      gggactca---gtg-agcctccaaacaggactgat------------gga
A0A3B3E2W4_BCL2L1-      gaaaccca---cag-atgatgggggacaaactgca------------g--
A0A3B3ICL7_BCL2L1-      gaagccca---cag-acgatgggggagaaactgaa------------g--
A0A3B3ICL7_BCL2L1-      gaagccca---cag-acgatgggggagaaactgaa------------g--
A0A3B4BFZ8_BCL2L1-      tatgtcag---acc-ccgctagggtccagtgtgag------------ggc
A0A3P8VMA1_BCL2L1-      gatgttga---gga-ttgggggagaacagcgtgaa------------ggt
A0A0F7L1T6_BCL2L1-      gagaccag---agg-atactgatggaaggacagag------------gga
H2U5I3_BCL2L1-01        gagaccag---agg-atactgatggaaggacagag------------gga
H2U5I3_BCL2L1-02        gagaccag---agg-atactgatggaaggacagag------------gga
G3P7B4_BCL2L1-01        gaggccgg---agg-atgccggcggaaggacggag------------gga
A0A3Q3FUB6_BCL2L1-      gaggtcag---agg-atgctggtgaaaggactgag------------gga
A0A3Q3X5M5_BCL2L1-      aaggccag---aag-ataccggtgggaggactgaa------------gga
A0A2U9BIG9_BCL2L1-      gaggccgg---agg-atgctggtggaaggactgag------------gga
A0A3Q1JZ46_BCL2L1-      gaggccag---atg-ataccggtgga------gtg------------gga
A0A3Q1JZ46_BCL2L1-      gaggccag---atg-ataccggtgga------gtg------------gga
A0A3Q3NFM4_BCL2L1-      gaggccag---aag-atgctggtggaaggacagag------------gga
A0A3Q3NFM4_BCL2L1-      gaggccag---aag-atgctggtggaaggacagag------------gga
A0A3Q3J5K3_BCL2L1-      gaggccgg---aaa-acgctggtggaaggactgag------------gga
A0A3B4V9K8_BCL2L1-      gaggccag---agg-atgctggtggaaggactgag------------gga
A0A3B4XS24_BCL2L1-      gaggccag---agg-atgctggtggaaggactgag------------gga
A0A3B5B4X7_BCL2L1-      gaggccgg---agg-atgctgcaggaaggactgag------------gga
A0A3Q1EVP6_BCL2L1-      gaggccag---agg-atgctggaggaaggactgat------------ggg
A0A3Q1BQA0_BCL2L1-      gaggccag---agg-atgctggaggaaggactgat------------ggg
A0A3P8U812_BCL2L1-      gaggccag---agg-atgctgaaggaaggactgat------------ggg
E6ZFR0_BCL2L1-01        gaggccgg---aga-atgccggtgaaaggactgag------------gga
A0A0B4KJI5_BCL2L1-      gaggccag---atg-atgctggtggaaggactgag------------gca
A0A3Q3BEB7_BCL2L1-      gatgccgg---agg-ttgccggtgaaaggaccgag---------------
A0A3Q2C6K4_BCL2L1-      gaggtcgg---agg-tcactggtggccggaccgag------------gga
A0A3Q2NRP4_BCL2L1-      gaggtccg---agg-ttgctggcgataggaccgag------------ggg
A0A3B5MGS2_BCL2L1-      gaggtccg---agg-ttgccgggggcaggaccaat------------tgg
M4A558_BCL2L1-01        gaggtccg---agg-ttgccgggggcaggaccaat------------tgg
A0A3P9QFB3_BCL2L1-      gaggtccg---agg-ccgacggggccaggaccaat------------tgg
A0A3B3XN57_BCL2L1-      gaggtccg---agg-ccgacggggccaggaccaat------------tgg
A0A087YBW4_BCL2L1-      gaggtccg---agg-ccgacggggccaggaccaat------------tgg
A0A3B3VWI7_BCL2L1-      gaggtccg---agg-ccgacggggccaggaccaat------------tgg
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        ---------------------------------tcccag-----------
Q2TAP5_BCL2L1-01        ---------------------------------ccccaa-----------
Q91828_BCL2L1-01        ----------------------------------cccaa-----------
H9GHK7_BCL2L1-01        -------------------------------------ggaagcgatggag
F6WA14_BCL2L1-01        --------------------------------gttctagaaggggc----
G3WKX6_BCL2L1-01        --------------------------------gcctcagaagggac----
A0A452FIG6_BCL2L1-      ---------------------------------cctcagaagggacaaaa
A0A452FIG6_BCL2L1-      ---------------------------------cctcagaagggacaaaa
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------accctagaagggacagaa
W5PSA5_BCL2L1-01        --------------------------------accctagaagggacagaa
G3SPN0_BCL2L1-01        --------------------------------gcctcggaaggcactgaa
H0X6V2_BCL2L1-01        --------------------------------gccccagaagggaatgaa
P53563_BCL2L1-03        --------------------------------gccccagaagaaactgaa
P53563_BCL2L1-02        --------------------------------gccccagaagaaactgaa
P53563_BCL2L1-04        --------------------------------gccccagaagaaactgaa
P53563_BCL2L1-01        --------------------------------gccccagaagaaactgaa
O35843_BCL2L1-01        --------------------------------gccccagaagaaactgaa
Q64373_BCL2L1-09        --------------------------------gccccagaagaaactgaa
Q64373_BCL2L1-01        --------------------------------gccccagaagaaactgaa
Q64373_BCL2L1-03        --------------------------------gccccagaagaaactgaa
Q64373_BCL2L1-04        --------------------------------gccccagaagaaactgaa
B2Z3Z4_BCL2L1-01        --------------------------------gccccagaaggaactgaa
Q9MYW4_BCL2L1-01        --------------------------------gccccggaagggactgga
O77737_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A286Y5D6_BCL2L1-      --------------------------------ggcccagaagggactgaa
G1P9D2_BCL2L1-01        --------------------------------gccccagaagggactgaa
Q05KJ0_BCL2L1-02        --------------------------------gccccagaagggacagaa
Q05KJ0_BCL2L1-01        --------------------------------gccccagaagggacagaa
A0A452FWV3_BCL2L1-      --------------------------------gccccagaagggacagaa
Q9MZS7_BCL2L1-01        --------------------------------gccccagaagggacagaa
F6WQI0_BCL2L1-02        --------------------------------gccccagaagggactgaa
A0A2U3V0P1_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A1L5BWY3_BCL2L1-      --------------------------------gccccagaagggattgaa
A0A287CZ07_BCL2L1-      --------------------------------gccccagaagggactgaa
I3MUP5_BCL2L1-01        --------------------------------gccccagaagggactgaa
I3MUP5_BCL2L1-02        --------------------------------gccccagaagggactgaa
I3MUP5_BCL2L1-03        --------------------------------gccccagaagggactgaa
F6WQI0_BCL2L1-01        --------------------------------gccccagaagggactgaa
E2IV76_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A2K6G3C5_BCL2L1-      --------------------------------gccccagaagcgactgaa
A0A2K6G3C5_BCL2L1-      --------------------------------gccccagaagcgactgaa
G1RER8_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A2J8VIH3_BCL2L1-      --------------------------------gccccagaagggactgaa
Q07817_BCL2L1-01        --------------------------------gccccagaagggactgaa
Q07817_BCL2L1-03        --------------------------------gccccagaagggactgaa
Q07817_BCL2L1-02        --------------------------------gccccagaagggactgaa
G3RY91_BCL2L1-02        --------------------------------gccccagaagggactgaa
G3RY91_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A2K5H963_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5H963_BCL2L1-      --------------------------------gccccagaagggactgaa
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5M8B1_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K6LPM4_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K6QFA2_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5VPG2_BCL2L1-      --------------------------------gccccagaagggactgaa
F6UKR4_BCL2L1-02        --------------------------------gccccagaagggactgaa
A0A2K5YR37_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5YR37_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5VPG2_BCL2L1-      --------------------------------gccccagaagggactgaa
F6UKR4_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A0D9RJZ8_BCL2L1-      --------------------------------gccccagaagggactgaa
I7GKS6_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A2K6LPM4_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K6QFA2_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K6QFA2_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K5YR37_BCL2L1-      --------------------------------gccccagaagggactgaa
A0A2K6UWY8_BCL2L1-      --------------------------------gccccagaagggactgat
E2IV77_BCL2L1-01        --------------------------------gccccagaagggactgat
A0A2K6UWY8_BCL2L1-      --------------------------------gccccagaagggactgat
A0A2K5EBP4_BCL2L1-      --------------------------------gccccagaagggactgat
E2IV75_BCL2L1-01        --------------------------------gccccagaagggactgat
F7IT34_BCL2L1-02        --------------------------------gccccagaagggactgat
F7IT34_BCL2L1-01        --------------------------------gccccagaagggactgat
A0A2K5EBP4_BCL2L1-      --------------------------------gccccagaagggactgat
M3Z2H9_BCL2L1-01        --------------------------------gccccagaagggactgaa
Q76LT7_BCL2L1-01        --------------------------------gccccagaagggactgaa
Q8SQ42_BCL2L1-01        --------------------------------gccccagaagggactgaa
M3XA94_BCL2L1-01        --------------------------------gccccagaagggactgaa
A0A452SDS4_BCL2L1-      --------------------------------gccccagaaggaactgaa
A0A384D3U1_BCL2L1-      --------------------------------gccccagaaggaactgaa
A0A452ILL8_BCL2L1-      --------------------------------tctgcagaagaggct---
A0A452ILL8_BCL2L1-      --------------------------------tctgcagaagaggct---
K7F655_BCL2L1-01        --------------------------------gctgcagaagaggcg---
U3JSL7_BCL2L1-01        --------------------------------tttgcaggggaggagga-
Q4U2V6_BCL2L1-01        --------------------------------tttgcaggggaggagga-
H0Z8G3_BCL2L1-01        --------------------------------tttgcaggggaggagga-
Q07816_BCL2L1-04        --------------------------------actgcagctgaggca---
Q07816_BCL2L1-03        --------------------------------actgcagctgaggca---
Q07816_BCL2L1-02        --------------------------------actgcagctgaggca---
Q07816_BCL2L1-01        --------------------------------actgcagctgaggca---
G1N5N5_BCL2L1-01        --------------------------------actgcagcagaggca---
H3ANS8_BCL2L1-01        gtggaggagaccgcgcgagggaagcacagactcccgaggagggggccatt
A0A3B5K6B9_BCL2L1-      --------------------------------------gggcag------
A0A3B5K6B9_BCL2L1-      --------------------------------------gggcag------
H3CH49_BCL2L1-01        --------------------------------------gggcag------
C1BLI0_BCL2L1-01        gac-----------------------------------------------
A0A3P8XFS0_BCL2L1-      gaagaggctactgcaaatgggt---------ctgtggggaacgg------
A0A3P8XFS0_BCL2L1-      gaagaggctactgcaaatgggt---------ctgtggggaacgg------
A0A286MU87_BCL2L1-      gatgaggccattgcaaatgggt---------ctgtggggaacta------
C0HAD8_BCL2L1-01        gatgacgccattgcaaatgggt---------ctgtgg-------------
A0A345BSW9_BCL2L1-      gccgaagagaatgg-------------------tgagggggcgg------
Q90Z98_BCL2L1-01        gctgaagagaatgg-------------------cgagggggcag------
Q90Z98_BCL2L1-02        gctgaagagaatgg-------------------cgagggggcag------
A0A059PJI5_BCL2L1-      ggaagagaacgcgg---------------------tgggagcgg------
A0A3B3ZN55_BCL2L1-      tgacacagagagagacagggac---------cttctgggactgg------
A0A3B3ZN55_BCL2L1-      --gcacacagagtgacacggag---------catcttggacttg------
D2ITA2_BCL2L1-02        -----------------------------------gaggacaag------
A0A3P8UWG7_BCL2L1-      gaa---gaggcagg--gttggg---------c---gcagagcag------
A0A3B3QRZ2_BCL2L1-      gggctcgggtcaggccgatggg---------cgcgagggggtta------
A0A3B1JJ42_BCL2L1-      ggccaggaagcgga--ggggaa---------t---gcagaggcg------
A0A3B4DTL9_BCL2L1-      ggtcaggcggcaga--ggagaa---------c---gcagagggg------
A0A3P8XYL5_BCL2L1-      gga---gaggtgga--ag-----------------aggtggcag------
B5XAY3_BCL2L1-01        gga---caggtgga--ag-----------------ggggtgcgg------
A0A3B3TFR4_BCL2L1-      ggg---gaggtgag--g------------------gcgaagcag------
A0A3Q3DUT7_BCL2L1-      agg---gaggaagc--ctcagg---------cgaggaggagcag------
A0A3Q3DUT7_BCL2L1-      agg---gaggaagc--ctcagg---------cgaggaggagcag------
A0A3Q3DUT7_BCL2L1-      agg---gaggaagc--ctcagg---------cgaggaggagcag------
W5MG74_BCL2L1-01        gct---gaggcggt--gggttc---------g---gggagcccg------
A0A3Q3WIW8_BCL2L1-      ggg---caggcagt--gtcaga---------t---gaggaacag------
A0A2U9BY16_BCL2L1-      ggg---gaggcagg--tttggg---------g---gaggaacag------
A0A3B5PQJ0_BCL2L1-      ggg---gacgtggg--gatgga---------c---gacgagcag------
A0A3P9N9Y4_BCL2L1-      ggg---gacggggg--gatgga---------c---gacgagcag------
A0A3B3WI27_BCL2L1-      ggg---gacgcggg--gatgga---------c---gacgagcag------
A0A087X9B7_BCL2L1-      ggg---gacgcggg--gatgga---------c---gacgagcag------
A0A3B3TUS7_BCL2L1-      ggg---gacgcggg--gatgga---------c---gacgagcag------
A0A3Q2FR43_BCL2L1-      cag---ggggcgga--gcagga---------c---gacgagcgt------
A0A3Q2QPL9_BCL2L1-      agg---gacgcaga--gtctga---------c---gaggagcag------
A0A3Q3B3X5_BCL2L1-      ggg---gatgcagg--gttgga---------g---gacgcagag------
A0A3Q0RTF8_BCL2L1-      ggg---gcagcagg--gttgga---------t---gaggaacag------
I3IZK7_BCL2L1-01        ggg---gcggcggg--gttgga---------t---gaggaacag------
A0A3Q4N4B5_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
A0A3Q2X557_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
A0A3P8P0F1_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
A0A3P9D632_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
A0A3P9D632_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
A0A3B4FNX1_BCL2L1-      ggg---gcagcggg--gttgga---------t---gaggaacag------
G3NJY1_BCL2L1-01        ggggtagaggcagg--ggcggc---------t---ggtgggcag------
A0A3B3IB64_BCL2L1-      ggg---gagg--------tggg---------c---gaggagcag------
A0A3P9JYH1_BCL2L1-      ggg---gagg--------tggg---------c---gaggagcag------
A0A3B3DHA1_BCL2L1-      ggg---gagg--------tggg---------c---gaggagcag------
C3VIT1_BCL2L1-01        ggg---gacggggg--tctggg---------c---gaggagcag------
A0A3B4Z3X2_BCL2L1-      ggg---gaggcgag--gttggc---------t---gaggaacag------
A0A3B4Z3X2_BCL2L1-      ggg---gaggcgag--gttggc---------t---gaggaacag------
A0A3Q1GS47_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaccag------
A0A3Q1GS47_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaccag------
A0A3Q1DHJ3_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaacag------
A0A3Q1DHJ3_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaacag------
A0A3Q1DHJ3_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaacag------
A0A3P8TL99_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaacag------
A0A3P8TL99_BCL2L1-      ggg---gaggcccg--gctggg---------a---gaggaacag------
A0A219P0Y3_BCL2L1-      ggg---gaggcagg--gttagg---------t---gaggagcag------
A0A3Q3G2E1_BCL2L1-      gcg---ggggcagg--gtcggg---------t---gaggaacag------
A0A3Q3G2E1_BCL2L1-      gcg---ggggcagg--gtcggg---------t---gaggaacag------
A0A3Q3G2E1_BCL2L1-      gcg---ggggcagg--gtcggg---------t---gaggaacag------
A0A3B4V3T1_BCL2L1-      ggg---gaggcagg--gttggt---------t---gaggaacag------
A0A3B4XU17_BCL2L1-      ggg---gaggcagg--gttggt---------t---gaggaacag------
A0A3Q3IVF5_BCL2L1-      gag---gag-----------------------------------------
A0A3Q3MX20_BCL2L1-      gga---gaggctga--gtcagg---------t---gaggaacag------
A0A3Q1GZ93_BCL2L1-      ggg---gaagatgg--gttgag---------t---gaggaacag------
A0A3Q1GZ93_BCL2L1-      ggg---gaagatgg--gttgag---------t---gaggaacag------
A0A3Q1GZ93_BCL2L1-      ggg---gaagatgg--gttgag---------t---gaggaacag------
A0A0D6DR75_BCL2L1-      ggg---gaggttga--gtccgc---------t---gaggaacag------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      aac-----------------------------------------------
A0A3P8VMA1_BCL2L1-      gag-----------------------------------------------
A0A0F7L1T6_BCL2L1-      gaa-----------------------------------------------
H2U5I3_BCL2L1-01        gaa-----------------------------------------------
H2U5I3_BCL2L1-02        gaa-----------------------------------------------
G3P7B4_BCL2L1-01        gac-----------------------------------------------
A0A3Q3FUB6_BCL2L1-      gac-----------------------------------------------
A0A3Q3X5M5_BCL2L1-      gac-----------------------------------------------
A0A2U9BIG9_BCL2L1-      gac-----------------------------------------------
A0A3Q1JZ46_BCL2L1-      gac-----------------------------------------------
A0A3Q1JZ46_BCL2L1-      gac-----------------------------------------------
A0A3Q3NFM4_BCL2L1-      gac-----------------------------------------------
A0A3Q3NFM4_BCL2L1-      gac-----------------------------------------------
A0A3Q3J5K3_BCL2L1-      gac-----------------------------------------------
A0A3B4V9K8_BCL2L1-      gac-----------------------------------------------
A0A3B4XS24_BCL2L1-      gac-----------------------------------------------
A0A3B5B4X7_BCL2L1-      gac-----------------------------------------------
A0A3Q1EVP6_BCL2L1-      gac-----------------------------------------------
A0A3Q1BQA0_BCL2L1-      gac-----------------------------------------------
A0A3P8U812_BCL2L1-      gac-----------------------------------------------
E6ZFR0_BCL2L1-01        gac-----------------------------------------------
A0A0B4KJI5_BCL2L1-      gac-----------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      gac-----------------------------------------------
A0A3Q2NRP4_BCL2L1-      gac-----------------------------------------------
A0A3B5MGS2_BCL2L1-      gaa-----------------------------------------------
M4A558_BCL2L1-01        gaa-----------------------------------------------
A0A3P9QFB3_BCL2L1-      gac-----------------------------------------------
A0A3B3XN57_BCL2L1-      gac-----------------------------------------------
A0A087YBW4_BCL2L1-      gat-----------------------------------------------
A0A3B3VWI7_BCL2L1-      gat-----------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------atgggacaactg
A0A346RRN1_BCL2L1-      --------------------------------------atgggaaaactg
Q6GLI5_BCL2L1-01        ---------------cccaagggcgtgtcta-------atggaa------
Q2TAP5_BCL2L1-01        ---------------cccaatgccatatcta-------atggaa------
Q91828_BCL2L1-01        ---------------cccaatgccatatcta-------atggaa------
H9GHK7_BCL2L1-01        ccagcaaacgagacggggaacaccct---ca-------atggga------
F6WA14_BCL2L1-01        --------agagatacctagtactgt---ga-------atggca------
G3WKX6_BCL2L1-01        --------agagatacctagtactgt---ga-------atggca------
A0A452FIG6_BCL2L1-      tcagatatggaaa-ccccaatgccgt---ca-------atgcca------
A0A452FIG6_BCL2L1-      tcagatatggaaa-ccccaatgccgt---ca-------atgcca------
A0A3Q1LRT3_BCL2L1-      tcagatatggaaacccccagtg-gat---ca-------gtggca------
A0A452E1B1_BCL2L1-      tcagatatggaaacccccagcgccat---ca-------gtggca------
W5PSA5_BCL2L1-01        tcagatatggaaacccccagtgccat---ca-------gtggca------
G3SPN0_BCL2L1-01        tccgagatggagatccccagtgccat---ca-------atggca------
H0X6V2_BCL2L1-01        tcagagctggagacccccagtgccat---ta-------atggca------
P53563_BCL2L1-03        ccagaaagggagacccccagtgccat---ca-------atggca------
P53563_BCL2L1-02        ccagaaagggagacccccagtgccat---ca-------atggca------
P53563_BCL2L1-04        ccagaaagggagacccccagtgccat---ca-------atggca------
P53563_BCL2L1-01        ccagaaagggagacccccagtgccat---ca-------atggca------
O35843_BCL2L1-01        gcagagagggagacccccagtgccat---ca-------atggca------
Q64373_BCL2L1-09        gcagagagggagacccccagtgccat---ca-------atggca------
Q64373_BCL2L1-01        gcagagagggagacccccagtgccat---ca-------atggca------
Q64373_BCL2L1-03        gcagagagggagacccccagtgccat---ca-------atggca------
Q64373_BCL2L1-04        gcagagagggagacccccagtgccat---ca-------atggca------
B2Z3Z4_BCL2L1-01        tcagagagggagacccccagtgccat---ca-------atggca------
Q9MYW4_BCL2L1-01        ccagagatggagacccccagtgccat---ca-------atggca------
O77737_BCL2L1-01        tcagaagcggaaacccctagtgccat---ca-------atggca------
A0A286Y5D6_BCL2L1-      tcagagatggagacccccagtgccat---ca-------atggca------
G1P9D2_BCL2L1-01        tcagaggtggagacccccagtgccat---ca-------atggca------
Q05KJ0_BCL2L1-02        tcagatatggaaacccccagtgccat---ca-------atggca------
Q05KJ0_BCL2L1-01        tcagatatggaaacccccagtgccat---ca-------atggca------
A0A452FWV3_BCL2L1-      tcagatatggaaacccccagtgccat---ca-------atggca------
Q9MZS7_BCL2L1-01        tcagatatggaaacccccagtgccat---ca-------atggca------
F6WQI0_BCL2L1-02        tcagagatggagacccccagtgccat---ca-------atggca------
A0A2U3V0P1_BCL2L1-      tcagacatggaaacacccagtgccat---ca-------atggca------
A0A1L5BWY3_BCL2L1-      tcagaggtggagacccccagtgccat---ca-------atggca------
A0A287CZ07_BCL2L1-      tcagaggtggagacccccagtgccat---ca-------atggca------
I3MUP5_BCL2L1-01        tcagaggtggagacccccagtgccat---ca-------atggca------
I3MUP5_BCL2L1-02        tcagaggtggagacccccagtgccat---ca-------atggca------
I3MUP5_BCL2L1-03        tcagaggtggagacccccagtgccat---ca-------atggca------
F6WQI0_BCL2L1-01        tcagagatggagacccccagtgccat---ca-------atggca------
E2IV76_BCL2L1-01        tcggagatggaaacccccagtgccat---ta-------atggca------
A0A2K6G3C5_BCL2L1-      tcggagatggagacccccagtgccat---ta-------atggca------
A0A2K6G3C5_BCL2L1-      tcggagatggagacccccagtgccat---ta-------atggca------
G1RER8_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2J8VIH3_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
Q07817_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
Q07817_BCL2L1-03        tcggagatggagacccccagtgccat---ca-------atggca------
Q07817_BCL2L1-02        tcggagatggagacccccagtgccat---ca-------atggca------
G3RY91_BCL2L1-02        tcggagatggagacccccagtgccat---ca-------atggca------
G3RY91_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5H963_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5H963_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
Q2PFS6_BCL2L1-01        ------atggagacccccagtgccat---ca-------atggca------
A0A2K5M8B1_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5M8B1_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6LPM4_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6QFA2_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5VPG2_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
F6UKR4_BCL2L1-02        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5YR37_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5YR37_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5VPG2_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
F6UKR4_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A0D9RJZ8_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
I7GKS6_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6LPM4_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6QFA2_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6QFA2_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5YR37_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6UWY8_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
E2IV77_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K6UWY8_BCL2L1-      tcggagatggagacccccagtgccat---ca-------at----------
A0A2K5EBP4_BCL2L1-      tcggagatggagacccccagtgccat---ca-------atggca------
E2IV75_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
F7IT34_BCL2L1-02        tcggagatggagacccccagtgccat---ca-------atggca------
F7IT34_BCL2L1-01        tcggagatggagacccccagtgccat---ca-------atggca------
A0A2K5EBP4_BCL2L1-      tcggagatggagacccccagtgccat---ca-------at----------
M3Z2H9_BCL2L1-01        tcagagatggagacccccagtgccat---ca-------atggca------
Q76LT7_BCL2L1-01        tcagagatggagacccccagtgccat---ca-------atggca------
Q8SQ42_BCL2L1-01        tcagagatggagacccccagtgccat---ca-------atggca------
M3XA94_BCL2L1-01        tcagagatggagacccccagtgccat---ca-------atggca------
A0A452SDS4_BCL2L1-      tcagagatggagacccccagtgccat---ca-------atggca------
A0A384D3U1_BCL2L1-      tcagagatggagacccccagtgccat---ca-------atggca------
A0A452ILL8_BCL2L1-      ---gagatggc------aagtgtccc---ta-------atggga------
A0A452ILL8_BCL2L1-      ---gagatggc------aagtgtccc---ta-------atggga------
K7F655_BCL2L1-01        ---gagatggc------aagcgtccc---ta-------atggga------
U3JSL7_BCL2L1-01        --cgagatgga------cggcgtgct---ca-------acggaa------
Q4U2V6_BCL2L1-01        --cgagatgga------cggggtcct---ca-------acggga------
H0Z8G3_BCL2L1-01        --cgagatgga------cggggtcct---ca-------acggga------
Q07816_BCL2L1-04        ---gagatgga------cagcgtcct---ca-------atggga------
Q07816_BCL2L1-03        ---gagatgga------cagcgtcct---ca-------atggga------
Q07816_BCL2L1-02        ---gagatgga------cagcgtcct---ca-------atggga------
Q07816_BCL2L1-01        ---gagatgga------cagcgtcct---ca-------atggga------
G1N5N5_BCL2L1-01        ---gagatgga------cagcgtcct---ca-------atggga------
H3ANS8_BCL2L1-01        ccaggca--tggacccacccaacggcagccaccctcatgcaggac-----
A0A3B5K6B9_BCL2L1-      -tttgta--actactcagtt---------ca-------atggaac-----
A0A3B5K6B9_BCL2L1-      -tttgta--actactcagtt---------ca-------atggaac-----
H3CH49_BCL2L1-01        -tttgga--accacccagtc---------ca-------atggaac-----
C1BLI0_BCL2L1-01        ---------aagaccaatgtctccccagtta-------atggatc-----
A0A3P8XFS0_BCL2L1-      -caggaa----------------------ca-------gcagacg-----
A0A3P8XFS0_BCL2L1-      -caggaa----------------------ca-------gcagacg-----
A0A286MU87_BCL2L1-      -ccggaa----------------------ca-------gcagaag-----
C0HAD8_BCL2L1-01        ---ggaa----------------------ca-------gcagaag-----
A0A345BSW9_BCL2L1-      -caggaacgacgaccctcgt---------ta-------acggctc-----
Q90Z98_BCL2L1-01        -caggagcgacaactcttgt---------ta-------atggcac-----
Q90Z98_BCL2L1-02        -caggagcgacaactcttgt---------ta-------atggcac-----
A0A059PJI5_BCL2L1-      -gagagtcggagacgccgacagcagtcgtta-------atggcac-----
A0A3B3ZN55_BCL2L1-      -gggaca--ggagcgtggac-------------------aggaac-----
A0A3B3ZN55_BCL2L1-      -gggata--ggggcgtagac-------------------agg-gc-----
D2ITA2_BCL2L1-02        -tc--------------------------ca-------acaggat-----
A0A3P8UWG7_BCL2L1-      -cggaca--agtacgcacgc---------ca-------acgggac-----
A0A3B3QRZ2_BCL2L1-      -tggtaacagcaactcatgt---------ca-------atgggtc-----
A0A3B1JJ42_BCL2L1-      -gccggg--gtgactcccaccgcagtcgtta-------acgggtc-----
A0A3B4DTL9_BCL2L1-      -gcggcg--gtgacgcccacggcagttgtca-------acggatc-----
A0A3P8XYL5_BCL2L1-      -cagtca---ccatgcaccc---------ca-------atggcac-----
B5XAY3_BCL2L1-01        -cagtcc---taacatacgt---------c--------------------
A0A3B3TFR4_BCL2L1-      -caggcgctgtggctcatgc---------ca-------atggatc-----
A0A3Q3DUT7_BCL2L1-      -cgggta--cagacgcctgc---------ca-------atgggac-----
A0A3Q3DUT7_BCL2L1-      -cgggta--cagacgcctgc---------ca-------atgggac-----
A0A3Q3DUT7_BCL2L1-      -cgggta--cagacgcctgc---------ca-------atgggac-----
W5MG74_BCL2L1-01        -aacgca--gaggagcgtac---------ga-------acggcgc-----
A0A3Q3WIW8_BCL2L1-      -cgggta--gcgacacacgc---------ca-------atgggac-----
A0A2U9BY16_BCL2L1-      -cagaca--gcgccgcatgc---------ca-------acggaac-----
A0A3B5PQJ0_BCL2L1-      -acgtta--gagacacacgc---------ta-------atgggac-----
A0A3P9N9Y4_BCL2L1-      -acgttg--gagacgcacgc---------ta-------atgggac-----
A0A3B3WI27_BCL2L1-      -acgttg--gagacgcacgc---------ta-------atgggac-----
A0A087X9B7_BCL2L1-      -acgttg--gagacgcacgc---------ta-------atgggac-----
A0A3B3TUS7_BCL2L1-      -acgttg--gagacgcacgc---------ta-------atgggac-----
A0A3Q2FR43_BCL2L1-      -acgccg--gagacgcacgc---------ta-------acgggac-----
A0A3Q2QPL9_BCL2L1-      -acggcg--gagacgcacgc---------ca-------acgggac-----
A0A3Q3B3X5_BCL2L1-      -atgaca--gagacacacgc---------ca-------atgggac-----
A0A3Q0RTF8_BCL2L1-      -cgaata--gatacacacgc---------ca-------atgggac-----
I3IZK7_BCL2L1-01        -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3Q4N4B5_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3Q2X557_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3P8P0F1_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3P9D632_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3P9D632_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
A0A3B4FNX1_BCL2L1-      -cgaata--gacacacacgc---------ca-------atgggac-----
G3NJY1_BCL2L1-01        -cgggga--gcgacgcactc---------ca-------acgggac-----
A0A3B3IB64_BCL2L1-      -agcacg--gagacgcacgc---------ca-------acgggac-----
A0A3P9JYH1_BCL2L1-      -agcacg--gagacgcacgc---------ca-------acgggac-----
A0A3B3DHA1_BCL2L1-      -agcaca--gagacgcacgc---------ca-------acgggac-----
C3VIT1_BCL2L1-01        -agcaca--gagacgcacgc---------ca-------acgggac-----
A0A3B4Z3X2_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3B4Z3X2_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3Q1GS47_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3Q1GS47_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3Q1DHJ3_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3Q1DHJ3_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3Q1DHJ3_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3P8TL99_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A3P8TL99_BCL2L1-      -cggaca--gagacacacgc---------ca-------acgggac-----
A0A219P0Y3_BCL2L1-      -cgggta--gcgacacacgc---------ca-------acgggac-----
A0A3Q3G2E1_BCL2L1-      -caggta--gcgacgcacgc---------ca-------acgggac-----
A0A3Q3G2E1_BCL2L1-      -caggta--gcgacgcacgc---------ca-------acgggac-----
A0A3Q3G2E1_BCL2L1-      -caggta--gcgacgcacgc---------ca-------acgggac-----
A0A3B4V3T1_BCL2L1-      -cggata--gcgacgcacgc---------ca-------atggaac-----
A0A3B4XU17_BCL2L1-      -cggata--gcgacgcacgc---------ca-------atggaac-----
A0A3Q3IVF5_BCL2L1-      ---------gcaacgcacgc---------ca-------atgggac-----
A0A3Q3MX20_BCL2L1-      -cggata--gcaacgcatgc---------ca-------acgggac-----
A0A3Q1GZ93_BCL2L1-      -cggata--gcaacgcacgc---------ca-------acgggac-----
A0A3Q1GZ93_BCL2L1-      -cggata--gcaacgcacgc---------ca-------acgggac-----
A0A3Q1GZ93_BCL2L1-      -cggata--gcaacgcacgc---------ca-------acgggac-----
A0A0D6DR75_BCL2L1-      -cggata--gcgacgcacgc---------ca-------acggtac-----
A0A3B3E2W4_BCL2L1-      ----------aggaccgctctgctacctgca-------acggcac-----
A0A3B3ICL7_BCL2L1-      ----------aggaccactccgatgcccgga-------atcgcag-----
A0A3B3ICL7_BCL2L1-      ----------aggaccactccgatgcccgga-------atcgcag-----
A0A3B4BFZ8_BCL2L1-      ---------aagg-cagctaatgtcccg--a-------atggtat-----
A0A3P8VMA1_BCL2L1-      ---------gaggtcaccacagcgtccagta-------atggcgttcctc
A0A0F7L1T6_BCL2L1-      ---------aagaggagccccgctgcttcca-------atggcct-----
H2U5I3_BCL2L1-01        ---------aagaggagccccggtgcttcca-------atggcct-----
H2U5I3_BCL2L1-02        ---------aagaggagccccggtgcttcca-------atggcct-----
G3P7B4_BCL2L1-01        ---------aaggccaactcggcgtccg---------------tt-----
A0A3Q3FUB6_BCL2L1-      ---------atggaaaactctgctgccagta-------atggctt-----
A0A3Q3X5M5_BCL2L1-      ---------aaggccagctctgctgccagaa-------atggctt-----
A0A2U9BIG9_BCL2L1-      ---------aaggccaactcagctgccagca-------atggctt-----
A0A3Q1JZ46_BCL2L1-      ---------agacccaactcagcagctgcta-------acggcct-----
A0A3Q1JZ46_BCL2L1-      ---------agacccaactcagcagctgcta-------acggcct-----
A0A3Q3NFM4_BCL2L1-      ---------atgaccggtgcagctgccacca-------acggctt-----
A0A3Q3NFM4_BCL2L1-      ---------atgaccggtgcagctgccacca-------acggctt-----
A0A3Q3J5K3_BCL2L1-      ---------aggaccaacccagctaccacta-------acggcct-----
A0A3B4V9K8_BCL2L1-      ---------aaggccaactcagctgccagta-------atggctt-----
A0A3B4XS24_BCL2L1-      ---------aaggccagctcagctgccagta-------atggctt-----
A0A3B5B4X7_BCL2L1-      ---------aagaccaactctgctgccagta-------acggctt-----
A0A3Q1EVP6_BCL2L1-      ---------aaggccagctcagcctccagta-------acggctt-----
A0A3Q1BQA0_BCL2L1-      ---------aaggccaactcagcttccagta-------atggctt-----
A0A3P8U812_BCL2L1-      ---------aaggccaactcagcttccagta-------acggctt-----
E6ZFR0_BCL2L1-01        ---------aaggccaactcagctgccagaa-------acggctt-----
A0A0B4KJI5_BCL2L1-      ---------aaagccaactcagctgccacaa-------atggcct-----
A0A3Q3BEB7_BCL2L1-      ---------aaggccagctcggctcccagta-------acggctt-----
A0A3Q2C6K4_BCL2L1-      ---------aaggacgcctcggcttccagca-------atggccc-----
A0A3Q2NRP4_BCL2L1-      ---------aaggactccccggcttctagca-------atggccc-----
A0A3B5MGS2_BCL2L1-      ---------ggggacagccgggtccctcgca-------atggccc-----
M4A558_BCL2L1-01        ---------ggggacagccgggtccctagca-------atggccg-----
A0A3P9QFB3_BCL2L1-      ---------ggggacagccggggccctagca-------atggccc-----
A0A3B3XN57_BCL2L1-      ---------ggggacagccggggccctagca-------atggccc-----
A0A087YBW4_BCL2L1-      ---------ggggacagccggggccctagca-------atggtcc-----
A0A3B3VWI7_BCL2L1-      ---------ggggacagccggggccctagca-------atggtcc-----
                                                                          

R4JQR8_BCL2L1-01        ---------------------------------tcctacgttagactt--
A0A346RRN1_BCL2L1-      ---------------------------------tccctcgttggaagt--
Q6GLI5_BCL2L1-01        ----------------------------------------gt--------
Q2TAP5_BCL2L1-01        ----------------------------------cttctact--------
Q91828_BCL2L1-01        ---------------------------------ccttctact--------
H9GHK7_BCL2L1-01        ---------------------------------gcccttcttggcatc--
F6WA14_BCL2L1-01        ---------------------------------gtccctcttggcacc--
G3WKX6_BCL2L1-01        ---------------------------------gcccctcttggcacc--
A0A452FIG6_BCL2L1-      ---------------------------------acccatcttggcacc--
A0A452FIG6_BCL2L1-      ---------------------------------acccatcttggcacc--
A0A3Q1LRT3_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A452E1B1_BCL2L1-      ---------------------------------acccatcctggcacc--
W5PSA5_BCL2L1-01        ---------------------------------acccatcctggcacc--
G3SPN0_BCL2L1-01        ---------------------------------acccatcccggcacc--
H0X6V2_BCL2L1-01        ---------------------------------acccatcctggcacc--
P53563_BCL2L1-03        ---------------------------------acccatcctggcacc--
P53563_BCL2L1-02        ---------------------------------acccatcctggcacc--
P53563_BCL2L1-04        ---------------------------------acccatcctggcacc--
P53563_BCL2L1-01        ---------------------------------acccatcctggcacc--
O35843_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q64373_BCL2L1-09        ---------------------------------acccatcctggcacc--
Q64373_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q64373_BCL2L1-03        ---------------------------------acccatcctggcacc--
Q64373_BCL2L1-04        ---------------------------------acccatcctggcacc--
B2Z3Z4_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q9MYW4_BCL2L1-01        ---------------------------------acccagcctggcacc--
O77737_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A286Y5D6_BCL2L1-      ---------------------------------acccatcctggcacc--
G1P9D2_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q05KJ0_BCL2L1-02        ---------------------------------acgcatcctggcacc--
Q05KJ0_BCL2L1-01        ---------------------------------acgcatcctggcacc--
A0A452FWV3_BCL2L1-      ---------------------------------acccatcttggcacc--
Q9MZS7_BCL2L1-01        ---------------------------------acccatcttggcacc--
F6WQI0_BCL2L1-02        ---------------------------------acccatcctggcacc--
A0A2U3V0P1_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A1L5BWY3_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A287CZ07_BCL2L1-      ---------------------------------acccatcctggcatc--
I3MUP5_BCL2L1-01        ---------------------------------acccatcctggcatc--
I3MUP5_BCL2L1-02        ---------------------------------acccatcctggcatc--
I3MUP5_BCL2L1-03        ---------------------------------acccatcctggcatc--
F6WQI0_BCL2L1-01        ---------------------------------acccatcctggcacc--
E2IV76_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A2K6G3C5_BCL2L1-      ---------------------------------acccatcct--------
A0A2K6G3C5_BCL2L1-      ---------------------------------acccatcctggcacc--
G1RER8_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A2J8VIH3_BCL2L1-      ---------------------------------acccatcctggcacc--
Q07817_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q07817_BCL2L1-03        ---------------------------------acccatcctggcacc--
Q07817_BCL2L1-02        ---------------------------------acccatcctggcacc--
G3RY91_BCL2L1-02        ---------------------------------acccatcct--------
G3RY91_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A2K5H963_BCL2L1-      ---------------------------------acccatcct--------
A0A2K5H963_BCL2L1-      ---------------------------------acccatcctggcacc--
Q2PFS6_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A2K5M8B1_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K5M8B1_BCL2L1-      ---------------------------------acccatcct--------
A0A2K6LPM4_BCL2L1-      ---------------------------------acccatcctgg------
A0A2K6QFA2_BCL2L1-      ---------------------------------acccatcctgg------
A0A2K5VPG2_BCL2L1-      ---------------------------------acccatcctgg------
F6UKR4_BCL2L1-02        ---------------------------------acccatcctgg------
A0A2K5YR37_BCL2L1-      ---------------------------------acccatcctgg------
A0A2K5YR37_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K5VPG2_BCL2L1-      ---------------------------------acccatcctggcacc--
F6UKR4_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A0D9RJZ8_BCL2L1-      ---------------------------------acccatcctggcacc--
I7GKS6_BCL2L1-01        ---------------------------------acccatcctgg------
A0A2K6LPM4_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K6QFA2_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K6QFA2_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K5YR37_BCL2L1-      ---------------------------------acccatcctggcacc--
A0A2K6UWY8_BCL2L1-      ---------------------------------acccagcctggcacc--
E2IV77_BCL2L1-01        ---------------------------------acccagcctggcacc--
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ---------------------------------acccatcctggcacc--
E2IV75_BCL2L1-01        ---------------------------------acccatcctggcacc--
F7IT34_BCL2L1-02        ---------------------------------acccatcctggcacc--
F7IT34_BCL2L1-01        ---------------------------------acccatcctggcacc--
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        ---------------------------------acccatcctggcacc--
Q76LT7_BCL2L1-01        ---------------------------------acccatcctggcact--
Q8SQ42_BCL2L1-01        ---------------------------------acccatcctggcact--
M3XA94_BCL2L1-01        ---------------------------------acccatcctggcact--
A0A452SDS4_BCL2L1-      ---------------------------------acccatcctggcact--
A0A384D3U1_BCL2L1-      ---------------------------------acccatcctggcact--
A0A452ILL8_BCL2L1-      ---------------------------------gtccatcctggcatc--
A0A452ILL8_BCL2L1-      ---------------------------------gtccatcctggcatc--
K7F655_BCL2L1-01        ---------------------------------gtccatcctggcatc--
U3JSL7_BCL2L1-01        ---------------------------------gcccctcctggcacg--
Q4U2V6_BCL2L1-01        ---------------------------------gcccctcctggcacg--
H0Z8G3_BCL2L1-01        ---------------------------------gcccctcctggcacg--
Q07816_BCL2L1-04        ---------------------------------gcccatcctggcacc--
Q07816_BCL2L1-03        ---------------------------------gcccatcctggcacc--
Q07816_BCL2L1-02        ---------------------------------gcccatcctggcacc--
Q07816_BCL2L1-01        ---------------------------------gcccatcctggcacc--
G1N5N5_BCL2L1-01        ---------------------------------gcccatcctggcacc--
H3ANS8_BCL2L1-01        -----------tc--------------------------aatggtgcg--
A0A3B5K6B9_BCL2L1-      -----------t---------------------ttt---aatggtgca--
A0A3B5K6B9_BCL2L1-      -----------t---------------------ttt---aatggtgca--
H3CH49_BCL2L1-01        -----------t---------------------ttt---aatggggca--
C1BLI0_BCL2L1-01        -----------t---------------------gttgaaaatgaccga--
A0A3P8XFS0_BCL2L1-      -----------c--------------------------------------
A0A3P8XFS0_BCL2L1-      -----------c--------------------------------------
A0A286MU87_BCL2L1-      -----------c--------------------------------------
C0HAD8_BCL2L1-01        -----------c--------------------------------------
A0A345BSW9_BCL2L1-      -----------c---------------------atg---aacaga-----
Q90Z98_BCL2L1-01        -----------c---------------------atg---aatagaacgaa
Q90Z98_BCL2L1-02        -----------c---------------------atg---aatagaacgaa
A0A059PJI5_BCL2L1-      -----------c---------------------cta---aacgggacc--
A0A3B3ZN55_BCL2L1-      -----------tccacccc---------ctcactta---g----------
A0A3B3ZN55_BCL2L1-      -----------tcggctgcagagagaaacagaggtg---gacagtacg--
D2ITA2_BCL2L1-02        -----------t---------------------ggt---aata--atg--
A0A3P8UWG7_BCL2L1-      -----------t---------------------gta---aacggcaca--
A0A3B3QRZ2_BCL2L1-      -----------g---------------------gtc---attgctggc--
A0A3B1JJ42_BCL2L1-      -----------c---------------------gta---aatgggacg--
A0A3B4DTL9_BCL2L1-      -----------c---------------------gta---aatgggaca--
A0A3P8XYL5_BCL2L1-      -----------a---------------------atg---aatgggacg--
B5XAY3_BCL2L1-01        ---------------------------------------aacgggacg--
A0A3B3TFR4_BCL2L1-      -----------g---------------------gtc---agtagcggg--
A0A3Q3DUT7_BCL2L1-      -----------g---------------------acc---aacggcacc--
A0A3Q3DUT7_BCL2L1-      -----------g---------------------acc---aacggcacc--
A0A3Q3DUT7_BCL2L1-      -----------g---------------------acc---aacggcacc--
W5MG74_BCL2L1-01        -----------g---------------------gcc---aatggcggg--
A0A3Q3WIW8_BCL2L1-      -----------t---------------------ttt---aacggtacg--
A0A2U9BY16_BCL2L1-      -----------t---------------------cta---aacggcgtg--
A0A3B5PQJ0_BCL2L1-      -----------t---------------------ttt---aacgggacg--
A0A3P9N9Y4_BCL2L1-      -----------t---------------------ttt---aacgggaca--
A0A3B3WI27_BCL2L1-      -----------t---------------------ttt---aacgggaca--
A0A087X9B7_BCL2L1-      -----------t---------------------ttt---aacgggaca--
A0A3B3TUS7_BCL2L1-      -----------t---------------------ttt---aacgggaca--
A0A3Q2FR43_BCL2L1-      -----------t---------------------ttt---aacgggacc--
A0A3Q2QPL9_BCL2L1-      -----------c---------------------gtc---aacgggacc--
A0A3Q3B3X5_BCL2L1-      -----------t---------------------ttt---aacgggact--
A0A3Q0RTF8_BCL2L1-      -----------t---------------------ttt---aatggcaca--
I3IZK7_BCL2L1-01        -----------t---------------------ttt---aatggcacg--
A0A3Q4N4B5_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3Q2X557_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3P8P0F1_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3P9D632_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3P9D632_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3B4FNX1_BCL2L1-      -----------t---------------------ttt---aatggcacc--
G3NJY1_BCL2L1-01        -----------t---------------------ttc---aacggcacg--
A0A3B3IB64_BCL2L1-      -----------g---------------------ttt---aacgggaca--
A0A3P9JYH1_BCL2L1-      -----------g---------------------ttt---aacgggaca--
A0A3B3DHA1_BCL2L1-      -----------g---------------------ttt---aacgggacg--
C3VIT1_BCL2L1-01        -----------t---------------------ttt---accgggacc--
A0A3B4Z3X2_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3B4Z3X2_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3Q1GS47_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q1GS47_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q1DHJ3_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q1DHJ3_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q1DHJ3_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3P8TL99_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3P8TL99_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A219P0Y3_BCL2L1-      -----------t---------------------ttt---aatggcatg--
A0A3Q3G2E1_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q3G2E1_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3Q3G2E1_BCL2L1-      -----------t---------------------ttt---aacggcacg--
A0A3B4V3T1_BCL2L1-      -----------t---------------------ttt---aatggcaca--
A0A3B4XU17_BCL2L1-      -----------t---------------------ttt---aatggcacg--
A0A3Q3IVF5_BCL2L1-      -----------t---------------------ttt---aacggcacc--
A0A3Q3MX20_BCL2L1-      -----------t---------------------ttt---aatggcaca--
A0A3Q1GZ93_BCL2L1-      -----------t---------------------ttt---aatggtaga--
A0A3Q1GZ93_BCL2L1-      -----------t---------------------ttt---aatggtaga--
A0A3Q1GZ93_BCL2L1-      -----------t---------------------ttt---aatggtaga--
A0A0D6DR75_BCL2L1-      -----------t---------------------ttt---aacggaaga--
A0A3B3E2W4_BCL2L1-      -----------a---------------------ctggtcaacagcg----
A0A3B3ICL7_BCL2L1-      -----------g---------------------ctggtcagcagtg----
A0A3B3ICL7_BCL2L1-      -----------g---------------------ctggtcagcagtg----
A0A3B4BFZ8_BCL2L1-      -----------g---------------------ctaacaaaccgga----
A0A3P8VMA1_BCL2L1-      agactccttcag---------------------ctgtgctgcagcact--
A0A0F7L1T6_BCL2L1-      -----------g---------------------ctggtccgcagcagg--
H2U5I3_BCL2L1-01        -----------g---------------------ctggtccgcagcagg--
H2U5I3_BCL2L1-02        -----------g---------------------ctggtccgcagcagg--
G3P7B4_BCL2L1-01        -----------c---------------------ctggac----gcggg--
A0A3Q3FUB6_BCL2L1-      -----------t---------------------ttggtcaacagcagg--
A0A3Q3X5M5_BCL2L1-      -----------g---------------------ctggtcaacagcagt--
A0A2U9BIG9_BCL2L1-      -----------g---------------------ttggtcgacggcggc--
A0A3Q1JZ46_BCL2L1-      -----------g---------------------ccggtcagcaggagt--
A0A3Q1JZ46_BCL2L1-      -----------g---------------------ccggtcagcaggagt--
A0A3Q3NFM4_BCL2L1-      -----------g---------------------ctggtcaacagcagg--
A0A3Q3NFM4_BCL2L1-      -----------g---------------------ctggtcaacagcagg--
A0A3Q3J5K3_BCL2L1-      -----------t--------------------------------------
A0A3B4V9K8_BCL2L1-      -----------g---------------------ttggtcaacagcagt--
A0A3B4XS24_BCL2L1-      -----------g---------------------ttggtcaacagcagt--
A0A3B5B4X7_BCL2L1-      -----------g---------------------ctggtgaacagca----
A0A3Q1EVP6_BCL2L1-      -----------g---------------------ctggtgaacaaca----
A0A3Q1BQA0_BCL2L1-      -----------g---------------------ctggtgaacagca----
A0A3P8U812_BCL2L1-      -----------g---------------------ctggtgaacagca----
E6ZFR0_BCL2L1-01        -----------g---------------------ctggccagcaagaac--
A0A0B4KJI5_BCL2L1-      -----------g---------------------ctggccaacagcagc--
A0A3Q3BEB7_BCL2L1-      -----------g---------------------ctggtcaacagta----
A0A3Q2C6K4_BCL2L1-      -----------a---------------------cttttcaacagca----
A0A3Q2NRP4_BCL2L1-      -----------t---------------------ctggtcagcagct----
A0A3B5MGS2_BCL2L1-      -----------g---------------------ctggtcaacagct----
M4A558_BCL2L1-01        -----------g---------------------ctggtcaacagcc----
A0A3P9QFB3_BCL2L1-      -----------g---------------------ctggtcaacagcc----
A0A3B3XN57_BCL2L1-      -----------g---------------------ctggtcaacagct----
A0A087YBW4_BCL2L1-      -----------g---------------------ctggtcaacagct----
A0A3B3VWI7_BCL2L1-      -----------g---------------------ctggtcaacagct----
                                                                          

R4JQR8_BCL2L1-01        ------------------------------gccaccatcaca--------
A0A346RRN1_BCL2L1-      ------------------------------cccaccttcaca--------
Q6GLI5_BCL2L1-01        ------tcggagggcccc---------ggggcca-----cac--------
Q2TAP5_BCL2L1-01        ------tcagagcgccccgggg---aaggggcca-----cgc--------
Q91828_BCL2L1-01        ------tcagagcgccccgggg---aaggggcca-----cgc--------
H9GHK7_BCL2L1-01        ----ccagccccagccatgtcatcaatggggcctcagaacac--------
F6WA14_BCL2L1-01        ----ctgctgacagccgtgctgtgagtggggccacagggcac--------
G3WKX6_BCL2L1-01        ----ctgctgacagccgtgcagtgagtggggccacaggacac--------
A0A452FIG6_BCL2L1-      ----tggcgcatagccctgcggtgaatggagccactggccac--------
A0A452FIG6_BCL2L1-      ----tggcgcatagccctgcggtgaatggagccactggccac--------
A0A3Q1LRT3_BCL2L1-      ----tggcagatagccccacagtgaatggagccactggccac--------
A0A452E1B1_BCL2L1-      ----tggcagatagctctgtggtgaatggagccactggtcac--------
W5PSA5_BCL2L1-01        ----tggcagatagccctgtggtgaatggagccactggtcac--------
G3SPN0_BCL2L1-01        ----tggcagacagccctgcggtgaatggagctactggccac--------
H0X6V2_BCL2L1-01        ----tggctgacagccccacggtgaatggagccactggccac--------
P53563_BCL2L1-03        ----tggcggatagccccgcggtgaatggagccactggccac--------
P53563_BCL2L1-02        ----tggcggatagccccgcggtgaatggagccactggccac--------
P53563_BCL2L1-04        ----tggcggatagccccgcggtgaatggagccactggccac--------
P53563_BCL2L1-01        ----tggcggatagccccgcggtgaatggagccactggccac--------
O35843_BCL2L1-01        ----tggcggatagcccggccgtgaatggagccactggccac--------
Q64373_BCL2L1-09        ----tggcggatagcccggccgtgaatggagccactggccac--------
Q64373_BCL2L1-01        ----tggcggatagcccggccgtgaatggagccactggccac--------
Q64373_BCL2L1-03        ----tggcggatagcccggccgtgaatggagccactggccac--------
Q64373_BCL2L1-04        ----tggcggatagcccggccgtgaatggagccactggccac--------
B2Z3Z4_BCL2L1-01        ----tggcggacagccccgcggtaaatggagccactggccac--------
Q9MYW4_BCL2L1-01        ----cggcggacagccccgcggtgaacggagccactggccac--------
O77737_BCL2L1-01        ----tggcggacagccccgcggtgaatggagccactggccac--------
A0A286Y5D6_BCL2L1-      ----taactgatagtcccacggtgaatggggccactggccac--------
G1P9D2_BCL2L1-01        ----tggtggacagccctgcggtgaatggagccactggccac--------
Q05KJ0_BCL2L1-02        ----tggcggatagccctgctgtgaatggagccactggccac--------
Q05KJ0_BCL2L1-01        ----tggcggatagccctgctgtgaatggagccactggccac--------
A0A452FWV3_BCL2L1-      ----tggcggatagccctgcggtgaatggagccaccggccac--------
Q9MZS7_BCL2L1-01        ----tggcggatagccctgcggtgaatggagccaccggccac--------
F6WQI0_BCL2L1-02        ----tggcggacagccccacggggaatggagccactggccac--------
A0A2U3V0P1_BCL2L1-      ----tggcagacagccctgcggtgaatgtagccactggccac--------
A0A1L5BWY3_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A287CZ07_BCL2L1-      ----tggccgacagccccgcgataaatggagccactggtcac--------
I3MUP5_BCL2L1-01        ----tggccgacagccccgcggtaaatggagccactggtcac--------
I3MUP5_BCL2L1-02        ----tggccgacagccccgcggtaaatggagccactggtcac--------
I3MUP5_BCL2L1-03        ----tggccgacagccccgcggtaaatggagccactggtcac--------
F6WQI0_BCL2L1-01        ----tggcggacagccccacggggaatggagccactggccac--------
E2IV76_BCL2L1-01        ----tggcagacagccctccagcgaatggagccactggccac--------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ----tggcggacagccccccagcgaatggagccactggccac--------
G1RER8_BCL2L1-01        ----tggcggacagccccgcggtgaatggagccactggccac--------
A0A2J8VIH3_BCL2L1-      ----tggcggacagccccgcggtgaatggagccactggccac--------
Q07817_BCL2L1-01        ----tggcagacagccccgcggtgaatggagccactggccac--------
Q07817_BCL2L1-03        ----tggcagacagccccgcggtgaatggagccactggccac--------
Q07817_BCL2L1-02        ----tggcagacagccccgcggtgaatggagccactggccac--------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ----tggcggacagccccgcggtgaatggagccactggccac--------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
Q2PFS6_BCL2L1-01        ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K5M8B1_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K5VPG2_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
F6UKR4_BCL2L1-01        ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A0D9RJZ8_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K6QFA2_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K6QFA2_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K5YR37_BCL2L1-      ----tggtggacagccccgcggtgaatggagccactggccac--------
A0A2K6UWY8_BCL2L1-      ----tggcggacagccccgcggtgaatggagccacgggccac--------
E2IV77_BCL2L1-01        ----tggcggacagccccgcggtgaatggagccacgggccac--------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ----tggcggacagccccgcggtgaatggagccacgggccac--------
E2IV75_BCL2L1-01        ----tggcggacagccccgcggtgaatggagccacgggccac--------
F7IT34_BCL2L1-02        ----tggcggacagcccagtggtgaatggagccacgggccac--------
F7IT34_BCL2L1-01        ----tggcggacagcccagtggtgaatggagccacgggccac--------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        ----tggcggacagccctgcggtgaatggagccactggccac--------
Q76LT7_BCL2L1-01        ----tggcagacagccctgcggtgaatggagccactggccac--------
Q8SQ42_BCL2L1-01        ----tggcagacagccctgcggtgaatggagccactggccac--------
M3XA94_BCL2L1-01        ----tggcggacagccctgcggtgaatggagccactggccac--------
A0A452SDS4_BCL2L1-      ----tggcggacagccctgcggtgaatggagccactggccac--------
A0A384D3U1_BCL2L1-      ----tggcggacagccctgcggtgaatggagccactggccac--------
A0A452ILL8_BCL2L1-      ----cgggtgccagccacatagtgaatggggctgctgggcac--------
A0A452ILL8_BCL2L1-      ----cgggtgccagccacatagtgaatggggctgctgggcac--------
K7F655_BCL2L1-01        ----caggtgccagccacgtagtgaacggggctgccgggcac--------
U3JSL7_BCL2L1-01        ----cacccaccagccacatagtgaacggagcctccgtgcac--------
Q4U2V6_BCL2L1-01        ----cggccaccagccacatagtgaatggagccaccgtgcac--------
H0Z8G3_BCL2L1-01        ----cggccaccagccacatagtgaatggagccaccgtgcac--------
Q07816_BCL2L1-04        ----cccctgccggccacgtagtgaacggagccaccgtgcac--------
Q07816_BCL2L1-03        ----cccctgccggccacgtagtgaacggagccaccgtgcac--------
Q07816_BCL2L1-02        ----cccctgccggccacgtagtgaacggagccaccgtgcac--------
Q07816_BCL2L1-01        ----cccctgccggccacgtagtgaacggagccaccgtgcac--------
G1N5N5_BCL2L1-01        ----cgcctgccggccacgtagtgaatggagccgccgtgcac--------
H3ANS8_BCL2L1-01        -----gtt-aacgggttgccggctggc---agcagcagccgcctggaagc
A0A3B5K6B9_BCL2L1-      ----agcc---ctggaacac------c---cccagca-------------
A0A3B5K6B9_BCL2L1-      ----agcc---ctggaacac------c---cccagca-------------
H3CH49_BCL2L1-01        ----agtc---ctggaaccc------c---cccagcaccctc--------
C1BLI0_BCL2L1-01        ----aattgcataggcagtctggggat---atcttcatctcc--------
A0A3P8XFS0_BCL2L1-      ----aatt---tgggaa---------a---gccctcaactcc--------
A0A3P8XFS0_BCL2L1-      ----aatt---tgggaa---------a---gccctcaactcc--------
A0A286MU87_BCL2L1-      ----aatt---tggcga---------a---gccctcatctcc--------
C0HAD8_BCL2L1-01        ----aatt---tggcga---------a---gccctcatctcc--------
A0A345BSW9_BCL2L1-      ----------------accc------c---accacaatcccccgctacat
Q90Z98_BCL2L1-01        cgctagttccactgggaccc------c---accacaatcccctgcttcat
Q90Z98_BCL2L1-02        cgctagttccactgggaccc------c---accacaatcccctgcttcat
A0A059PJI5_BCL2L1-      ----ggatcggcaggcactc------c---accgcgatcgccgactttgt
A0A3B3ZN55_BCL2L1-      ------ac---tcagacttgactccgc---ctctgattctgc--------
A0A3B3ZN55_BCL2L1-      ----gaac---tcagacttgactccgc---ctctgattctgc--------
D2ITA2_BCL2L1-02        ----ggtt---acggttgaa------c---gacggta-------------
A0A3P8UWG7_BCL2L1-      ----agtt---ctgggacgc------c---gcctgcatctcc------ac
A0A3B3QRZ2_BCL2L1-      ----ggca---ccagcagccaggtgtc---cccagtgcctga------gc
A0A3B1JJ42_BCL2L1-      ----agtc---acggtgcggcagggtc---gcccacctcgtc--------
A0A3B4DTL9_BCL2L1-      ----agtc---acggtccagcggggtc---gcccacctcttc--------
A0A3P8XYL5_BCL2L1-      ----agtc---ctgggactccaacaca---a---cagtcccccccctcat
B5XAY3_BCL2L1-01        ----agtc---ccgggactccaccacc---acggcagtcgcccccctcct
A0A3B3TFR4_BCL2L1-      ----aact---ctgtgggccagggtgc----------tcccc--------
A0A3Q3DUT7_BCL2L1-      ----agtc------------------c---cccggcgtcgcc--------
A0A3Q3DUT7_BCL2L1-      ----agtc------------------c---cccggcgtcgcc--------
A0A3Q3DUT7_BCL2L1-      ----agtc------------------c---cccggcgtcgcc--------
W5MG74_BCL2L1-01        ----gg-------ggggcccgtgtcgc---gccagccccccc--------
A0A3Q3WIW8_BCL2L1-      ----agtc---ccgggaccc------c---tccaaggtcccc------gc
A0A2U9BY16_BCL2L1-      ----aatc---ccgggaccc------c---cccagagtcccc------ac
A0A3B5PQJ0_BCL2L1-      ----agtc---cagg---------------------atcccc--------
A0A3P9N9Y4_BCL2L1-      ----agtc---cagg---------------------atcccc--------
A0A3B3WI27_BCL2L1-      ----agtc---cagg---------------------atcccc--------
A0A087X9B7_BCL2L1-      ----agtc---cagg---------------------atcccc--------
A0A3B3TUS7_BCL2L1-      ----agtc---cagg---------------------atcccc--------
A0A3Q2FR43_BCL2L1-      ----agtc---cagg---------------------ctcccc------gc
A0A3Q2QPL9_BCL2L1-      ----agct---cggg---------------------ctcccc------gc
A0A3Q3B3X5_BCL2L1-      ----agtc---ctgggaccc------c---gccggcgtcccc------ac
A0A3Q0RTF8_BCL2L1-      ----agtc---ccggtaccc------c---gccagcgtcccc------gc
I3IZK7_BCL2L1-01        ----agtc---ccgggaccc------c---tccggcatcccc------gc
A0A3Q4N4B5_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
A0A3Q2X557_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
A0A3P8P0F1_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
A0A3P9D632_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
A0A3P9D632_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
A0A3B4FNX1_BCL2L1-      ----agtc---ccgggaccc------c---accggcatcccc------gc
G3NJY1_BCL2L1-01        ----agtc---ccgggaccc------c---gccggcgtcccc------gc
A0A3B3IB64_BCL2L1-      ----actc---ccgggaccc------c---gccgctctcccc------gc
A0A3P9JYH1_BCL2L1-      ----actc---ccgggaccc------c---gccgctctcccc------gc
A0A3B3DHA1_BCL2L1-      ----agtc---ccgggaccc------c---gccgctatcccc------gc
C3VIT1_BCL2L1-01        ----agtc---ccgggaccc------c---gccggtgtcccc------tc
A0A3B4Z3X2_BCL2L1-      ----agtc---ccgggaccc------c---gccgccgtcccc--------
A0A3B4Z3X2_BCL2L1-      ----agtc---ccgggaccc------c---gccgccgtcccc--------
A0A3Q1GS47_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3Q1GS47_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3Q1DHJ3_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3Q1DHJ3_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3Q1DHJ3_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3P8TL99_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A3P8TL99_BCL2L1-      ----agtc---ccgggaccc------c---cccgccgtcccc--------
A0A219P0Y3_BCL2L1-      ----agtc---ccgggaccc------c---gccagcatcccc------gc
A0A3Q3G2E1_BCL2L1-      ----agtc---ctggaaccc------c---cccagcgtccccacaccggc
A0A3Q3G2E1_BCL2L1-      ----agtc---ctggaaccc------c---cccagcgtccccacaccggc
A0A3Q3G2E1_BCL2L1-      ----agtc---ctggaaccc------c---cccagcgtccccacaccggc
A0A3B4V3T1_BCL2L1-      ----agtc---ctgggaccc------g---tgcagagtcccc------gc
A0A3B4XU17_BCL2L1-      ----agtc---ctgggaccc------g---tccagagtcccc------gc
A0A3Q3IVF5_BCL2L1-      ----agtc---ccgggaccc------c---cccagcatcccc------gc
A0A3Q3MX20_BCL2L1-      ----agtc---ctgggaccc------c---cccagcgtcccc------gc
A0A3Q1GZ93_BCL2L1-      ----agtc---ccgggaccc------c---cccagcgtcccc------gc
A0A3Q1GZ93_BCL2L1-      ----agtc---ccgggaccc------c---cccagcgtcccc------gc
A0A3Q1GZ93_BCL2L1-      ----agtc---ccgggaccc------c---cccagcgtcccc------gc
A0A0D6DR75_BCL2L1-      ----agtc---ctggaaccc------c---cccagcatcccc------gc
A0A3B3E2W4_BCL2L1-      --------aggacggccagctgaagaa---gtcctgcccctg-------t
A0A3B3ICL7_BCL2L1-      --------aggacggccggctgaggag---gtcctgtccctg-------t
A0A3B3ICL7_BCL2L1-      --------aggacggccggctgaggag---gtcctgtccctg-------t
A0A3B4BFZ8_BCL2L1-      --------atggcaacagacaaacactggcctcactgcctcc-------t
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      ----aacaggggtggagc------------gtctccatccgc-------a
H2U5I3_BCL2L1-01        ----aacaggggtggagc------------gtctccatccgc-------a
H2U5I3_BCL2L1-02        ----aacaggggtggagc------------gtctccatccgc-------a
G3P7B4_BCL2L1-01        ----agcagcgccggccagccggggatgtcgtcgccaccgcc-------g
A0A3Q3FUB6_BCL2L1-      ----aaccgggccggccagtcagtgat---gtcatcatcccc-------a
A0A3Q3X5M5_BCL2L1-      ----agtaggggtggact------------gtctccttccac-------a
A0A2U9BIG9_BCL2L1-      ----aacaggtgcggtcagctggggactgacccgttgccccc-------g
A0A3Q1JZ46_BCL2L1-      -------------ggcgagctggggaa---ctcgtcacctcc-------g
A0A3Q1JZ46_BCL2L1-      -------------ggcgagctggggaa---ctcgtcacctcc-------g
A0A3Q3NFM4_BCL2L1-      ----tatgtcagcggccggccggggat---gtcatcatcccc-------a
A0A3Q3NFM4_BCL2L1-      ----tatgtcagcggccggccggggat---gtcatcatcccc-------a
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      ----gacaggtgtggtcagcccgggac---gtcctcgccccc-------g
A0A3B4XS24_BCL2L1-      ----gacaggtgtggtcagcccgggac---gtcctcgccccc-------g
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        ----acaagt---ggccagccggggac---gtcttcgtcctc-------a
A0A0B4KJI5_BCL2L1-      ----aacggg---ggc-------ggac---agc--------c-------a
A0A3Q3BEB7_BCL2L1-      --------gggacggccagtcggggaagaagatctggccccg-------c
A0A3Q2C6K4_BCL2L1-      --------ggcccagcccccccgg---gaagcctcgggcccc-------c
A0A3Q2NRP4_BCL2L1-      --------gggccggctccccgtg---gcagccttgggcccc-------t
A0A3B5MGS2_BCL2L1-      --------gggccgggcacccggg---gaaacccaggggccc-------t
M4A558_BCL2L1-01        --------gggccgggcccccggg---gaagcccaggggccc-------a
A0A3P9QFB3_BCL2L1-      --------gggctggctcccgggg---gaagtcccagggccc-------t
A0A3B3XN57_BCL2L1-      --------gggccggctccccagg---gaagtcccaggaccc-------t
A0A087YBW4_BCL2L1-      --------gggccggctccccagg---gaagtcccgggaccc-------t
A0A3B3VWI7_BCL2L1-      --------gggccggctccccagg---gaagtcccgggaccc-------t
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        ---------ag-ggcattgtggg------ggag---gaagtcctt-----
Q2TAP5_BCL2L1-01        ---------ag-ggcattgtgga------ggag---gaagtcctt-----
Q91828_BCL2L1-01        ---------ag-ggcattgtgga------ggag---gaagtcctt-----
H9GHK7_BCL2L1-01        ---------cccgaactccttgaagaggaggaggaagaaaacccgagggt
F6WA14_BCL2L1-01        ---------agcagcagcctggatgcccatgag---acaataccagtggc
G3WKX6_BCL2L1-01        ---------agcagcagcctggatgcccatgag---acaattcctgtagc
A0A452FIG6_BCL2L1-      ---------a-cagaa-------------gaaa---gtggt-cctgtggc
A0A452FIG6_BCL2L1-      ---------a-cagaa-------------gaaa---gtggt-cctgtggc
A0A3Q1LRT3_BCL2L1-      ---------agcagaagcttggatgcccggaaa---atgatccccatgac
A0A452E1B1_BCL2L1-      ---------agcagaagcttggacgctgggaaa---atgatccccacggc
W5PSA5_BCL2L1-01        ---------agcagaagcttggacaccgggaaa---atgatccccatggc
G3SPN0_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
H0X6V2_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
P53563_BCL2L1-03        ---------agcagcagtttggatgcgcgggag---gtaatccccatggc
P53563_BCL2L1-02        ---------agcagcagtttggatgcgcgggag---gtaatccccatggc
P53563_BCL2L1-04        ---------agcagcagtttggatgcgcgggag---gtaatccccatggc
P53563_BCL2L1-01        ---------agcagcagtttggatgcgcgggag---gtaatccccatggc
O35843_BCL2L1-01        ---------agcagcagtttggatgcgcgggag---gtgattcccatggc
Q64373_BCL2L1-09        ---------agcagcagtttggatgcgcgggag---gtgattcccatggc
Q64373_BCL2L1-01        ---------agcagcagtttggatgcgcgggag---gtgattcccatggc
Q64373_BCL2L1-03        ---------agcagcagtttggatgcgcgggag---gtgattcccatggc
Q64373_BCL2L1-04        ---------agcagcagtttggatgcgcgggag---gtgattcccatggc
B2Z3Z4_BCL2L1-01        ---------agcagcagtttggatgcacgggag---gtgatccccatggc
Q9MYW4_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatgac
O77737_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
A0A286Y5D6_BCL2L1-      ---------agcagtagtttggatgcccgggag---gtgatccccatggc
G1P9D2_BCL2L1-01        ---------agcagtagcttggatgcccgggag---gtgattcccatggc
Q05KJ0_BCL2L1-02        ---------agcagaagctcggatgcccgggaa---gtgatccccatggc
Q05KJ0_BCL2L1-01        ---------agcagaagctcggatgcccgggaa---gtgatccccatggc
A0A452FWV3_BCL2L1-      ---------agcagaagcttggatgcccgggaa---gtgatccccatggc
Q9MZS7_BCL2L1-01        ---------agcagaagcttggatgcccgggaa---gtgatccccatggc
F6WQI0_BCL2L1-02        ---------agcagcagcttggatgcccgggaa---gtgatccccatggc
A0A2U3V0P1_BCL2L1-      ---------agcagcagcttggatgcccgggag---gtgatccccatggc
A0A1L5BWY3_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatgac
A0A287CZ07_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
I3MUP5_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
I3MUP5_BCL2L1-02        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
I3MUP5_BCL2L1-03        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
F6WQI0_BCL2L1-01        ---------agcagcagcttggatgcccgggaa---gtgatccccatggc
E2IV76_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccctatggc
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
G1RER8_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2J8VIH3_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
Q07817_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
Q07817_BCL2L1-03        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
Q07817_BCL2L1-02        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
Q2PFS6_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5M8B1_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5VPG2_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
F6UKR4_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A0D9RJZ8_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K6QFA2_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K6QFA2_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5YR37_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K6UWY8_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
E2IV77_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ---------agcagcagtttggatgcccgggag---gtgatccccatggc
E2IV75_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
F7IT34_BCL2L1-02        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
F7IT34_BCL2L1-01        ---------agcagcagtttggatgcccgggag---gtgatccccatggc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
Q76LT7_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
Q8SQ42_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
M3XA94_BCL2L1-01        ---------agcagcagcttggatgcccgggag---gtgatccccatggc
A0A452SDS4_BCL2L1-      ---------agcagcagcttggatgcccgggag---gtgatccccatggc
A0A384D3U1_BCL2L1-      ---------agcagcagcttggatgcccgggag---gtgatccccatggc
A0A452ILL8_BCL2L1-      ---------agtaacagccttgaagcccatgaa---agggttccagcaac
A0A452ILL8_BCL2L1-      ---------agtaacagccttgaagcccatgaa---agggttccagcaac
K7F655_BCL2L1-01        ---------agtaacagccttgaagcccatgaa---agggttccggcagc
U3JSL7_BCL2L1-01        ---------cagagcagcctcgaagtccatgag---atccgtcgagcagc
Q4U2V6_BCL2L1-01        ---------cagagcagcctcgaagtccatgag---atccgtcgagcagc
H0Z8G3_BCL2L1-01        ---------cagaacagcctcgaagtccatgag---atccgtcgagcagc
Q07816_BCL2L1-04        ---------cggagcagcctggaagttcatgaa---attgttcgagcatc
Q07816_BCL2L1-03        ---------cggagcagcctggaagttcatgaa---attgttcgagcatc
Q07816_BCL2L1-02        ---------cggagcagcctggaagttcatgaa---attgttcgagcatc
Q07816_BCL2L1-01        ---------cggagcagcctggaagttcatgaa---attgttcgagcatc
G1N5N5_BCL2L1-01        ---------aggagcagcctggaagttcatgaa---attgttcgagcatc
H3ANS8_BCL2L1-01        ccaggcggtgtcggg-----------------------------gcccga
A0A3B5K6B9_BCL2L1-      ----acaagtctgg-------ca-------acaag---------tctgga
A0A3B5K6B9_BCL2L1-      ----acaagtctgg-------ca-------acaag---------tctgga
H3CH49_BCL2L1-01        ----ccagcaccag-------cagtcattgacaag---------tctgga
C1BLI0_BCL2L1-01        ----acagggggg-------------------------------tataga
A0A3P8XFS0_BCL2L1-      ----acaggggtg-------------------------------catgga
A0A3P8XFS0_BCL2L1-      ----acaggggtg-------------------------------catgga
A0A286MU87_BCL2L1-      ----acagggggg-------------------------------catgga
C0HAD8_BCL2L1-01        ----acagggggg-------------------------------catgga
A0A345BSW9_BCL2L1-      ccccccagcatcagacaaacgggagtggggg-------------tctgga
Q90Z98_BCL2L1-01        ccccccagcgtcaaacaaatgggtctggggg-------------tctaga
Q90Z98_BCL2L1-02        ccccccagcgtcaaacaaatgggtctggggg-------------tctaga
A0A059PJI5_BCL2L1-      cccctcagaggcaggtgaatggcagcg----caag---------cctgga
A0A3B3ZN55_BCL2L1-      -----cccc-----------------------------------------
A0A3B3ZN55_BCL2L1-      -----ccccgtccacagccccgcccccttgttgga---------cctgga
D2ITA2_BCL2L1-02        ----acggcaatggccagttggcgccatcacctactccacaaggcacgga
A0A3P8UWG7_BCL2L1-      t---gcggcagcag-cattcggcgtcggatacaag---------tctgga
A0A3B3QRZ2_BCL2L1-      agccgctccattcc-ccatcgccctctccacaagg---------cctgga
A0A3B1JJ42_BCL2L1-      ----cccccagaga-agggccaacggggctcgggg---------gctgga
A0A3B4DTL9_BCL2L1-      ----cccccaaaga-aggtccaacggggccggagg---------gctgga
A0A3P8XYL5_BCL2L1-      ctcctcggcgg----------------actgttgg---------cctgga
B5XAY3_BCL2L1-01        cccctcggcgg----------------acagcggg---------cctgga
A0A3B3TFR4_BCL2L1-      -----------tgg-aaggcgccaccccccaggg----------cctgga
A0A3Q3DUT7_BCL2L1-      -----------------gctacgagaggcggcgag---------cctgga
A0A3Q3DUT7_BCL2L1-      -----------------gctacgagaggcggcgag---------cctgga
A0A3Q3DUT7_BCL2L1-      -----------------gctacgagaggcggcgag---------cctgga
W5MG74_BCL2L1-01        ----aggg------------------------------------gatcga
A0A3Q3WIW8_BCL2L1-      t---gcggctgcaa-c------cgtcgacaacaag---------tctgga
A0A2U9BY16_BCL2L1-      t---gcggctgcaa-cggttgccttcatcgccgag---------cctgga
A0A3B5PQJ0_BCL2L1-      ----taggcggcac-caggcggcgtcggcgtcaac---------gatgga
A0A3P9N9Y4_BCL2L1-      ----gaggcggcaa-caggcggcgtcggcgtcaac---------gatgga
A0A3B3WI27_BCL2L1-      ----gaggcggcaa-caggcggcgtcggcggcaac---------gatgga
A0A087X9B7_BCL2L1-      ----gaggcggcaa-caggcggcgtcggcggcaac---------gatgga
A0A3B3TUS7_BCL2L1-      ----gaggcggcaa-caggcggcgtcggcggcaac---------gatgga
A0A3Q2FR43_BCL2L1-      ggcgacagca----------ggcgtccacagccgc---------catgga
A0A3Q2QPL9_BCL2L1-      ggcggcggcagcag-cagccggcgtccacggcggc---------gatgga
A0A3Q3B3X5_BCL2L1-      t---gaggcagcaa-ccgctgccgacgacggcgaa---------catgga
A0A3Q0RTF8_BCL2L1-      a---gcggcagcaa-cagccgccatcaacaacgaa---------cctcga
I3IZK7_BCL2L1-01        a---gcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3Q4N4B5_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3Q2X557_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3P8P0F1_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3P9D632_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3P9D632_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
A0A3B4FNX1_BCL2L1-      agcggcggcagcag-cagccgccatcaacgacgga---------cctcga
G3NJY1_BCL2L1-01        t---gctccagcaa-cggtcgccgtcgacggcgag---------cctgga
A0A3B3IB64_BCL2L1-      t---gcgagagcaa-cagttgccgtcgacgacaaa---------catgga
A0A3P9JYH1_BCL2L1-      t---gcgagagcaa-cagttgccgtcgacgacaaa---------catgga
A0A3B3DHA1_BCL2L1-      t---gcgtcagcag-cagttgccgtcgacgacgaa---------catgga
C3VIT1_BCL2L1-01        t---gaggcagcaa-ccgttgccgtcgacgacgacgacgacgcgcctgga
A0A3B4Z3X2_BCL2L1-      ----------gcgg-cggttggcgtcgacggcgac---------catgga
A0A3B4Z3X2_BCL2L1-      ----------gcgg-cggttggcgtcgacggcgac---------catgga
A0A3Q1GS47_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3Q1GS47_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3Q1DHJ3_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3Q1DHJ3_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3Q1DHJ3_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3P8TL99_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A3P8TL99_BCL2L1-      ----------gcgg-cggctggcgtcgacggcgac---------catgga
A0A219P0Y3_BCL2L1-      t---gcggcagcaa-cagttgccatcaacaacgag---------cctgga
A0A3Q3G2E1_BCL2L1-      a---gcagcaacaa-cggttaccagcaacgacgaa---------tctgga
A0A3Q3G2E1_BCL2L1-      a---gcagcaacaa-cggttaccagcaacgacgaa---------tctgga
A0A3Q3G2E1_BCL2L1-      a---gcagcaacaa-cggttaccagcaacgacgaa---------tctgga
A0A3B4V3T1_BCL2L1-      a---gcggcagcaa-cggctgccgtcaacaacgag---------cctgga
A0A3B4XU17_BCL2L1-      a---gcggcagcaa-cggctgccgtcaacaacgag---------cctgga
A0A3Q3IVF5_BCL2L1-      t---aaggcaacaa-cagttgccatcaacggcaaa---------cctgga
A0A3Q3MX20_BCL2L1-      t---gcgacaagaa-catttgcagtccacggcaag---------cctgga
A0A3Q1GZ93_BCL2L1-      t---gcggcaacaa-cggttgccatcaacgacgag---------cctgga
A0A3Q1GZ93_BCL2L1-      t---gcggcaacaa-cggttgccatcaacgacgag---------cctgga
A0A3Q1GZ93_BCL2L1-      t---gcggcaacaa-cggttgccatcaacgacgag---------cctgga
A0A0D6DR75_BCL2L1-      t---caggcaacaa-cggttgccatcaccgacgag---------cctgga
A0A3B3E2W4_BCL2L1-      t------gtgctag------------------------------catgga
A0A3B3ICL7_BCL2L1-      t------gtgctag------------------------------catgga
A0A3B3ICL7_BCL2L1-      t------gtgctag------------------------------catgga
A0A3B4BFZ8_BCL2L1-      g------atgatca------------------------------cttaga
A0A3P8VMA1_BCL2L1-      -------gcagtgg------------------------------tgcaga
A0A0F7L1T6_BCL2L1-      g------gtgctgg------------------------------cattga
H2U5I3_BCL2L1-01        g------gtgctgg------------------------------cataga
H2U5I3_BCL2L1-02        g------gtgctgg------------------------------cataga
G3P7B4_BCL2L1-01        ccaccgtccggtga------------------------------caccga
A0A3Q3FUB6_BCL2L1-      c------acaccga------------------------------cataga
A0A3Q3X5M5_BCL2L1-      g------gtgctga------------------------------catgga
A0A2U9BIG9_BCL2L1-      g------acggtgg------------------------------cgtggg
A0A3Q1JZ46_BCL2L1-      t------gtaagag------------------------------catgga
A0A3Q1JZ46_BCL2L1-      t------gtaagag------------------------------catgga
A0A3Q3NFM4_BCL2L1-      c------atggagg------------------------------cgtaga
A0A3Q3NFM4_BCL2L1-      c------atggagg------------------------------cgtaga
A0A3Q3J5K3_BCL2L1-      ------------gg------------------------------cataga
A0A3B4V9K8_BCL2L1-      c------atggtgg------------------------------cataga
A0A3B4XS24_BCL2L1-      c------atggtgg------------------------------cataga
A0A3B5B4X7_BCL2L1-      -------gaggcgg------------------------------cataga
A0A3Q1EVP6_BCL2L1-      -------gagacgg------------------------------cataga
A0A3Q1BQA0_BCL2L1-      -------gaggtgg------------------------------cataga
A0A3P8U812_BCL2L1-      -------gaggtgg------------------------------cataga
E6ZFR0_BCL2L1-01        g------gcgctga------------------------------cataga
A0A0B4KJI5_BCL2L1-      g------gtgctga------------------------------cataga
A0A3Q3BEB7_BCL2L1-      c------gcagcga------------------------------cataga
A0A3Q2C6K4_BCL2L1-      c------atggaag------------------------------cataga
A0A3Q2NRP4_BCL2L1-      c------atggccg------------------------------cgcgga
A0A3B5MGS2_BCL2L1-      c------cggccgg------------------------------cgtcga
M4A558_BCL2L1-01        a------tggccgg------------------------------tgttga
A0A3P9QFB3_BCL2L1-      c------c------------------------------------cgtcga
A0A3B3XN57_BCL2L1-      c------ccaccgg------------------------------cgtcga
A0A087YBW4_BCL2L1-      c------ccaccgg------------------------------cgtcaa
A0A3B3VWI7_BCL2L1-      c------ccaccgg------------------------------cgtcaa
                                                                          

R4JQR8_BCL2L1-01        ---aattcagcttaaattacgttcacttggagatgaattccaagaaagat
A0A346RRN1_BCL2L1-      ---agttcagctcacattacggacgattggggacgaatttcaggaacgat
Q6GLI5_BCL2L1-01        ----------caggcgctgctggacgcgtcggaggagtttgagttgagat
Q2TAP5_BCL2L1-01        ----------caagcccttttggaagcaacggaggagtttgagttgagat
Q91828_BCL2L1-01        ----------caagcccttttggaagcaacggaggagtttgagttgagat
H9GHK7_BCL2L1-01        ggatgtcagccagacacttagggaggctggcgatgagtttgaactaaggt
F6WA14_BCL2L1-01        tgctgtgaagcaagctttgagggaggcaggagatgaatttgaacttcggt
G3WKX6_BCL2L1-01        tgctgtgaagcaagctttgagggaggcaggagatgaatttgaactccggt
A0A452FIG6_BCL2L1-      aacagcacagcaagccccgagggaggcaggcagcgagtttgaactgaggc
A0A452FIG6_BCL2L1-      aacagcacagcaagccccgagggaggcaggcagcgagtttgaactgaggc
A0A3Q1LRT3_BCL2L1-      aacagtaaagcaagccctgagggaggcaagcaatgagtttaaactgaggt
A0A452E1B1_BCL2L1-      agtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggt
W5PSA5_BCL2L1-01        agtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggt
G3SPN0_BCL2L1-01        agcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggt
H0X6V2_BCL2L1-01        agcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
P53563_BCL2L1-03        agcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggt
P53563_BCL2L1-02        agcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggt
P53563_BCL2L1-04        agcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggt
P53563_BCL2L1-01        agcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggt
O35843_BCL2L1-01        agcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggt
Q64373_BCL2L1-09        agcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggt
Q64373_BCL2L1-01        agcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggt
Q64373_BCL2L1-03        agcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggt
Q64373_BCL2L1-04        agcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggt
B2Z3Z4_BCL2L1-01        agccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggt
Q9MYW4_BCL2L1-01        agcagtgaagcaggctctgagggaggcaggcgacgagtttgaactgcggt
O77737_BCL2L1-01        tgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggt
A0A286Y5D6_BCL2L1-      agcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggt
G1P9D2_BCL2L1-01        agcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggt
Q05KJ0_BCL2L1-02        agcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggt
Q05KJ0_BCL2L1-01        agcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggt
A0A452FWV3_BCL2L1-      agcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggt
Q9MZS7_BCL2L1-01        agcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggt
F6WQI0_BCL2L1-02        agcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggt
A0A2U3V0P1_BCL2L1-      agcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggt
A0A1L5BWY3_BCL2L1-      agcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggt
A0A287CZ07_BCL2L1-      agcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggt
I3MUP5_BCL2L1-01        agcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggt
I3MUP5_BCL2L1-02        agcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggt
I3MUP5_BCL2L1-03        agcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggt
F6WQI0_BCL2L1-01        agcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggt
E2IV76_BCL2L1-01        agcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      agcagtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggt
G1RER8_BCL2L1-01        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2J8VIH3_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
Q07817_BCL2L1-01        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
Q07817_BCL2L1-03        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
Q07817_BCL2L1-02        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
Q2PFS6_BCL2L1-01        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K5M8B1_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K5VPG2_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
F6UKR4_BCL2L1-01        agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A0D9RJZ8_BCL2L1-      agcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K6QFA2_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K6QFA2_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K5YR37_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K6UWY8_BCL2L1-      agcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
E2IV77_BCL2L1-01        agcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      agcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggt
E2IV75_BCL2L1-01        agcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggt
F7IT34_BCL2L1-02        agcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
F7IT34_BCL2L1-01        agcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        agcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggt
Q76LT7_BCL2L1-01        agcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggt
Q8SQ42_BCL2L1-01        agcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggt
M3XA94_BCL2L1-01        agcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggt
A0A452SDS4_BCL2L1-      agcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggt
A0A384D3U1_BCL2L1-      agcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggt
A0A452ILL8_BCL2L1-      tggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggt
A0A452ILL8_BCL2L1-      tggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggt
K7F655_BCL2L1-01        cgaagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggt
U3JSL7_BCL2L1-01        cgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggt
Q4U2V6_BCL2L1-01        cgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggt
H0Z8G3_BCL2L1-01        tgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggt
Q07816_BCL2L1-04        cgacgtgaggcaggcgctgagagatgcgggggatgagtttgagct-----
Q07816_BCL2L1-03        cgacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggt
Q07816_BCL2L1-02        cgacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggt
Q07816_BCL2L1-01        cgacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggt
G1N5N5_BCL2L1-01        tgacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggt
H3ANS8_BCL2L1-01        agccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggt
A0A3B5K6B9_BCL2L1-      tacagtaaaggaagccctccgggacacaggcaatgaatttgagctgcgat
A0A3B5K6B9_BCL2L1-      tacagtaaaggaagccctccgggacacaggcaatgaatttgagctgcgat
H3CH49_BCL2L1-01        cgcagtcaaggaagccctccgggacaccggcaatgaatttgagctgcggt
C1BLI0_BCL2L1-01        ggcggttaaagcagctcttagagactctgcagatgagtttgaattgcgtt
A0A3P8XFS0_BCL2L1-      ggcagtgaaagcagcactacgggactctgcagatgagtttgagctgcgct
A0A3P8XFS0_BCL2L1-      ggcagtgaaagcagcactacgggactctgcagatgagtttgagctgcgct
A0A286MU87_BCL2L1-      gccagtgaaagcagcactacgggactcagtggatgagtttgagctacgct
C0HAD8_BCL2L1-01        gccagtgaaagcagcactacgggactcagtggatgagtttgagctgcgct
A0A345BSW9_BCL2L1-      cgcggtgaaggaagcactacgcgattctgccaatgagtttgagctgcgtt
Q90Z98_BCL2L1-01        cgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgct
Q90Z98_BCL2L1-02        cgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgct
A0A059PJI5_BCL2L1-      ggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgct
A0A3B3ZN55_BCL2L1-      -------------gctcttcgtgactccgctaatgagttcgagctccgtt
A0A3B3ZN55_BCL2L1-      cgccgttaaagaggctcttcgtgactccgctaatgagttcgagctccgtt
D2ITA2_BCL2L1-02        ggctgtgagggcagcgcttctagaatcggtggaagagtttgagttgcgct
A0A3P8UWG7_BCL2L1-      ctccattaaagaggctctgcgggactcggccaacgagtttgaactgcgat
A0A3B3QRZ2_BCL2L1-      ggcggtgaaggaggcattgcgggattctgccaacgagtttgagctacgct
A0A3B1JJ42_BCL2L1-      tgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgat
A0A3B4DTL9_BCL2L1-      cgccgtgaaggaagcactgcgggactcagccaacgagtttgagctgcgat
A0A3P8XYL5_BCL2L1-      tgcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgtt
B5XAY3_BCL2L1-01        cgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgtt
A0A3B3TFR4_BCL2L1-      ggcggtgaaggaggcgctgcgactctcagccaacgaatttgagttccggt
A0A3Q3DUT7_BCL2L1-      cgcggtgaaggaggccctgcgggactcggccaatgagtttgagttgcgct
A0A3Q3DUT7_BCL2L1-      cgcggtgaaggaggccctgcgggactcggccaatgagtttgagttgcgct
A0A3Q3DUT7_BCL2L1-      cgcggtgaaggaggccctgcgggactcggccaatgagtttgagttgcgct
W5MG74_BCL2L1-01        ggcggtgcagggggcgctgcgcgactccgccaacgagtttgagctccgct
A0A3Q3WIW8_BCL2L1-      cgcagtaaaagatgccctgcgggactctgccaacgagttcgagctgcggt
A0A2U9BY16_BCL2L1-      tgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggt
A0A3B5PQJ0_BCL2L1-      cgcggtgaaagtggccctgcgcgacacggcccgtgagtttgagctgcgct
A0A3P9N9Y4_BCL2L1-      cgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgct
A0A3B3WI27_BCL2L1-      cgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgct
A0A087X9B7_BCL2L1-      cgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgct
A0A3B3TUS7_BCL2L1-      cgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgct
A0A3Q2FR43_BCL2L1-      ggcggtgaaggcggcgctgagagacacggcctgcgagttcgagctgcgct
A0A3Q2QPL9_BCL2L1-      ggcggtgaaggtggcgctgcgggagacggcctgcgagttcgagctgcgct
A0A3Q3B3X5_BCL2L1-      caaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggt
A0A3Q0RTF8_BCL2L1-      cgcagtgaaggaggcgctccgggacacagccaacgagttcgagctgcgat
I3IZK7_BCL2L1-01        cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
A0A3Q4N4B5_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
A0A3Q2X557_BCL2L1-      cgcagtgaaggaggcgctccgggacacggctaacgagttcgagctgcgat
A0A3P8P0F1_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
A0A3P9D632_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
A0A3P9D632_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
A0A3B4FNX1_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgat
G3NJY1_BCL2L1-01        tgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgat
A0A3B3IB64_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaacgagttcgagctccggt
A0A3P9JYH1_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaacgagttcgagctccggt
A0A3B3DHA1_BCL2L1-      cgcagtgaaggaggcgctccgggacacggccaacgagttcgagctgcggt
C3VIT1_BCL2L1-01        cgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggt
A0A3B4Z3X2_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3B4Z3X2_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3Q1GS47_BCL2L1-      cgcagtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3Q1GS47_BCL2L1-      cgcagtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3Q1DHJ3_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3Q1DHJ3_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3Q1DHJ3_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3P8TL99_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A3P8TL99_BCL2L1-      cgcggtgaaggaggccctccgggacacggccaacgagttcgagctgcggt
A0A219P0Y3_BCL2L1-      cgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgat
A0A3Q3G2E1_BCL2L1-      cgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgat
A0A3Q3G2E1_BCL2L1-      cgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgat
A0A3Q3G2E1_BCL2L1-      cgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgat
A0A3B4V3T1_BCL2L1-      cgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgat
A0A3B4XU17_BCL2L1-      cgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgat
A0A3Q3IVF5_BCL2L1-      tgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgat
A0A3Q3MX20_BCL2L1-      tgcagtgaaagaggccctccgggactcagccaacgagtttgagctacgat
A0A3Q1GZ93_BCL2L1-      tgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgat
A0A3Q1GZ93_BCL2L1-      tgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgat
A0A3Q1GZ93_BCL2L1-      tgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgat
A0A0D6DR75_BCL2L1-      tgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgat
A0A3B3E2W4_BCL2L1-      tgccatcaaatccacccttaaagattcggccaatgagtttgagcgtcgct
A0A3B3ICL7_BCL2L1-      cgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgtt
A0A3B3ICL7_BCL2L1-      cgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgtt
A0A3B4BFZ8_BCL2L1-      cgctattaagactgctctgacggactctgcagatgaatttgaagagttgt
A0A3P8VMA1_BCL2L1-      ggctgtaaaggctgctctcaaggactcagctgacgagtttgaacttcgct
A0A0F7L1T6_BCL2L1-      ggctgtgaacgcagctcttcgggactcggcagaagagtttgagaagctct
H2U5I3_BCL2L1-01        ggctgtgaacgcagctcttcgggactcggcagaagagtttgagaagctct
H2U5I3_BCL2L1-02        ggctgtgaacgcagctcttcgggactcggcagaagagtttgagaagctct
G3P7B4_BCL2L1-01        ggccgtaaaggcagctcttcaggactctgcgaatgagtttgagctgctct
A0A3Q3FUB6_BCL2L1-      ggctgtaaaggcagctcttctggactctgcagatgagtttgagcttctct
A0A3Q3X5M5_BCL2L1-      ggctgttaagtcggcgcttagggactcagccaatgagtttgagcagctct
A0A2U9BIG9_BCL2L1-      ggctgtgaaggaggcgctcagggactccgctcatgagtttgaacagctct
A0A3Q1JZ46_BCL2L1-      ggccgtaaaaacagctcttagggactctgctgacgagtttgaactgctct
A0A3Q1JZ46_BCL2L1-      ggccgtaaaaacagctcttagggactctgctgacgagtttgaactgctct
A0A3Q3NFM4_BCL2L1-      ggctgtaaaggcagctcttagggactccgctgaagagtttgaactgctct
A0A3Q3NFM4_BCL2L1-      ggctgtaaaggcagctcttagggactccgctgaagagtttgaactgctct
A0A3Q3J5K3_BCL2L1-      ggctgtaaaggctgctcttagggactctgctgatgagtttgaactgcgct
A0A3B4V9K8_BCL2L1-      ggccgtaaagtcagcccttaaggactctgctgacgaatttgaattgctct
A0A3B4XS24_BCL2L1-      ggccgtaaagtcagcccttaaggactctgctgacgaatttgaattgctct
A0A3B5B4X7_BCL2L1-      ggctgtaaaagcagcgcttaaggactcggcagatgagtttgaacttctct
A0A3Q1EVP6_BCL2L1-      ggctgtaaaatccacccttaaggatgcggcagatgaatttgaacttctct
A0A3Q1BQA0_BCL2L1-      ggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctct
A0A3P8U812_BCL2L1-      ggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctct
E6ZFR0_BCL2L1-01        ggctgtaaaggcagctcttcgggactcggcagatgagtttgaactgctct
A0A0B4KJI5_BCL2L1-      ggctgttaaagcagctcttcgggactcatctgaagagtttgaactgctct
A0A3Q3BEB7_BCL2L1-      ggccgtaaaatcagctctgaaggactctgcggatgagtttgagcgtctct
A0A3Q2C6K4_BCL2L1-      ggctgtaaaatccgctctgaaggactcagcaaatgagtttgaacttctct
A0A3Q2NRP4_BCL2L1-      ggctgtgaagtcggctctgagggactcggcggatgagtttgaacatctct
A0A3B5MGS2_BCL2L1-      ggtcgtcaaatcggttctgaaggacgcggcggaggagtttgagcgcctct
M4A558_BCL2L1-01        ggtcgtcaaatcagttctgaaggacgcggcggaggagtttgagcgcctct
A0A3P9QFB3_BCL2L1-      ggtcgtcaaatcggttctgaaggacgcggcagaggagtttgaacgcctct
A0A3B3XN57_BCL2L1-      ggttgtcaaatcggttctgaaggacgcggcagaggagtttgaacgcctct
A0A087YBW4_BCL2L1-      ggttgtcaaattggttctgaaggacgcggcagaggagtttgaacgcctct
A0A3B3VWI7_BCL2L1-      ggttgtcaaattggttctgaaggacgcggcagaggagtttgaacgcctct
                                                                          

R4JQR8_BCL2L1-01        ttcagactcagtttgacgatatggtcaatcagttacacataactgaggct
A0A346RRN1_BCL2L1-      ttcgcacacaatttgacgatatggtcgatcagttacatataacggaagca
Q6GLI5_BCL2L1-01        accagcgtgccttcagcgacctgaccgcccagctgcacctcacccaggac
Q2TAP5_BCL2L1-01        atcagcgtgccttcagtgacctgacctcacagctgcacatcacccaggac
Q91828_BCL2L1-01        atcagcgtgccttcagtgacctgacctcacagctgcacatcacccaggac
H9GHK7_BCL2L1-01        accggcgggcttttagtgacctgacctcccagctccacatcaccttgggc
F6WA14_BCL2L1-01        acaggcgggcattcagtgacctgacatcccagctccacatcacgccagga
G3WKX6_BCL2L1-01        accggcgggcattcagtgatctgacatcccagctccacatcactccaggg
A0A452FIG6_BCL2L1-      accaacagacggtcagcgacctgacgtcccagctccacaccaccccaggg
A0A452FIG6_BCL2L1-      accaacagacggtcagcgacctgacgtcccagctccacaccaccccaggg
A0A3Q1LRT3_BCL2L1-      accaacagacattcagcgacctgatgtcccagctccgcatcaccccaggg
A0A452E1B1_BCL2L1-      accaacagacattcagcgacctgacgtcccagctccacatcaccccaggg
W5PSA5_BCL2L1-01        accaacagacattcagcgacctgacgtcccagctccacatcaccccaggg
G3SPN0_BCL2L1-01        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
H0X6V2_BCL2L1-01        accggcgggcattcagtgacctgacatctcagctgcacatcaccccaggg
P53563_BCL2L1-03        accggagagcattcagtgatctaacatcccagcttcatataaccccaggg
P53563_BCL2L1-02        accggagagcattcagtgatctaacatcccagcttcatataaccccaggg
P53563_BCL2L1-04        accggagagcattcagtgatctaacatcccagcttcatataaccccaggg
P53563_BCL2L1-01        accggagagcattcagtgatctaacatcccagcttcatataaccccaggg
O35843_BCL2L1-01        accggagagcgttcagtgatctaacatcccagcttcacataaccccaggg
Q64373_BCL2L1-09        accggagagcgttcagtgatctaacatcccagcttcacataaccccaggg
Q64373_BCL2L1-01        accggagagcgttcagtgatctaacatcccagcttcacataaccccaggg
Q64373_BCL2L1-03        accggagagcgttcagtgatctaacatcccagcttcacataaccccaggg
Q64373_BCL2L1-04        accggagagcgttcagtgatctaacatcccagcttcacataaccccaggg
B2Z3Z4_BCL2L1-01        accggcgggcgttcagtgatctaacatcccagcttcatataaccccaggg
Q9MYW4_BCL2L1-01        accggcgggcattcagcgacctgacatcccagctccacatcaccccaggg
O77737_BCL2L1-01        accggagggcattcagtgacctgacgtcccagctccacatcaccccaggg
A0A286Y5D6_BCL2L1-      accggcgagcattcagcgacttaacatctcagctccacatcaccccgggg
G1P9D2_BCL2L1-01        accggcgggcgttcagcgacctgacatcccagctccacatcaccccaggg
Q05KJ0_BCL2L1-02        accgacgggcattcagcgacctgacgtcccagctccacatcaccccaggg
Q05KJ0_BCL2L1-01        accgacgggcattcagcgacctgacgtcccagctccacatcaccccaggg
A0A452FWV3_BCL2L1-      accgacgggcattcagcgacctgacgtcccagctccacattaccccaggg
Q9MZS7_BCL2L1-01        accgacgggcattcagcgacctgacgtcccagctccacatcaccccaggg
F6WQI0_BCL2L1-02        accggcgggcattcagcgacctgacatcccagctccacatcaccccaggg
A0A2U3V0P1_BCL2L1-      accggcgggcattcagcgacctgacatcccagctccacatcaccccaggg
A0A1L5BWY3_BCL2L1-      accggcgggcattcagtgacctgacatcccagctccacataaccccgggg
A0A287CZ07_BCL2L1-      actggcgggcattcagtgacctgacgtcccagctccacatcaccctgggg
I3MUP5_BCL2L1-01        accggcgggcattcagtgacctgacgtcccagctccacatcaccccgggg
I3MUP5_BCL2L1-02        accggcgggcattcagtgacctgacgtcccagctccacatcaccccgggg
I3MUP5_BCL2L1-03        accggcgggcattcagtgacctgacgtcccagctccacatcaccccgggg
F6WQI0_BCL2L1-01        accggcgggcattcagcgacctgacatcccagctccacatcaccccaggg
E2IV76_BCL2L1-01        accggcgggcattcagtgacctgacatcccagctccacatcaccctaggg
A0A2K6G3C5_BCL2L1-      -----------------------------------------------ggg
A0A2K6G3C5_BCL2L1-      accggcgggcattcagtgacctgacatcccagctccacatcaccctaggg
G1RER8_BCL2L1-01        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
A0A2J8VIH3_BCL2L1-      accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
Q07817_BCL2L1-01        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
Q07817_BCL2L1-03        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
Q07817_BCL2L1-02        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
G3RY91_BCL2L1-02        -----------------------------------------------ggg
G3RY91_BCL2L1-01        accggcgggcattcagtgacctgacatcccagctccacatcaccccaggg
A0A2K5H963_BCL2L1-      -----------------------------------------------ggg
A0A2K5H963_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
Q2PFS6_BCL2L1-01        accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K5M8B1_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K5M8B1_BCL2L1-      -----------------------------------------------ggg
A0A2K6LPM4_BCL2L1-      -------------------------------------------------g
A0A2K6QFA2_BCL2L1-      -------------------------------------------------g
A0A2K5VPG2_BCL2L1-      -------------------------------------------------g
F6UKR4_BCL2L1-02        -------------------------------------------------g
A0A2K5YR37_BCL2L1-      -------------------------------------------------g
A0A2K5YR37_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K5VPG2_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
F6UKR4_BCL2L1-01        accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A0D9RJZ8_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
I7GKS6_BCL2L1-01        ----------------------------------------caccccaggg
A0A2K6LPM4_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K6QFA2_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K6QFA2_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K5YR37_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K6UWY8_BCL2L1-      accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
E2IV77_BCL2L1-01        accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
A0A2K6UWY8_BCL2L1-      -------------------------------gctccacatcacccccggg
A0A2K5EBP4_BCL2L1-      accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
E2IV75_BCL2L1-01        accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
F7IT34_BCL2L1-02        accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
F7IT34_BCL2L1-01        accggcgggcatttagtgacctgacatcccagctccacatcacccccggg
A0A2K5EBP4_BCL2L1-      -------------------------------gctccacatcacccccggg
M3Z2H9_BCL2L1-01        accggcgggcattcagcgacctgacatctcagcttcacatcaccccaggg
Q76LT7_BCL2L1-01        accggcgggcattcagtgacctgacatcccagcttcacatcaccccaggg
Q8SQ42_BCL2L1-01        accggcgggcattcagtgacctgacatcccagcttcacatcaccccaggg
M3XA94_BCL2L1-01        accggcgggcattcagcgacctgacatcccagcttcacatcaccccaggg
A0A452SDS4_BCL2L1-      accggcgggcattcagcgacctgacatcccagcttcacatcaccccaggg
A0A384D3U1_BCL2L1-      accggcgggcattcagcgacctgacatcccagcttcacatcaccccaggg
A0A452ILL8_BCL2L1-      atcggagggctttcagtgacctcacttcccaactccacatcactcctggc
A0A452ILL8_BCL2L1-      atcggagggctttcagtgacctcacttcccaactccacatcactcctggc
K7F655_BCL2L1-01        atcggagggctttcagtgacctcacttcccagctccacatcaccctgggc
U3JSL7_BCL2L1-01        accggcgggcgttcagcgacctcacttcccagctccacatcactcccagc
Q4U2V6_BCL2L1-01        accggcgggcgttcagcgacctcacttcccagctccacatcactcccagc
H0Z8G3_BCL2L1-01        accggcgggcgttcagcgacctcacttcccagctccacatcactcccagc
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        accggagggctttcagcgacctcacctcccagctccacatcacccctggc
Q07816_BCL2L1-02        accggagggctttcagcgacctcacctcccagctccacatcacccctggc
Q07816_BCL2L1-01        accggagggctttcagcgacctcacctcccagctccacatcacccctggc
G1N5N5_BCL2L1-01        accggagggctttcagcgatctcacctcccagctccacatcacccctggc
H3ANS8_BCL2L1-01        atagccgagcattcagtgacctctcttcccagctccacatcacccccggc
A0A3B5K6B9_BCL2L1-      acacttgtgctttcagtgacctgcacaaccagctacacatcaccccagct
A0A3B5K6B9_BCL2L1-      acacttgtgctttcagtgacctgcacaaccagctacacatcaccccagct
H3CH49_BCL2L1-01        acacctgcgcgttcagtgacctgcacaaccagctccacatcacgccagcc
C1BLI0_BCL2L1-01        acaccagagccttcaatgatccctcttctcaactgcatatcacccctgct
A0A3P8XFS0_BCL2L1-      acacccgtgccttcagtgatctctcctcccagctccacatcacccccgcc
A0A3P8XFS0_BCL2L1-      acacccgtgccttcagtgatctctcctcccagctccacatcacccccgcc
A0A286MU87_BCL2L1-      acacccgtgccttcagtgacctctcctcccagctccacatcacccctgcc
C0HAD8_BCL2L1-01        acacccgcgccttcagtgacctctcctcccagctccacatcacccctgcc
A0A345BSW9_BCL2L1-      attcccgagcgttcaacgacctttcctcacagctccacatcacacctgcc
Q90Z98_BCL2L1-01        attccagagcattcaacgatctttcctcacagctccacatcacacccgcc
Q90Z98_BCL2L1-02        attccagagcattcaacgatctttcctcacagctccacatcacacccgcc
A0A059PJI5_BCL2L1-      attcacgcgcctttagcgacctgtcatcacagttgcatataactccagtc
A0A3B3ZN55_BCL2L1-      ttagccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgcc
A0A3B3ZN55_BCL2L1-      ttagccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgcc
D2ITA2_BCL2L1-02        acacgctggccttcagcgacctgtcgtcccagctgcccatcacccccgcc
A0A3P8UWG7_BCL2L1-      acgcgcgggccttcagcgatctgcaccagcagctgcacatcacaccagcc
A0A3B3QRZ2_BCL2L1-      acagccgcgccttcagcgacctctcctcccagcttcacatcacacccgtc
A0A3B1JJ42_BCL2L1-      actctcgcgccttcagcgacctgtcctcccagctgcacatcacgcctgct
A0A3B4DTL9_BCL2L1-      attcacgcgcctttagcgacctctcctcccagctccatatcacgccagcc
A0A3P8XYL5_BCL2L1-      acgccctagcattcagtgacctgtcatcccagctgcacctcacaccggct
B5XAY3_BCL2L1-01        atgccagagcgttcagtgacctgtcctcccagctacacatcacgccgtcc
A0A3B3TFR4_BCL2L1-      accagcgtgccttcagcgacctgtcgtcacagctgcatatcacgccggcc
A0A3Q3DUT7_BCL2L1-      actcccacgccttcagcgacctggacaaacagctgcacattacaccggcc
A0A3Q3DUT7_BCL2L1-      actcccacgccttcagcgacctggacaaacagctgcacattacaccggcc
A0A3Q3DUT7_BCL2L1-      actcccacgccttcagcgacctggacaaacagctgcacattacaccggcc
W5MG74_BCL2L1-01        acggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgcc
A0A3Q3WIW8_BCL2L1-      atgcccgcgccttcagtgacctgcacaaccagctccacatcacaccggcc
A0A2U9BY16_BCL2L1-      acgcgcgcgccttcagcgatctgcacaaccagctgcacatcacgccggcc
A0A3B5PQJ0_BCL2L1-      actcccgcgccttcaacgaccttcacagcacgctgcacatcacaccggcc
A0A3P9N9Y4_BCL2L1-      actcccgcgccttcaacgaccttcacagcacgctgcacatcacaccggcc
A0A3B3WI27_BCL2L1-      actcccgcgccttcaacgaccttcacagcacgctgcacatcacaccggcc
A0A087X9B7_BCL2L1-      actcccgcgccttcaacgaccttcacagcacgctgcacatcacaccggcc
A0A3B3TUS7_BCL2L1-      actcccgcgccttcaacgaccttcacagcacgctgcacatcacaccggcc
A0A3Q2FR43_BCL2L1-      acgcccgcgccttcaacgaccttcacagcacgctgcacatcacgccggcc
A0A3Q2QPL9_BCL2L1-      acgcccgcgccttcaacgacctgcacagcacgctgcacatcacgccggcc
A0A3Q3B3X5_BCL2L1-      acgcccgcgctttcagcgacctgcacagccagctgcacatcacgcccggc
A0A3Q0RTF8_BCL2L1-      acgctcgtgccttcaacgatctgcacagccagctgcacatcacgccggcc
I3IZK7_BCL2L1-01        acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
A0A3Q4N4B5_BCL2L1-      acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
A0A3Q2X557_BCL2L1-      acgctcgtgccttcagcgaccttcacagccaactgcacatcacgccggcc
A0A3P8P0F1_BCL2L1-      acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
A0A3P9D632_BCL2L1-      acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
A0A3P9D632_BCL2L1-      acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
A0A3B4FNX1_BCL2L1-      acgctcgtgccttcagcgaccttcacagccagctgcacatcacgccggcc
G3NJY1_BCL2L1-01        acgctcgggccttcagcgatctgcacaaccagctgcacatcacgccggcc
A0A3B3IB64_BCL2L1-      acgcccttgccttcaacaacctgcacagccagctgcacatcacgcccgcc
A0A3P9JYH1_BCL2L1-      acgcccttgccttcaacaacctgcacagccagctgcacatcacgcccgcc
A0A3B3DHA1_BCL2L1-      acgccctggccttcaacaacctgcacagccagctgcacatcacgcccgcc
C3VIT1_BCL2L1-01        acgcccgcgccttcagcgacctccacagccagctgcacatcacgccggcc
A0A3B4Z3X2_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgccggcc
A0A3B4Z3X2_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgccggcc
A0A3Q1GS47_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3Q1GS47_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3Q1DHJ3_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3Q1DHJ3_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3Q1DHJ3_BCL2L1-      acgcccgcgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3P8TL99_BCL2L1-      acgcccgtgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A3P8TL99_BCL2L1-      acgcccgtgccttcagcgacctgcacagccagctgcacatcacgcccgcc
A0A219P0Y3_BCL2L1-      acgctcgcgccttcagcgatctgcaccaccagctgcacatcacgccggcc
A0A3Q3G2E1_BCL2L1-      atgccagcgccttcagcgatctgcacaaccagctgcacatcacgccggcc
A0A3Q3G2E1_BCL2L1-      atgccagcgccttcagcgatctgcacaaccagctgcacatcacgccggcc
A0A3Q3G2E1_BCL2L1-      atgccagcgccttcagcgatctgcacaaccagctgcacatcacgccggcc
A0A3B4V3T1_BCL2L1-      actcccgcgccttcagcgatctgcacaaccagctgcatatcacgccggcc
A0A3B4XU17_BCL2L1-      actcccgcgccttcagcgatctgcacaaccagctgcatatcacgccggcc
A0A3Q3IVF5_BCL2L1-      atgcccgtgctttcagtgatctgcaccaccagctgcatatcacaccagcc
A0A3Q3MX20_BCL2L1-      acgcccgtgctttcagcgatctgcacaaccagctgcatatcacgccagcc
A0A3Q1GZ93_BCL2L1-      acgctcgagccttcagcgatctgcacaaccagctgcatatcacgcctgcc
A0A3Q1GZ93_BCL2L1-      acgctcgagccttcagcgatctgcacaaccagctgcatatcacgcctgcc
A0A3Q1GZ93_BCL2L1-      acgctcgagccttcagcgatctgcacaaccagctgcatatcacgcctgcc
A0A0D6DR75_BCL2L1-      atgcccgcgccttcagcgatctgcacaaccagctgcatatcacgcccgcc
A0A3B3E2W4_BCL2L1-      tcagtcaaggttttagtgatctctctctgcagtttcacatcactcctgac
A0A3B3ICL7_BCL2L1-      tccatcaaggttttagtgatctctccgtgcagcttcatatcactccagac
A0A3B3ICL7_BCL2L1-      tccatcaaggttttagtgatctctccgtgcagcttcatatcactccagac
A0A3B4BFZ8_BCL2L1-      tcacacaagcattcagcaacctttcctctcagctcgacatcacacctgat
A0A3P8VMA1_BCL2L1-      tcacacaagcctttcgtaaccttttcttaaagctggacctcactccggac
A0A0F7L1T6_BCL2L1-      ttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgac
H2U5I3_BCL2L1-01        ttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgac
H2U5I3_BCL2L1-02        ttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgac
G3P7B4_BCL2L1-01        tcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgac
A0A3Q3FUB6_BCL2L1-      ttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaac
A0A3Q3X5M5_BCL2L1-      tcacacaagcgttcagtgacctctcctcgcagcttgacatcacccctgac
A0A2U9BIG9_BCL2L1-      tcaaccaagcgttcagtgacctctccctgcagctcgacatcacccctgac
A0A3Q1JZ46_BCL2L1-      tcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgac
A0A3Q1JZ46_BCL2L1-      tcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgac
A0A3Q3NFM4_BCL2L1-      tcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgac
A0A3Q3NFM4_BCL2L1-      tcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgac
A0A3Q3J5K3_BCL2L1-      tcacacaagcatttagtgacctttcctcgcagcttgtcatcactcctgac
A0A3B4V9K8_BCL2L1-      tcaaccaagcgtttagtgacctttccacgcagcttgacatcactcctgac
A0A3B4XS24_BCL2L1-      tcaaccaagcatttagtgacctttccacgcagcttgacatcactcctgac
A0A3B5B4X7_BCL2L1-      tcacgcaagcttttagtgacctgtcttcacagcttgacatcactcctgac
A0A3Q1EVP6_BCL2L1-      tcacgcaaactttcagtgacctgtcttcgcagattgacatcacccctgaa
A0A3Q1BQA0_BCL2L1-      tcacgcaggcttttagtgatctgtcttcacagcttgacatcacccctgaa
A0A3P8U812_BCL2L1-      tcacgcaggcttttagtgatctgtcttcacagcttgacatcacccctgaa
E6ZFR0_BCL2L1-01        tcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgac
A0A0B4KJI5_BCL2L1-      tcacacaagcgtttagtgacctctccacgcagctcgacatcactcctgac
A0A3Q3BEB7_BCL2L1-      acacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgac
A0A3Q2C6K4_BCL2L1-      tctctcaaagtttcagtgacctctccatgcagctagacatcacccctgac
A0A3Q2NRP4_BCL2L1-      tcacccaaagtttcagtcacctctccctgcagctggacatcacccccgac
A0A3B5MGS2_BCL2L1-      acacccaaagctttaaacacctctccttgcagctggacatcacccccgac
M4A558_BCL2L1-01        acacccaaagctttaaacacctctccttgcagctggacatcacccccgac
A0A3P9QFB3_BCL2L1-      acacccaaagctttaaacacctttccttgcagctggacatcacccccgac
A0A3B3XN57_BCL2L1-      acacccaaagctttaaacacctttccttgcagctggacatcacccccgac
A0A087YBW4_BCL2L1-      acacccaaagctttaaacacctttccttgcagctggacatcacccccgac
A0A3B3VWI7_BCL2L1-      acacccaaagctttaaacacctttccttgcagctggacatcacccccgac
                                                                          

R4JQR8_BCL2L1-01        actgcatatccaacgtttcaaagagttgttcaggaattatttattgatgg
A0A346RRN1_BCL2L1-      acagcatatcctactttccaaagagttgttcaagagttattcattgatgg
Q6GLI5_BCL2L1-01        actgcccagcaaagcttccagcaggtggtgggggagttgttcagggacgg
Q2TAP5_BCL2L1-01        acggcccagcagagcttccagcaagttatgggagagttgttcagggatgg
Q91828_BCL2L1-01        acggcccagcagagcttccagcaagttatgggagagttgttcagggatgg
H9GHK7_BCL2L1-01        acggcataccagagcttcgagcaggtggtgaatgaactcttccacgatgg
F6WA14_BCL2L1-01        acagcttatcagagctttgagcaggtagtgaatgaactcttccgggatgg
G3WKX6_BCL2L1-01        acggcttatcagagttttgagcaggtagtgaatgaactcttccgggatgg
A0A452FIG6_BCL2L1-      acagcatatcagagctttgaacaggtaatgtatgagctcttctgggacgg
A0A452FIG6_BCL2L1-      acagcatatcagagctttgaacaggtaatgtatgagctcttctgggacgg
A0A3Q1LRT3_BCL2L1-      acagcatgtcagagctttgaacaggtaataaatgaactcttccgggacag
A0A452E1B1_BCL2L1-      acaacatatcagagctttgaacaggtaataaatgaactcttccaggatgg
W5PSA5_BCL2L1-01        aaagcatatcagagctttgaacaggtaataaatgaactcttccaggatgg
G3SPN0_BCL2L1-01        acagcatatcagagctttgagcaggtagtgaacgaactcttccgggatgg
H0X6V2_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
P53563_BCL2L1-03        acagcatatcagagctttgaacaggtagtgaatgaactctttcgggatgg
P53563_BCL2L1-02        acagcatatcagagctttgaacaggtagtgaatgaactctttcgggatgg
P53563_BCL2L1-04        acagcatatcagagctttgaacaggtagtgaatgaactctttcgggatgg
P53563_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactctttcgggatgg
O35843_BCL2L1-01        accgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgg
Q64373_BCL2L1-09        accgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgg
Q64373_BCL2L1-01        accgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgg
Q64373_BCL2L1-03        accgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgg
Q64373_BCL2L1-04        accgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgg
B2Z3Z4_BCL2L1-01        actgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatgg
Q9MYW4_BCL2L1-01        acagcatatcagagctttgaacaagtagtgaacgaactcttccgggatgg
O77737_BCL2L1-01        acagcgtatcagagctttgagcaggtattgaacgaactcttccgggatgg
A0A286Y5D6_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
G1P9D2_BCL2L1-01        acagcatatcagagctttgagcaagtagtgaatgaactcttccgggatgg
Q05KJ0_BCL2L1-02        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggacgg
Q05KJ0_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggacgg
A0A452FWV3_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggacgg
Q9MZS7_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggacgg
F6WQI0_BCL2L1-02        acagcatatcagagctttgagcaggtagtgaatgaactcttccgggatgg
A0A2U3V0P1_BCL2L1-      acggcatatcagagctttgagcaggtagtgaacgaactcttccgggatgg
A0A1L5BWY3_BCL2L1-      acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
A0A287CZ07_BCL2L1-      acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
I3MUP5_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
I3MUP5_BCL2L1-02        acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
I3MUP5_BCL2L1-03        acagcatatcagagctttgaacaggtagtgaacgaactcttccgggatgg
F6WQI0_BCL2L1-01        acagcatatcagagctttgagcaggtagtgaatgaactcttccgggatgg
E2IV76_BCL2L1-01        acagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6G3C5_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgagatgg
A0A2K6G3C5_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgagatgg
G1RER8_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2J8VIH3_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
Q07817_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
Q07817_BCL2L1-03        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
Q07817_BCL2L1-02        acagcatatcagagctttgaaca---------------------------
G3RY91_BCL2L1-02        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
G3RY91_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5H963_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5H963_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
Q2PFS6_BCL2L1-01        acagcatatcagagctttgaacaagtagtgaatgaactcttccgggatgg
A0A2K5M8B1_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5M8B1_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6LPM4_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6QFA2_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5VPG2_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
F6UKR4_BCL2L1-02        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5YR37_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5YR37_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5VPG2_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
F6UKR4_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A0D9RJZ8_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
I7GKS6_BCL2L1-01        acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6LPM4_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6QFA2_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K6QFA2_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5YR37_BCL2L1-      acagcatatcagagctttgaaca---------------------------
A0A2K6UWY8_BCL2L1-      acagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatgg
E2IV77_BCL2L1-01        acagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatgg
A0A2K6UWY8_BCL2L1-      acagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatgg
A0A2K5EBP4_BCL2L1-      acagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatgg
E2IV75_BCL2L1-01        acagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatgg
F7IT34_BCL2L1-02        acagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatgg
F7IT34_BCL2L1-01        acagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatgg
A0A2K5EBP4_BCL2L1-      acagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatgg
M3Z2H9_BCL2L1-01        acagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatgg
Q76LT7_BCL2L1-01        acagcatatcagagctttgagcaggtagtgaatgaactcttccgggatgg
Q8SQ42_BCL2L1-01        acagcatatcagagctttgagcaggtagtgaatgaactcttccgggatgg
M3XA94_BCL2L1-01        acagcatatcagagctttgagcaggtagtgaacgaactcttccgggatgg
A0A452SDS4_BCL2L1-      acagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatgg
A0A384D3U1_BCL2L1-      acagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatgg
A0A452ILL8_BCL2L1-      acggcataccagagctttgagcaggtagtgaatgaactcttccgggacgg
A0A452ILL8_BCL2L1-      acggcataccagagctttgagcaggtagtgaatgaactcttccgggacgg
K7F655_BCL2L1-01        acggcttaccagagcttcgagcaggtggtgaatgaactcttccgggacgg
U3JSL7_BCL2L1-01        acagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgg
Q4U2V6_BCL2L1-01        acagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgg
H0Z8G3_BCL2L1-01        acagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgg
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        acggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatgg
Q07816_BCL2L1-02        acggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatgg
Q07816_BCL2L1-01        acggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatgg
G1N5N5_BCL2L1-01        acggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatgg
H3ANS8_BCL2L1-01        acagcctaccagagctttgaacaggtggtgaacgaactcttccgggacgg
A0A3B5K6B9_BCL2L1-      actgcttaccaaagttttgagaatgttatggatgaggtatttagggatgg
A0A3B5K6B9_BCL2L1-      actgcttaccaaagttttgagaatgttatggatgaggtatttagggatgg
H3CH49_BCL2L1-01        acggcttaccaaagttttgagaacgttatggatgaggtgtttcgggatgg
C1BLI0_BCL2L1-01        acagcataccatagctttgaaagtgtaatgaacgaggtgttcagggacgg
A0A3P8XFS0_BCL2L1-      acagcctaccacagttttgaaagtgtgatggacgaggtgttcagggatgg
A0A3P8XFS0_BCL2L1-      acagcctaccacagttttgaaagtgtgatggacgaggtgttcagggatgg
A0A286MU87_BCL2L1-      acagcctaccacagctttgagagtgtgatggacgaagtgttcagggacgg
C0HAD8_BCL2L1-01        acagcctaccacagctttgagagtgtgatggacgaagtgttcagggacgg
A0A345BSW9_BCL2L1-      acggcataccagagctttgagagcgtgatggatgaggtgttccgcgacgg
Q90Z98_BCL2L1-01        acagcgtaccagagcttcgagagcgtgatggatgaggtgtttcgcgacgg
Q90Z98_BCL2L1-02        acagcgtaccagagcttcgagagcgtgatggatgaggtgtttcgcgacgg
A0A059PJI5_BCL2L1-      acggtgtaccagagctttgagagcgtgatggacgaggtgttccgcgacgg
A0A3B3ZN55_BCL2L1-      acagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatgg
A0A3B3ZN55_BCL2L1-      acagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatgg
D2ITA2_BCL2L1-02        acggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacag
A0A3P8UWG7_BCL2L1-      actgcctaccaaagtttcgagaatgtgatggacgaagtgttccgggacgg
A0A3B3QRZ2_BCL2L1-      acggcctaccagagctttgagagtgtaatgaacgaggtgttccgcgatgg
A0A3B1JJ42_BCL2L1-      actgcgtaccagagctttgagagcgtgatggacgaggtgtttcgcgatgg
A0A3B4DTL9_BCL2L1-      acggcgtatcagagcttcgaaagcgtgatggacgaggtgttccgagacgg
A0A3P8XYL5_BCL2L1-      acagcctaccagagctttgcaagtgtgatggatgaggtgttccgggatgg
B5XAY3_BCL2L1-01        acagcctaccagagctttgagaacgtgatggacgaggtgttccgggacgg
A0A3B3TFR4_BCL2L1-      acagcctaccagagcttcgagagcgtcatgaacgaggtgttccgggacgg
A0A3Q3DUT7_BCL2L1-      actgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacga
A0A3Q3DUT7_BCL2L1-      actgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacga
A0A3Q3DUT7_BCL2L1-      actgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacga
W5MG74_BCL2L1-01        accgcctaccagagcttcgagcacgtcatggacgaggtcttccgggacgg
A0A3Q3WIW8_BCL2L1-      accgcctaccaaagctttgagaacgtgatggacgaggtgttcagggacgg
A0A2U9BY16_BCL2L1-      acggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacgg
A0A3B5PQJ0_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3P9N9Y4_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3B3WI27_BCL2L1-      accgcgtaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A087X9B7_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3B3TUS7_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q2FR43_BCL2L1-      accgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacgg
A0A3Q2QPL9_BCL2L1-      accgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacgg
A0A3Q3B3X5_BCL2L1-      accgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q0RTF8_BCL2L1-      acggcctaccaaagcttcgagaatgtgatggacgaggtgttccgggatgg
I3IZK7_BCL2L1-01        acggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacgg
A0A3Q4N4B5_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q2X557_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3P8P0F1_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3P9D632_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3P9D632_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3B4FNX1_BCL2L1-      acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
G3NJY1_BCL2L1-01        acggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacgg
A0A3B3IB64_BCL2L1-      acggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaa
A0A3P9JYH1_BCL2L1-      acggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaa
A0A3B3DHA1_BCL2L1-      acggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaa
C3VIT1_BCL2L1-01        acggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3B4Z3X2_BCL2L1-      accgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3B4Z3X2_BCL2L1-      accgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q1GS47_BCL2L1-      accgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacgg
A0A3Q1GS47_BCL2L1-      accgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacgg
A0A3Q1DHJ3_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q1DHJ3_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q1DHJ3_BCL2L1-      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3P8TL99_BCL2L1-      accgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacgg
A0A3P8TL99_BCL2L1-      accgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacgg
A0A219P0Y3_BCL2L1-      acagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacgg
A0A3Q3G2E1_BCL2L1-      acaacccaccagagctttgagaacgtgatggacgaggtgttccgggacgg
A0A3Q3G2E1_BCL2L1-      acaacccaccagagctttgagaacgtgatggacgaggtgttccgggacgg
A0A3Q3G2E1_BCL2L1-      acaacccaccagagctttgagaacgtgatggacgaggtgttccgggacgg
A0A3B4V3T1_BCL2L1-      acagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggacgg
A0A3B4XU17_BCL2L1-      acagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggatgg
A0A3Q3IVF5_BCL2L1-      acggcctaccaaagctttgagagcgtgatggatgaagtgttccgggacgg
A0A3Q3MX20_BCL2L1-      acggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggacgg
A0A3Q1GZ93_BCL2L1-      acagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacgg
A0A3Q1GZ93_BCL2L1-      acagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacgg
A0A3Q1GZ93_BCL2L1-      acagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacgg
A0A0D6DR75_BCL2L1-      acggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacgg
A0A3B3E2W4_BCL2L1-      acggcctaccaaaacttcaaaagtgtgttggatgagctgttcaaggatgg
A0A3B3ICL7_BCL2L1-      acggcctaccaaaacttcaaaagggtgttggatgagctgttcaaggatgg
A0A3B3ICL7_BCL2L1-      acggcctaccaaaacttcaaaagggtgttggatgagctgttcaaggatgg
A0A3B4BFZ8_BCL2L1-      acagcttataacagctttaaaagtgtcatggacgaggtgttcaaagatgg
A0A3P8VMA1_BCL2L1-      acagtctaccacagttttaagagcgtgatggatgaggtcttcagagacgg
A0A0F7L1T6_BCL2L1-      acggcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgg
H2U5I3_BCL2L1-01        acagcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgg
H2U5I3_BCL2L1-02        acagcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgg
G3P7B4_BCL2L1-01        acggcctaccacagcttcaagagcgtgatggacgaggtgttcaaggatgg
A0A3Q3FUB6_BCL2L1-      acagcctatcacagctttaagagtgtgatggacgaggttttcaaggatgg
A0A3Q3X5M5_BCL2L1-      acagcctatcacagttttaagagcgtgatggacgaggtgttcaaggacgg
A0A2U9BIG9_BCL2L1-      acggcctaccaaagctttaagagtgtgatggacgaggtgttcaaggacgg
A0A3Q1JZ46_BCL2L1-      acggcctatcaaagctttaagagtgtgatggacgagttgttcaaggatgg
A0A3Q1JZ46_BCL2L1-      acggcctatcaaagctttaagagtgtgatggacgagttgttcaaggatgg
A0A3Q3NFM4_BCL2L1-      acagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggatgg
A0A3Q3NFM4_BCL2L1-      acagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggatgg
A0A3Q3J5K3_BCL2L1-      acagcctacaacagctttaaaagcgtgatggatgaagtgttcaaagatgg
A0A3B4V9K8_BCL2L1-      actgcataccacagctttaagagtgtgatggatgagttgttcaaagatgg
A0A3B4XS24_BCL2L1-      actgcataccacagctttaagagtgtgatggatgagttgttcaaggatgg
A0A3B5B4X7_BCL2L1-      acggcctaccacagcttcaagagtgtgatggacgaggtgttcaaggatgg
A0A3Q1EVP6_BCL2L1-      acggcctaccacagctttaagagtgtgatggatgaggtgttcaaggatgg
A0A3Q1BQA0_BCL2L1-      acggcctaccacagctttaagagtgtgatggacgaggtgttcaaggatgg
A0A3P8U812_BCL2L1-      acagcctaccacagctttaagagtgtgatggacgaggtgttcaaggatgg
E6ZFR0_BCL2L1-01        acggcctaccacagctttaaaagcgtgatggacgaggtgttcaaggatgg
A0A0B4KJI5_BCL2L1-      acagcctaccacagctttaagagcgtgatggacgaggtgttcaaggacgg
A0A3Q3BEB7_BCL2L1-      acggtctaccacagcttcaagagcgtgctggacgagctgttcaaggacgg
A0A3Q2C6K4_BCL2L1-      acggcctaccacagctttaaggccgtgttggacgagttgttcaaggatgg
A0A3Q2NRP4_BCL2L1-      acggcctaccacagcttcaaggccgtgctggacgagttgttcaaggacgg
A0A3B5MGS2_BCL2L1-      acggcctaccacagcttcaagaccgtgctggacgagttgttcaagggcgg
M4A558_BCL2L1-01        acggcctaccacagcttcaagaccgtgctggacgagttgttcaagggcgg
A0A3P9QFB3_BCL2L1-      acggcctaccacagcttcaagaccgtgctggatgagttgttcaagggcga
A0A3B3XN57_BCL2L1-      acggcctaccagagcttcaagactgtgctggatgagttattcaagggtga
A0A087YBW4_BCL2L1-      acggcctaccagagcttcaagaccgtgctggatgagttgttcaagggtga
A0A3B3VWI7_BCL2L1-      acggcctaccagagcttcaagaccgtgctggatgagttgttcaagggtga
                                                                          

R4JQR8_BCL2L1-01        aaatattaactggggaaggattgtggctcttttcggttttggtgggtctt
A0A346RRN1_BCL2L1-      gaatataaactgggggagggtcgttgccttgttcggttttggaggggccc
Q6GLI5_BCL2L1-01        c---accaactggggcagaatcgtggccttcttctcctttgggcgggccc
Q2TAP5_BCL2L1-01        g---acaaactgggggagaattgtggctttcttctcatttgggcgggccc
Q91828_BCL2L1-01        g---acaaactgggggagaattgtggctttcttctcatttgggcgggccc
H9GHK7_BCL2L1-01        g---gtaaactgggggcggatagtggcattcttctcctttgggggagccc
F6WA14_BCL2L1-01        g---gtgaactggggccgaattgtggcattcttctccttcggaggggcat
G3WKX6_BCL2L1-01        g---gtgaactggggccgaattgtggcattcttctccttcggaggggcat
A0A452FIG6_BCL2L1-      g---gtgaactgggatcacactgtggcctttttctccttcaggggggcac
A0A452FIG6_BCL2L1-      g---gtgaactgggatcacactgtggcctttttctccttcaggggggcac
A0A3Q1LRT3_BCL2L1-      g---gtgaaatggggtcacgttgtggcctttttctccttcagtgggacac
A0A452E1B1_BCL2L1-      g---gtgaactggtgtcgcaatgtggcctttttctccttcggtggggcac
W5PSA5_BCL2L1-01        g---gtgaactggggtcgcaatgtggcctttttctccttcggtggggcac
G3SPN0_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
H0X6V2_BCL2L1-01        g---gtaaactggggtcgaattgtggcctttttctccttcggcggggctc
P53563_BCL2L1-03        g---gtaaactggggtcgcattgtggccttcttctcctttggcggggcac
P53563_BCL2L1-02        g---gtaaactggggtcgcattgtggccttcttctcctttggcggggcac
P53563_BCL2L1-04        g---gtaaactggggtcgcattgtggccttcttctcctttggcggggcac
P53563_BCL2L1-01        g---gtaaactggggtcgcattgtggccttcttctcctttggcggggcac
O35843_BCL2L1-01        a---gtaaactggggtcgcatcgtggcctttttctcctttggcggggcac
Q64373_BCL2L1-09        a---gtaaactggggtcgcatcgtggcctttttctcctttggcggggcac
Q64373_BCL2L1-01        a---gtaaactggggtcgcatcgtggcctttttctcctttggcggggcac
Q64373_BCL2L1-03        a---gtaaactggggtcgcatcgtggcctttttctcctttggcggggcac
Q64373_BCL2L1-04        a---gtaaactggggtcgcatcgtggcctttttctcctttggcggggcac
B2Z3Z4_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggtggagccc
Q9MYW4_BCL2L1-01        g---gtgaactggggccgcattgtggcctttttctccttcggcggggcac
O77737_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
A0A286Y5D6_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcat
G1P9D2_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctcgttcggtggggcat
Q05KJ0_BCL2L1-02        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
Q05KJ0_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
A0A452FWV3_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
Q9MZS7_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
F6WQI0_BCL2L1-02        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
A0A2U3V0P1_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
A0A1L5BWY3_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A287CZ07_BCL2L1-      g---gtaaactggggtcacattgtggcctttctctcctttggcggggcac
I3MUP5_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
I3MUP5_BCL2L1-02        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
I3MUP5_BCL2L1-03        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
F6WQI0_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
E2IV76_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggccc
A0A2K6G3C5_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggccc
A0A2K6G3C5_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggccc
G1RER8_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2J8VIH3_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
Q07817_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
Q07817_BCL2L1-03        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
G3RY91_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5H963_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5H963_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
Q2PFS6_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5M8B1_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5M8B1_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6LPM4_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6QFA2_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5VPG2_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
F6UKR4_BCL2L1-02        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5YR37_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5YR37_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5VPG2_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
F6UKR4_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A0D9RJZ8_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
I7GKS6_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6LPM4_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6QFA2_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6QFA2_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggcggggcac
E2IV77_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K6UWY8_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5EBP4_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
E2IV75_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
F7IT34_BCL2L1-02        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
F7IT34_BCL2L1-01        g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5EBP4_BCL2L1-      g---gtaaactggggtcgcattgtggcctttttctccttcggcggggcac
M3Z2H9_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggctc
Q76LT7_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
Q8SQ42_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
M3XA94_BCL2L1-01        g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcac
A0A452SDS4_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcat
A0A384D3U1_BCL2L1-      g---gtgaactggggtcgcattgtggcctttttctccttcggtggggcat
A0A452ILL8_BCL2L1-      a---gtgaactgggggcgcattgtggcttttttctcctttggaggagccc
A0A452ILL8_BCL2L1-      a---gtgaactgggggcgcattgtggcttttttctcctttggaggagccc
K7F655_BCL2L1-01        a---gtgaactgggggcgcattgtggcttttttctcctttggaggagccc
U3JSL7_BCL2L1-01        a---gtgaactggggccgcatcgtggctttcttctccttcggaggagcct
Q4U2V6_BCL2L1-01        a---gtgaactggggccgcatcgtggctttcttctccttcggaggagcct
H0Z8G3_BCL2L1-01        a---gtgaactggggccgcatcgtggctttcttctccttcggaggagcct
Q07816_BCL2L1-04        -----------------------------------------gaggggctt
Q07816_BCL2L1-03        t---gtgaactgggggcgcatcgtggctttcttctccttcggaggggctt
Q07816_BCL2L1-02        t---gtgaactgggggcgcatcgtggctttcttctccttcggaggggctt
Q07816_BCL2L1-01        t---gtgaactgggggcgcatcgtggctttcttctccttcggaggggctt
G1N5N5_BCL2L1-01        t---gtgaactgggggcgcatcgtggctttcttctccttcggaggggctt
H3ANS8_BCL2L1-01        a---gtgaactgggggcgcgtggtggctttctttgcctttggaggggcgt
A0A3B5K6B9_BCL2L1-      a---gtcaactgggggcggatagtggggctttttgcatttggtggtgctc
A0A3B5K6B9_BCL2L1-      a---gtcaactgggggcggatagtggggctttttgcatttggtggtgctc
H3CH49_BCL2L1-01        a---gtcaactgggggcggatagtgggcctttttgccttcggtggtgccc
C1BLI0_BCL2L1-01        c---gtcaactggggacgtgtagtaggcctgtttgcttttggtggtgctc
A0A3P8XFS0_BCL2L1-      g---gttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
A0A3P8XFS0_BCL2L1-      g---gttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
A0A286MU87_BCL2L1-      g---gtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
C0HAD8_BCL2L1-01        g---gtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
A0A345BSW9_BCL2L1-      c---gtcaactggggccgcatcgtgggactgtttgccttcggaggggctc
Q90Z98_BCL2L1-01        c---gtcaactggggccgaatcgtggggttgttcgcattcggaggggctc
Q90Z98_BCL2L1-02        c---gtcaactggggccgaatcgtggggttgttcgcattcggaggggctc
A0A059PJI5_BCL2L1-      c---gtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccc
A0A3B3ZN55_BCL2L1-      c---gttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctc
A0A3B3ZN55_BCL2L1-      c---gttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctc
D2ITA2_BCL2L1-02        c---atcaactggggacgcatagtgggcctgtttgccttcgggggggccc
A0A3P8UWG7_BCL2L1-      t---gtcaattggggtcgcatcatagggctcttcgccttcggcggggcgc
A0A3B3QRZ2_BCL2L1-      a---atcaactggggccgcatcgtgggcctctttgcctttggcggggccc
A0A3B1JJ42_BCL2L1-      c---gtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctc
A0A3B4DTL9_BCL2L1-      c---gtcaactggggccgtgttgtgggcctgttcgcgttcggtggggccc
A0A3P8XYL5_BCL2L1-      g---gtgaactggggaagggttgtgggcctgtttgcgttcggaggggccc
B5XAY3_BCL2L1-01        t---gtcaactggggacgggtggtgggcctgttttccttcggaggggccc
A0A3B3TFR4_BCL2L1-      t---gtcaactggggccgagtggtgggcctcttcgcctttggtggcgcgt
A0A3Q3DUT7_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgttcggcggcgcgc
A0A3Q3DUT7_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgttcggcggcgcgc
A0A3Q3DUT7_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgttcggcggcgcgc
W5MG74_BCL2L1-01        g---gtgaactgggggcgcatcgtggggctcttcgctttcgggggtgcgc
A0A3Q3WIW8_BCL2L1-      t---gtcaactggggacgcatagtcggactcttcgctttcggcggtgcac
A0A2U9BY16_BCL2L1-      c---gtcaactggggccgcatcatagggctttttgcatttggcggggcgc
A0A3B5PQJ0_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgc
A0A3P9N9Y4_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgc
A0A3B3WI27_BCL2L1-      c---gtcaactggggccgaatcgtggggctcttcgcgtttggtggcgcgc
A0A087X9B7_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgc
A0A3B3TUS7_BCL2L1-      c---gtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgc
A0A3Q2FR43_BCL2L1-      c---gtcaactggggccgcatcgtgggcctgttcgccttcggcggagcgc
A0A3Q2QPL9_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggcgcgc
A0A3Q3B3X5_BCL2L1-      c---gtcaactggggccgcattgtggggctctttgcattcggcggagcgc
A0A3Q0RTF8_BCL2L1-      c---gtcaactggggccgcatcgtagggcttttcgcgttcggcggggcac
I3IZK7_BCL2L1-01        c---gtcaactggggccgcatcgtagggctttttgcgttcggcggggcac
A0A3Q4N4B5_BCL2L1-      c---gttaactggggccgcatcgtagggctttttgcgttcggtggggcac
A0A3Q2X557_BCL2L1-      c---gttaactggggccgcatcgtagggcttttcgcgttcggcggggcac
A0A3P8P0F1_BCL2L1-      c---gttaactggggccgcatcgtagggcttttcgcgttcggcggggcac
A0A3P9D632_BCL2L1-      c---gttaactggggccgcatcgtagggcttttcgcgttcggcggggcac
A0A3P9D632_BCL2L1-      c---gttaactggggccgcatcgtagggcttttcgcgttcggcggggcac
A0A3B4FNX1_BCL2L1-      c---gttaactggggccgcatcgtagggcttttcgcgttcggcggggcac
G3NJY1_BCL2L1-01        c---gtcaactggggccgcatcgtggggctgttcgccttcggcggggcgc
A0A3B3IB64_BCL2L1-      c---atcaactggggccgcatcgtggggctcttcgcattcggcggggcgc
A0A3P9JYH1_BCL2L1-      c---atcaactggggccgcatcgtggggctcttcgcattcggcggggcgc
A0A3B3DHA1_BCL2L1-      c---atcaactgggggcgcatcgtggggctcttcgcgttcggcggggcgc
C3VIT1_BCL2L1-01        c---gtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgc
A0A3B4Z3X2_BCL2L1-      c---gtcaactggggccgcatcgtagggcttttcgcgttcggcggggcgc
A0A3B4Z3X2_BCL2L1-      c---gtcaactggggccgcatcgtagggcttttcgcgttcggcggggcgc
A0A3Q1GS47_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3Q1GS47_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3Q1DHJ3_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3Q1DHJ3_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3Q1DHJ3_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3P8TL99_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A3P8TL99_BCL2L1-      c---gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgc
A0A219P0Y3_BCL2L1-      a---gtcaactggggccgcatcgtagggcttttcgctttcggcggggcgc
A0A3Q3G2E1_BCL2L1-      a---gtcaactggggccgcatcgtggggctctttgctttcggcggggcgc
A0A3Q3G2E1_BCL2L1-      a---gtcaactggggccgcatcgtggggctctttgctttcggcggggcgc
A0A3Q3G2E1_BCL2L1-      a---gtcaactggggccgcatcgtggggctctttgctttcggcggggcgc
A0A3B4V3T1_BCL2L1-      c---ttcaactggggccgcatcatagggctttttgtgttcggcggggcgc
A0A3B4XU17_BCL2L1-      c---ttcaactggggccgcatcatagggctttttgtgttcggcggggcgc
A0A3Q3IVF5_BCL2L1-      c---gtcaactggggccgcatcatagggctttttgcatttggcggggcgt
A0A3Q3MX20_BCL2L1-      t---gtcaactggggtcgcatcatagggctttttgcattcggcggggctc
A0A3Q1GZ93_BCL2L1-      t---gtcaactggggccgcattgtagggctttttgcgttcggtggggcgc
A0A3Q1GZ93_BCL2L1-      t---gtcaactggggccgcattgtagggctttttgcgttcggtggggcgc
A0A3Q1GZ93_BCL2L1-      t---gtcaactggggccgcattgtagggctttttgcgttcggtggggcgc
A0A0D6DR75_BCL2L1-      c---gtcaactggggccgcatcatagggctctttgcatttggtggggcac
A0A3B3E2W4_BCL2L1-      g---ataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgc
A0A3B3ICL7_BCL2L1-      g---atcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgc
A0A3B3ICL7_BCL2L1-      g---atcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgc
A0A3B4BFZ8_BCL2L1-      g---gttaattggggacggattgtgggtctttttgtttttggaggggttt
A0A3P8VMA1_BCL2L1-      a---gtcaactggggacgcatagtcggcctgtttactttcggaggagtac
A0A0F7L1T6_BCL2L1-      a---gacaactggggacgagttgtgggactatttgcctttggcggggtac
H2U5I3_BCL2L1-01        a---gtcaactggggacgagttgtgggactatttgcctttggcggggtac
H2U5I3_BCL2L1-02        a---gtcaactggggacgagttgtgggactatttgcctttggcggggtac
G3P7B4_BCL2L1-01        c---gtcaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
A0A3Q3FUB6_BCL2L1-      a---gtcaactgggggcgtatagtaggcctgtttgcctttggcggtgtac
A0A3Q3X5M5_BCL2L1-      g---gtcaactggggacgtatagtgggactgtttgcctttggaggtgttc
A0A2U9BIG9_BCL2L1-      a---gtcaactggggacgtatagtgggcctgttcgcttttggcggcgtgc
A0A3Q1JZ46_BCL2L1-      a---gtcaactggggacgtatagtggggctgtttgccttcggtggcgtgc
A0A3Q1JZ46_BCL2L1-      a---gtcaactggggacgtatagtggggctgtttgccttcggtggcgtgc
A0A3Q3NFM4_BCL2L1-      a---gtcaactggggacgcatagtgggcctgtttgctttcggtggtgtac
A0A3Q3NFM4_BCL2L1-      a---gtcaactggggacgcatagtgggcctgtttgctttcggtggtgtac
A0A3Q3J5K3_BCL2L1-      a---gtcaactggggacgtattgtgggcttgtttgcttttggtggtgcac
A0A3B4V9K8_BCL2L1-      a---gtcaactggggacgtatagtgggcctatttgcctttgggggtgtac
A0A3B4XS24_BCL2L1-      a---gtcaactggggacgtatagtgggcctgtttgcctttgggggtgtac
A0A3B5B4X7_BCL2L1-      g---gtcaactggggacgtatagtgggcctgttttgctttggcggtgtac
A0A3Q1EVP6_BCL2L1-      g---gtcaactggggacgtatagtgggcctgttttgctttggcggtgtac
A0A3Q1BQA0_BCL2L1-      g---gtcaactggggacgtatagtgggcctgttttgctttggcggtgtac
A0A3P8U812_BCL2L1-      g---gtcaactggggacgtatagtgggcctgttttgctttggcggtgtac
E6ZFR0_BCL2L1-01        a---gtgaactggggacgtatagtgggcctgtttgcctttggcggtgtac
A0A0B4KJI5_BCL2L1-      a---gtcaactggggacgtgtagtgggcctgtttgcttttggcggtgtgc
A0A3Q3BEB7_BCL2L1-      g---gtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
A0A3Q2C6K4_BCL2L1-      g---atcaactggggccgtgtggtggggctgtttgcctttggtggggttc
A0A3Q2NRP4_BCL2L1-      g---gtcaactgggggcgcgtggtggggctgtttgccttcggcggggttc
A0A3B5MGS2_BCL2L1-      g---gtcaactgggggcgggtggtggccatgtttaccttcggggggattc
M4A558_BCL2L1-01        g---gtcaactgggggcgggtggtggccatgtttaccttcggggggattc
A0A3P9QFB3_BCL2L1-      g---gtcaactggggtcgggtggtggccatgtttacctttggggggattc
A0A3B3XN57_BCL2L1-      g---gtcaactggggtcgggtggtggccatgtttacctttgggggaattc
A0A087YBW4_BCL2L1-      g---gtcaactggggtcgggtggtggccatgtttacctttgggggaattc
A0A3B3VWI7_BCL2L1-      g---gtcaactggggtcgggtggtggccatgtttacctttggggggattc
                                                                          

R4JQR8_BCL2L1-01        tgtcagtgaaatgtgtacaaagaggaatgccacaacttgtggattcaatt
A0A346RRN1_BCL2L1-      tctcagtagaatgtgtacaaaatggaatgccacaacttgtagactcgatc
Q6GLI5_BCL2L1-01        tgtgcgtggagagtgccaacaaggagatgactgagctgctccccaggatc
Q2TAP5_BCL2L1-01        tatgtgtggagagtgcaaacaaggagatgactgatctgctacccagaatt
Q91828_BCL2L1-01        tatgtgtggagagtgcaaacaaggagatgactgatctgctacccagaatt
H9GHK7_BCL2L1-01        tgtgcgtggagagcgttgacaaagagatgcaagggttggtggtgaggatt
F6WA14_BCL2L1-01        tgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
G3WKX6_BCL2L1-01        tgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
A0A452FIG6_BCL2L1-      tatgcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtc
A0A452FIG6_BCL2L1-      tatgcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtc
A0A3Q1LRT3_BCL2L1-      tatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtc
A0A452E1B1_BCL2L1-      tatgcatgaaaagcatagtcaaggagatgcaggtattggtaagtcaggtc
W5PSA5_BCL2L1-01        tatgcatgaaaagcatagtcaaggagatgcaggtattggtaagtcaggtc
G3SPN0_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
H0X6V2_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
P53563_BCL2L1-03        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
P53563_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
P53563_BCL2L1-04        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
P53563_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
O35843_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
Q64373_BCL2L1-09        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
Q64373_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
Q64373_BCL2L1-03        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
Q64373_BCL2L1-04        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
B2Z3Z4_BCL2L1-01        tctgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q9MYW4_BCL2L1-01        tgtgcgtggaaagcgtggacaaggagatggaggtattggtgagtcggatc
O77737_BCL2L1-01        tgtgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A286Y5D6_BCL2L1-      tgtgcgtggagagcgtagacaaggagatgcaggtattggtgaggcggatc
G1P9D2_BCL2L1-01        tgtgcgtggaaagtgtggacaaggagatgcaggtattggtgagtcggatt
Q05KJ0_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q05KJ0_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A452FWV3_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q9MZS7_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F6WQI0_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2U3V0P1_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
A0A1L5BWY3_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A287CZ07_BCL2L1-      tgtgcatggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
I3MUP5_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
I3MUP5_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
I3MUP5_BCL2L1-03        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F6WQI0_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
E2IV76_BCL2L1-01        tatgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6G3C5_BCL2L1-      tctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6G3C5_BCL2L1-      tctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatc
G1RER8_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
A0A2J8VIH3_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatt
Q07817_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q07817_BCL2L1-03        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
G3RY91_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5H963_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5H963_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
Q2PFS6_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5M8B1_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5M8B1_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6LPM4_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6QFA2_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5VPG2_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F6UKR4_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5YR37_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5YR37_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5VPG2_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F6UKR4_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A0D9RJZ8_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
I7GKS6_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6LPM4_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6QFA2_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K6QFA2_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatc
E2IV77_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatc
A0A2K6UWY8_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatc
A0A2K5EBP4_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
E2IV75_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F7IT34_BCL2L1-02        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
F7IT34_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A2K5EBP4_BCL2L1-      tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
M3Z2H9_BCL2L1-01        tgtgtgtggagagcgtagacaaggagatgcaggcattggtgagtcggatc
Q76LT7_BCL2L1-01        tgtgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatc
Q8SQ42_BCL2L1-01        tgtgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatc
M3XA94_BCL2L1-01        tgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A452SDS4_BCL2L1-      tgtgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A384D3U1_BCL2L1-      tgtgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatc
A0A452ILL8_BCL2L1-      tgtgtgtggagagtgtcgacaaggagatgcaggtgttggttggacgcatc
A0A452ILL8_BCL2L1-      tgtgtgtggagagtgtcgacaaggagatgcaggtgttggttggacgcatc
K7F655_BCL2L1-01        tgtgcgtggagagtgtggacaaggagatgcaggtgttggtgggacgcatc
U3JSL7_BCL2L1-01        tgtgcgtggagagcgttgttaaggagatgcgggtattggtgaaacgcatc
Q4U2V6_BCL2L1-01        tgtgcgtggagagcgttgttaaggagatgagggtattggtgaaacgcatc
H0Z8G3_BCL2L1-01        tgtgcgtggagagcgttgttaaggagatgagggtattggtgaaacgcatc
Q07816_BCL2L1-04        tgtgcgtggagagcgtggacaaggagatgcgggtactggtgggacgcatt
Q07816_BCL2L1-03        tgtgcgtggagagcgtggacaaggagatgcgggtactggtgggacgcatt
Q07816_BCL2L1-02        tgtgcgtggagagcgtggacaaggagatgcgggtactggtgggacgcatt
Q07816_BCL2L1-01        tgtgcgtggagagcgtggacaaggagatgcgggtactggtgggacgcatt
G1N5N5_BCL2L1-01        tgtgcgtggagagcgtggacaaggagatgcgggtactggtgggacgcatt
H3ANS8_BCL2L1-01        tgtgtgtggagagtatggacaaggagatgtcttcactagtagagcggatc
A0A3B5K6B9_BCL2L1-      tctgtgtggagtgtgttgagaaggagatgagtcccctggtgggccggatt
A0A3B5K6B9_BCL2L1-      tctgtgtggagtgtgttgagaaggagatgagtcccctggtgggccggatt
H3CH49_BCL2L1-01        tgtgtgtggagtgtgtggagaaggagatgaatcctctggttggccggatc
C1BLI0_BCL2L1-01        tttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtatt
A0A3P8XFS0_BCL2L1-      tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtatt
A0A3P8XFS0_BCL2L1-      tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtatt
A0A286MU87_BCL2L1-      tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatc
C0HAD8_BCL2L1-01        tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatc
A0A345BSW9_BCL2L1-      tgtgcgtcgagtgtgtggagaaggagatgagcccattagtgggacgcatt
Q90Z98_BCL2L1-01        tgtgcgtcgagtgtgtggagaaggagatgagtccgcttgtgggacgcatc
Q90Z98_BCL2L1-02        tgtgcgtcgagtgtgtggagaaggagatgagtccgcttgtgggacgcatc
A0A059PJI5_BCL2L1-      tctgtgtcgagtgtgtggaaaaggagatgagtccgctggtggcacgtatc
A0A3B3ZN55_BCL2L1-      tcgctgtggagtgtgtggacaaagagatgagcaccctagtggctcgcatc
A0A3B3ZN55_BCL2L1-      tcgctgtggagtgtgtggacaaagagatgagcaccctagtggctcgcatc
D2ITA2_BCL2L1-02        tctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtg
A0A3P8UWG7_BCL2L1-      tgagtgtcgagtgcgtggagaaagagatgagtcagctggtggccaggatt
A0A3B3QRZ2_BCL2L1-      tgtgcgtggagtgtgtggagaaggagatgggccacctggtggatcgtatt
A0A3B1JJ42_BCL2L1-      tgtgtgtggagtgcgtggagaaggagatgagccccctggtgggacgcatc
A0A3B4DTL9_BCL2L1-      tgtgcgtggagtgtgtggaaaaggagatgagcccactcgtgggacgcatc
A0A3P8XYL5_BCL2L1-      tctgtgtagagtgcgtggagaaggagatgagcccccttgtgggacggatt
B5XAY3_BCL2L1-01        tctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatc
A0A3B3TFR4_BCL2L1-      tgtgcgtggagtgtgtcgagaaggagatgagcccgctggtgggccacatt
A0A3Q3DUT7_BCL2L1-      tgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatc
A0A3Q3DUT7_BCL2L1-      tgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatc
A0A3Q3DUT7_BCL2L1-      tgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatc
W5MG74_BCL2L1-01        tgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcata
A0A3Q3WIW8_BCL2L1-      tgtgcgtagagtgcgttgagaaggagatgagtccactggtgggcaggatc
A0A2U9BY16_BCL2L1-      tgagtgtggagtgtgtggagaaggagatgagttcgctggtgggcaggatc
A0A3B5PQJ0_BCL2L1-      tgtgcgtggagtgcgtggagaaggagatgagccacctggtagccaggatt
A0A3P9N9Y4_BCL2L1-      tctgcgtggagtgtgtggagaaggagatgagccacctggtagccaggatt
A0A3B3WI27_BCL2L1-      tctgcgtggagtgtgtggagaaggagatgagccacctggtagccaggatt
A0A087X9B7_BCL2L1-      tctgcgtggaatgcgttgagaaggagatgagccacctggtagccaggatt
A0A3B3TUS7_BCL2L1-      tctgcgtggaatgcgttgagaaggagatgagccacctggtagccaggatt
A0A3Q2FR43_BCL2L1-      tgtgcgtggaatgcgtggagaaggagatgagtcccctggtggggcggatc
A0A3Q2QPL9_BCL2L1-      tctgcgtggagtgcgtggagaaggagatgagtcccctggtgggccgcatc
A0A3Q3B3X5_BCL2L1-      tgtgcgtcgagtgcgtcgagaaggagatgagtcacctggtggccaggatt
A0A3Q0RTF8_BCL2L1-      tgtgtgtcgagtgtgtcgagaaggagatgagccccctggtgggcaggatc
I3IZK7_BCL2L1-01        tgtgtgttgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3Q4N4B5_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3Q2X557_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3P8P0F1_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3P9D632_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3P9D632_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
A0A3B4FNX1_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccttggtgggcaggatc
G3NJY1_BCL2L1-01        tgtgcgtggagtgcgtggacaaggagatgagtccgctggtgggcaggatc
A0A3B3IB64_BCL2L1-      tgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccggatt
A0A3P9JYH1_BCL2L1-      tgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccggatt
A0A3B3DHA1_BCL2L1-      tgtgcgtcgagtgcgtggagaaggagatgagccccctggtggacaggatt
C3VIT1_BCL2L1-01        tgtgcgtggagtgcgtggagagggagatgagccccttggtgggcaggatc
A0A3B4Z3X2_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
A0A3B4Z3X2_BCL2L1-      tgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
A0A3Q1GS47_BCL2L1-      tgtgcgtcgagtgcgtggaaaaggagatgagccccctggtgggcaggatc
A0A3Q1GS47_BCL2L1-      tgtgcgtcgagtgcgtggaaaaggagatgagccccctggtgggcaggatc
A0A3Q1DHJ3_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
A0A3Q1DHJ3_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
A0A3Q1DHJ3_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
A0A3P8TL99_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
A0A3P8TL99_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
A0A219P0Y3_BCL2L1-      tgtgcgtggagtgcgttgagaaggagatgagtccgttggtgggcaggatc
A0A3Q3G2E1_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcaggatc
A0A3Q3G2E1_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcaggatc
A0A3Q3G2E1_BCL2L1-      tgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcaggatc
A0A3B4V3T1_BCL2L1-      tgtgtgtcgagtgtgtggagaaggagatgagtcctctggtgggcaggatc
A0A3B4XU17_BCL2L1-      tgtgtgtcgagtgtgtggagaaggagatgagtcctctggtgggcaggatc
A0A3Q3IVF5_BCL2L1-      tgtgtgtcgagtgtgtggagaaagagatgagtccgctggtgggtaggatt
A0A3Q3MX20_BCL2L1-      tgtgtgtcgagtgtgtggagaaggagatgagtccactggtgggcaggatt
A0A3Q1GZ93_BCL2L1-      tgtgcgtcgagtgtgtggagaaggagatgagtcagctggtgggaaggatc
A0A3Q1GZ93_BCL2L1-      tgtgcgtcgagtgtgtggagaaggagatgagtcagctggtgggaaggatc
A0A3Q1GZ93_BCL2L1-      tgtgcgtcgagtgtgtggagaaggagatgagtcagctggtgggaaggatc
A0A0D6DR75_BCL2L1-      tgtgtgttgagtgtgtggagaaggagatgagtcagctggtggtcaggatc
A0A3B3E2W4_BCL2L1-      tgtgtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcatt
A0A3B3ICL7_BCL2L1-      tgtgtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcatt
A0A3B3ICL7_BCL2L1-      tgtgtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcatt
A0A3B4BFZ8_BCL2L1-      tgagtgtggagtgtgtggagaaggatatgagcattctggttcctcgcatt
A0A3P8VMA1_BCL2L1-      tgtgtgtggaatgtgtgcagaggaatatgagtgagttagttccccgcatt
A0A0F7L1T6_BCL2L1-      tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcatt
H2U5I3_BCL2L1-01        tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcatt
H2U5I3_BCL2L1-02        tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcatt
G3P7B4_BCL2L1-01        tctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatc
A0A3Q3FUB6_BCL2L1-      tgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatc
A0A3Q3X5M5_BCL2L1-      tatgtgtggaatgtgctgagaaggatacaggtgagcttgtttgccgcatt
A0A2U9BIG9_BCL2L1-      tgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgcccgtatc
A0A3Q1JZ46_BCL2L1-      tgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatc
A0A3Q1JZ46_BCL2L1-      tgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatc
A0A3Q3NFM4_BCL2L1-      tgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatc
A0A3Q3NFM4_BCL2L1-      tgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatc
A0A3Q3J5K3_BCL2L1-      tgtgtgtggaatgcgtcgagaagaatatgagtgagctggtgtcccgcatc
A0A3B4V9K8_BCL2L1-      tgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatc
A0A3B4XS24_BCL2L1-      tgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatc
A0A3B5B4X7_BCL2L1-      tgtgtgtggaatgcgtagacaagaatatgaacgagctggttccccgcatc
A0A3Q1EVP6_BCL2L1-      tgtgtgtggaatgcgtagagaagaatatgagtgagctggttccccgcatc
A0A3Q1BQA0_BCL2L1-      tgtgtgtggaatgcgtagagaagaatatgagtgagctggttccccgcatc
A0A3P8U812_BCL2L1-      tgtgtgtggaatgcgtagataagaatatgagtgagctggttccccgcatc
E6ZFR0_BCL2L1-01        tgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatc
A0A0B4KJI5_BCL2L1-      tgtgtgtggaatgcgttgagaaggatacgagcgagctggtctcccgcatc
A0A3Q3BEB7_BCL2L1-      tgtgcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcatt
A0A3Q2C6K4_BCL2L1-      tgtgtgtgcactgcgtgcagaagaatatgagtgagttggtgtcccgcatt
A0A3Q2NRP4_BCL2L1-      tgtgtgtggactgcgtccagaagaacatgagcgagctggtgccccgcatc
A0A3B5MGS2_BCL2L1-      tgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcatt
M4A558_BCL2L1-01        tgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcatt
A0A3P9QFB3_BCL2L1-      tgtgtgtggactgcgtccagaagaatatgagcgagctggtctcccgcatt
A0A3B3XN57_BCL2L1-      tgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcatt
A0A087YBW4_BCL2L1-      tgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcatt
A0A3B3VWI7_BCL2L1-      tgtgtgtggattgcgttcagaagaatatgagcgagctggtctcccgcatt
                                                                          

R4JQR8_BCL2L1-01        gttgactgggtatctacctatttgtgtaatagtttagagcaatggattac
A0A346RRN1_BCL2L1-      gttgactgggtttctgtatatttatgtgataatttagaaccatggattac
Q6GLI5_BCL2L1-01        gtgcaatggatggtgcagtacctggagcatacgctgcagccctggatgct
Q2TAP5_BCL2L1-01        gtccagtggatggtgaattatctagagcacacactgcagccctggatgca
Q91828_BCL2L1-01        gtccagtggatggtgaattatctagagcacacactgcagccctggatgca
H9GHK7_BCL2L1-01        gccagctggatgaccacgtacctgactgaacacctggacccctggatcca
F6WA14_BCL2L1-01        acctcctggatggccacttacttggatgaccacctagacccttggatcca
G3WKX6_BCL2L1-01        acctcctggatggccacttacttggatgagcacctagacccatggatcca
A0A452FIG6_BCL2L1-      atgacttggatggccagccagctaaatgaccacctagagccttggatcca
A0A452FIG6_BCL2L1-      atgacttggatggccagccagctaaatgaccacctagagccttggatcca
A0A3Q1LRT3_BCL2L1-      acaacttcaacggccacttacctaaataaccacctcaagccttggatcca
A0A452E1B1_BCL2L1-      acgacttggatggccacttacctaaataaccacctagagccttggatcca
W5PSA5_BCL2L1-01        acgacttggatggccacttacctaaatgaccacctagagccttggatcca
G3SPN0_BCL2L1-01        gcaacttggatggctacttacctgaatgaccacctagagccttggatcca
H0X6V2_BCL2L1-01        gcagcttggatggccacttacttgaatgaccacctagagccttggatcca
P53563_BCL2L1-03        gcaagttggatggccacctacctgaatgaccacctagagccttggatcca
P53563_BCL2L1-02        gcaagttggatggccacctacctgaatgaccacctagagccttggatcca
P53563_BCL2L1-04        gcaagttggatggccacctacctgaatgaccacctagagccttggatcca
P53563_BCL2L1-01        gcaagttggatggccacctacctgaatgaccacctagagccttggatcca
O35843_BCL2L1-01        gcaagttggatggccacctatctgaatgaccacctagagccttggatcca
Q64373_BCL2L1-09        gcaagttggatggccacctatctgaatgaccacctagagccttggatcca
Q64373_BCL2L1-01        gcaagttggatggccacctatctgaatgaccacctagagccttggatcca
Q64373_BCL2L1-03        gcaagttggatggccacctatctgaatgaccacctagagccttggatcca
Q64373_BCL2L1-04        gcaagttggatggccacctatctgaatgaccacctagagccttggatcca
B2Z3Z4_BCL2L1-01        gcaagttggatggccacctacctgaatgaccacctagagccttggatcca
Q9MYW4_BCL2L1-01        gcggcgtggatggccacttacctgaatgaccacctggagccctggatcca
O77737_BCL2L1-01        gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
A0A286Y5D6_BCL2L1-      gcaagctggatggctacttacctgaatgaccacctagaaccttggatcca
G1P9D2_BCL2L1-01        gcaacgtggatggccacttacctgaatgaccacctagagccttggatcca
Q05KJ0_BCL2L1-02        gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
Q05KJ0_BCL2L1-01        gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
A0A452FWV3_BCL2L1-      gcaacttggatggctacttacctgaatgaccacctagagccttggatcca
Q9MZS7_BCL2L1-01        gcaacttggatggctacttacctgaatgaccacctagagccttggatcca
F6WQI0_BCL2L1-02        gcaacctggatggccacttacctgaatgaccacctagagccttggatcca
A0A2U3V0P1_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A1L5BWY3_BCL2L1-      gcaagttggatggctacttacctgaatgaccacctagaaccttggatcca
A0A287CZ07_BCL2L1-      gcaagttggat---------------------------gccttggatcca
I3MUP5_BCL2L1-01        gcaagttggatggccacttacctgaatgaccacctagagccttggatcca
I3MUP5_BCL2L1-02        gcaagttggatggccacttacctgaatgaccacctagagccttggatcca
I3MUP5_BCL2L1-03        gcaagttggatggccacttacctgaatgaccacctagagccttggatcca
F6WQI0_BCL2L1-01        gcaacctggatggccacttacctgaatgaccacctagagccttggatcca
E2IV76_BCL2L1-01        gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K6G3C5_BCL2L1-      gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K6G3C5_BCL2L1-      gcaacttggatggccacttacctgaatgaccacctagagccttggatcca
G1RER8_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2J8VIH3_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
Q07817_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
Q07817_BCL2L1-03        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
G3RY91_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5H963_BCL2L1-      gcaacttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K5H963_BCL2L1-      gcaacttggatggccacttatctgaatgaccacctagagccttggatcca
Q2PFS6_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5M8B1_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5M8B1_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K6LPM4_BCL2L1-      gcagcttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K6QFA2_BCL2L1-      gcagcttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K5VPG2_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
F6UKR4_BCL2L1-02        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5YR37_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5YR37_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5VPG2_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
F6UKR4_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A0D9RJZ8_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
I7GKS6_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K6LPM4_BCL2L1-      gcagcttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K6QFA2_BCL2L1-      gcagcttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K6QFA2_BCL2L1-      gcagcttggatggccacttatctgaatgaccacctagagccttggatcca
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
E2IV77_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K6UWY8_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5EBP4_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
E2IV75_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
F7IT34_BCL2L1-02        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
F7IT34_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
A0A2K5EBP4_BCL2L1-      gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
M3Z2H9_BCL2L1-01        gcaacttggatggccacttacctgaacgaccacctagagccttggatcca
Q76LT7_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
Q8SQ42_BCL2L1-01        gcagcttggatggccacttacctgaatgaccacctagagccttggatcca
M3XA94_BCL2L1-01        gcaacttggatggccacttacctgaacgaccacctagagccttggatcca
A0A452SDS4_BCL2L1-      gcaacttggatggccacttacctgaacgaccacctagagccttggatcca
A0A384D3U1_BCL2L1-      gcaacttggatggccacttacctgaacgaccacctagagccttggatcca
A0A452ILL8_BCL2L1-      gtctcatggatgaccacttacctgactgaccacctagatccctggatcca
A0A452ILL8_BCL2L1-      gtctcatggatgaccacttacctgactgaccacctagatccctggatcca
K7F655_BCL2L1-01        gcctcttggatgaccacttacctgactgaccaccttgatccctggatcca
U3JSL7_BCL2L1-01        gtgtcttggatgaccacgtacttgaccgaccacttagatccctggatcca
Q4U2V6_BCL2L1-01        gtgtcttggatgaccacgtacttgaccgaccacttagatccctggatcca
H0Z8G3_BCL2L1-01        gtctcttggatgaccacgtacttgaccgaccacttagatccctggatcca
Q07816_BCL2L1-04        gtgtcttggatgaccacgtacttgaccgaccatctagatccctggatcca
Q07816_BCL2L1-03        gtgtcttggatgaccacgtacttgaccgaccatctagatccctggatcca
Q07816_BCL2L1-02        gtgtcttggatgaccacgtacttgaccgaccatctagatccctggatcca
Q07816_BCL2L1-01        gtgtcttggatgaccacgtacttgaccgaccatctagatccctggatcca
G1N5N5_BCL2L1-01        gtgtcttggatgaccacgtacttgaccgaccatctagacccctggatcca
H3ANS8_BCL2L1-01        gctgagtggatgacgacttacctagatgataacttaaacccttggattca
A0A3B5K6B9_BCL2L1-      atagagtggatgacagtctatcttgacaaccacattcaaccatggatcca
A0A3B5K6B9_BCL2L1-      atagagtggatgacagtctatcttgacaaccacattcaaccatggatcca
H3CH49_BCL2L1-01        atagagtggatgacggtctatctggacaaccacatccagccctggatcca
C1BLI0_BCL2L1-01        gcagattggatgaccacctacctggacaaccacatccagccatggataca
A0A3P8XFS0_BCL2L1-      gcagactggatgaccacctacctggacgaacacatccagccctggatcca
A0A3P8XFS0_BCL2L1-      gcagactggatgaccacctacctggacgaacacatccagccctggatcca
A0A286MU87_BCL2L1-      gcagattggatgaccacctatctggacaaccatatccagccctggatcca
C0HAD8_BCL2L1-01        gcagactggatgaccacctacctggacaaccatatccagccctggatcca
A0A345BSW9_BCL2L1-      gcagaatggatgaccgtctacctggacaaccacattcagccctggatcca
Q90Z98_BCL2L1-01        gcagaatggatgaccgtctacctagacaaccatattcaaccctggatcca
Q90Z98_BCL2L1-02        gcagaatggatgaccgtctacctagacaaccatattcaaccctggatcca
A0A059PJI5_BCL2L1-      gccgagtggatgaccgtctacctggacaaccacatccagccctggattga
A0A3B3ZN55_BCL2L1-      gtcacctggatgactgtgtatctggacgaacacatccaagactggatcga
A0A3B3ZN55_BCL2L1-      gtcacctggatgactgtgtatctggacgaacacatccaagactggatcga
D2ITA2_BCL2L1-02        gcagagtggatgaccaggtacctggacgaccacattgaccactggatcca
A0A3P8UWG7_BCL2L1-      gcggattggatgacagtctatcttgacaaccacatccagccatggatcga
A0A3B3QRZ2_BCL2L1-      gctgactggatgaccgtttacctggacagcaacatccagccctggatcca
A0A3B1JJ42_BCL2L1-      gcagagtggatgaccgtctacttggacaaccacatccagccctggatcca
A0A3B4DTL9_BCL2L1-      gcagagtggatgactgtctacttggacaaccatatccagccctggatcca
A0A3P8XYL5_BCL2L1-      gctgactggatgaccgtctacctggataaccacatccagccctggatcga
B5XAY3_BCL2L1-01        acagactggatgaccgtctacctggacaaccacatccagccctggatcca
A0A3B3TFR4_BCL2L1-      gtggactggatgaccgtctacttggacaaccatatccagccctggattca
A0A3Q3DUT7_BCL2L1-      atcgagtggatgacggtgtacctggacaaccaccttcagccctggataga
A0A3Q3DUT7_BCL2L1-      atcgagtggatgacggtgtacctggacaaccaccttcagccctggataga
A0A3Q3DUT7_BCL2L1-      atcgagtggatgacggtgtacctggacaaccaccttcagccctggataga
W5MG74_BCL2L1-01        gccgagtggatgaccgtctacctggacaacaacattcagccctggatcca
A0A3Q3WIW8_BCL2L1-      atcgagtggatgacggtctatctggacaaccaaatccagccctggatcga
A0A2U9BY16_BCL2L1-      gttgagtggatgacggtgtacctagacaacaacatccagccctggatcca
A0A3B5PQJ0_BCL2L1-      gtagagtggatgaccgtctacctggatgagcagattgaaccttgggtaga
A0A3P9N9Y4_BCL2L1-      gtagagtggatgaccgtctacctggatgagcggattgaaccttgggtgga
A0A3B3WI27_BCL2L1-      gtagagtggatgaccgtctacttggatgagcggattgaaccttgggtgga
A0A087X9B7_BCL2L1-      gtagagtggatgaccgtctacttggatgagcggattgaaccttgggtgga
A0A3B3TUS7_BCL2L1-      gtagagtggatgaccgtctacttggatgagcggattgaaccttgggtgga
A0A3Q2FR43_BCL2L1-      gtggagtggatgaccgtctacttggatgagcagatcgatccctggatcca
A0A3Q2QPL9_BCL2L1-      gtggagtggatgaccgtctacctggacgagcagatcgacccctggatcca
A0A3Q3B3X5_BCL2L1-      gtggagtggatgaccgtctacctggacaaccacattcagccttggattca
A0A3Q0RTF8_BCL2L1-      gtagagtggatgacagtctacctagacaaccacattcagccctggatcca
I3IZK7_BCL2L1-01        gtagagtggatgaccgtctacctagacaaccacattcagccctggatcca
A0A3Q4N4B5_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
A0A3Q2X557_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
A0A3P8P0F1_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
A0A3P9D632_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
A0A3P9D632_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
A0A3B4FNX1_BCL2L1-      gtagagtggatgacggtctacctagacaaccacattcagccctggatcca
G3NJY1_BCL2L1-01        gtcgagtggatgacgctctacctggacaaccacattcagccctggatcca
A0A3B3IB64_BCL2L1-      gtggagtggatgaccgtctacctggacaaccacatccagccctggatcca
A0A3P9JYH1_BCL2L1-      gtggagtggatgaccgtctacctggacaaccacatccagccctggatcca
A0A3B3DHA1_BCL2L1-      gtggagtggatgaccgtctacctggacaaccacatccagccgtggatcca
C3VIT1_BCL2L1-01        gtggagtggatgacggtctacctggacaaccacattcagccctggatcca
A0A3B4Z3X2_BCL2L1-      gtagagtggatgacggtttacctggacaaccacattcaggactggatcca
A0A3B4Z3X2_BCL2L1-      gtagagtggatgacggtttacctggacaaccacattcaggactggatcca
A0A3Q1GS47_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3Q1GS47_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3Q1DHJ3_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3Q1DHJ3_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3Q1DHJ3_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3P8TL99_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A3P8TL99_BCL2L1-      gtagagtggatgaccgtctacctggacaaccacattcaggactggatcca
A0A219P0Y3_BCL2L1-      atagagtggaagacccgctatctggacaaccacattcagccctggatcca
A0A3Q3G2E1_BCL2L1-      atagagtggatgactgtctacctggacaaccgaattcaaccttggatcga
A0A3Q3G2E1_BCL2L1-      atagagtggatgactgtctacctggacaaccgaattcaaccttggatcga
A0A3Q3G2E1_BCL2L1-      atagagtggatgactgtctacctggacaaccgaattcaaccttggatcga
A0A3B4V3T1_BCL2L1-      gtagagtggatgaccgtctacctggacaaccgcattcagccatggatcca
A0A3B4XU17_BCL2L1-      gtagagtggatgaccgtctacctggacaaccgcattcagccatggatcca
A0A3Q3IVF5_BCL2L1-      gtagagtggatgacagtctacctggataaccacattcagccctggatcca
A0A3Q3MX20_BCL2L1-      gtggagtggatgaccctctacctggacaaccacattgagccctggatcca
A0A3Q1GZ93_BCL2L1-      gtagagtggatgacagtctacctggacaaccacattcagccctggatcca
A0A3Q1GZ93_BCL2L1-      gtagagtggatgacagtctacctggacaaccacattcagccctggatcca
A0A3Q1GZ93_BCL2L1-      gtagagtggatgacagtctacctggacaaccacattcagccctggatcca
A0A0D6DR75_BCL2L1-      gtagagtggatgacagtgtacctggacgaccacattcagccctggatcca
A0A3B3E2W4_BCL2L1-      gctgaatggatgaccatgtacctagacgagcaaataagtccatggatcca
A0A3B3ICL7_BCL2L1-      gctgaatggatgacccagtacctggatgagcaaataagtccatggatcca
A0A3B3ICL7_BCL2L1-      gctgaatggatgacccagtacctggatgagcaaataagtccatggatcca
A0A3B4BFZ8_BCL2L1-      gctaactggatgactatctacctggatgagaatatcgccacgtggattca
A0A3P8VMA1_BCL2L1-      gcagactggatgaccatgtacttggatgaatacattgatccatggatcca
A0A0F7L1T6_BCL2L1-      gcagactggatgaccatttacctggatgagcatattaacccgtggatcca
H2U5I3_BCL2L1-01        gcagactggatgaccatttacctggatgagcatattaacccgtggatcca
H2U5I3_BCL2L1-02        gcagactggatgaccatttacctggatgagcatattaacccgtggatcca
G3P7B4_BCL2L1-01        gcggactggatgaccacgtacctggacgagcacatcagtgcttggatcca
A0A3Q3FUB6_BCL2L1-      gcaggctggatgactacgtacctggatgagcacattagtgcatggatcga
A0A3Q3X5M5_BCL2L1-      gcagactggatgaccacttacctggatgagcatattaatccgtggatcca
A0A2U9BIG9_BCL2L1-      gctgactggatgaccatgtacctggatgagcacatcagcccctggatcca
A0A3Q1JZ46_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtccttggatcca
A0A3Q1JZ46_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtccttggatcca
A0A3Q3NFM4_BCL2L1-      gcagattggatgaccatgtatctggatgagcacatcagtccgtggatcga
A0A3Q3NFM4_BCL2L1-      gcagattggatgaccatgtatctggatgagcacatcagtccgtggatcga
A0A3Q3J5K3_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A3B4V9K8_BCL2L1-      acagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A3B4XS24_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A3B5B4X7_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtctgtggatcca
A0A3Q1EVP6_BCL2L1-      gctgactggatgaccatgtacctggatgagcacatcagtccctggatcca
A0A3Q1BQA0_BCL2L1-      gctgactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A3P8U812_BCL2L1-      gctgactggatgaccatgtacctggatgagcacatcagtccgtggatcca
E6ZFR0_BCL2L1-01        gcagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A0B4KJI5_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcaatccgtggattga
A0A3Q3BEB7_BCL2L1-      gcagactggatgaccgtttacctggatgagcagatcggtccgtggatcga
A0A3Q2C6K4_BCL2L1-      gcagactggatgaccatttacctagatgagcagcttaacccttggatcca
A0A3Q2NRP4_BCL2L1-      gcagactggatgaccatttacctggatgagcagctcgacccctgggtccg
A0A3B5MGS2_BCL2L1-      gccgaatggatgaccacttacctggacgagcagctcagtccctggatcca
M4A558_BCL2L1-01        gccgaatggatgaccacttacctggatgagcagctcagtccctggatcca
A0A3P9QFB3_BCL2L1-      gctgaatggatgaccacttacttggacgagcagctcaatccctggatcca
A0A3B3XN57_BCL2L1-      gccgaatggatgaccacttacctggacgagcagctcaatccctggatcca
A0A087YBW4_BCL2L1-      gccgaatggatgaccacttacctggacgagcagctcaatccctggatcca
A0A3B3VWI7_BCL2L1-      gccgaatggatgaccacttacctggacgagcagctcaatccctggatcca
                                                                          

R4JQR8_BCL2L1-01        agataacggtggttgg---ca-----------------aggatttgtgga
A0A346RRN1_BCL2L1-      ttcaaatggtggctgg---ca-----------------gggctttgtgga
Q6GLI5_BCL2L1-01        ggagaacggaggctgg---ga-----------------agcttttgtcgg
Q2TAP5_BCL2L1-01        ggagaatggaggctgg---ga-----------------agcttttgtcgg
Q91828_BCL2L1-01        ggagaatggaggctgg---ga-----------------agcttttgtcgg
H9GHK7_BCL2L1-01        agaaaacggtggctgg---aa-----------------------------
F6WA14_BCL2L1-01        agaaaatggcggctgg---ga-----------------cacctttgtgga
G3WKX6_BCL2L1-01        agaaaatggcggttgg---ga-----------------caccttcgtgga
A0A452FIG6_BCL2L1-      ggagaatggcggctgg---ga-----------------cacttctgtgga
A0A452FIG6_BCL2L1-      ggagaatggcggctgg---ga-----------------cacttctgtgga
A0A3Q1LRT3_BCL2L1-      agagaacggcgggtgg---ga-----------------cacttttgtgga
A0A452E1B1_BCL2L1-      ggagaatggcgactgg---ga-----------------catttttgtgga
W5PSA5_BCL2L1-01        ggagaatggcgactgg---ga-----------------catttttgtgga
G3SPN0_BCL2L1-01        ggagaacggcggctgg---gt------aaggaccacgccccttttgtgc-
H0X6V2_BCL2L1-01        ggagaacggcggctggtggaggtgtcaggcctttccagagcttct-----
P53563_BCL2L1-03        ggagaacggcggctgg---gt------aagaaccacgccccttgtgtgtc
P53563_BCL2L1-02        ggagaacggcggctgg---gt------aagaaccacgccccttgtgtgtc
P53563_BCL2L1-04        ggagaacggcggctgg---gt------aagaaccacgccccttgtgtgtc
P53563_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
O35843_BCL2L1-01        ggagaacggcggctgg---ggtgtgagtggaggtacacccctcagatctg
Q64373_BCL2L1-09        ggagaacggcggctgg---ga-----------------cacttttgtgga
Q64373_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
Q64373_BCL2L1-03        ggagaacggcggctgg---g------------------------------
Q64373_BCL2L1-04        ggagaacggcggctgg---g------------------------------
B2Z3Z4_BCL2L1-01        ggacaacggcggctgg---ga-----------------cactttcgtgga
Q9MYW4_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacgtttgtgga
O77737_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A286Y5D6_BCL2L1-      ggacaacggcggctgg---ga-----------------cacttttgtgga
G1P9D2_BCL2L1-01        ggagaacggaggctgg---ga-----------------cacttttgtgga
Q05KJ0_BCL2L1-02        ggagaacggcggctgg---ga-----------------cacttttgtgga
Q05KJ0_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A452FWV3_BCL2L1-      ggagaacggcggctgg---ga-----------------cacgtttgtgga
Q9MZS7_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacgtttgtgga
F6WQI0_BCL2L1-02        agagaacggcggctggaaaga-----------------aactgctttggg
A0A2U3V0P1_BCL2L1-      ggagaacggcggctgg---ga-----------------cactttcgtgga
A0A1L5BWY3_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A287CZ07_BCL2L1-      agagaacggcggctgg---ga-----------------cacttttgtgga
I3MUP5_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
I3MUP5_BCL2L1-02        ggagaacggcggctgg---ga-----------------cacttttgtgga
I3MUP5_BCL2L1-03        ggagaacggcggctgg---ga-----------------cacttttgtgga
F6WQI0_BCL2L1-01        agagaacggcggctgg---ga-----------------cacctttgtgga
E2IV76_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6G3C5_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6G3C5_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
G1RER8_BCL2L1-01        ggagaacggcggctgg---ga-----------------tacttttgtgga
A0A2J8VIH3_BCL2L1-      ggagaacggcggctgg---ga-----------------tacttttgtgga
Q07817_BCL2L1-01        ggagaacggcggctgg---ga-----------------tacttttgtgga
Q07817_BCL2L1-03        ggagaacggcggctgg---ga-----------------tacttttgtgga
Q07817_BCL2L1-02        ---------------g---ga-----------------tacttttgtgga
G3RY91_BCL2L1-02        ggagaacggcggctgg---ga-----------------tacttttgtgga
G3RY91_BCL2L1-01        ggagaacggcggctgg---ga-----------------tacttttgtgga
A0A2K5H963_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5H963_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
Q2PFS6_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5M8B1_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5M8B1_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6LPM4_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6QFA2_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5VPG2_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
F6UKR4_BCL2L1-02        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5YR37_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5YR37_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5VPG2_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
F6UKR4_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A0D9RJZ8_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
I7GKS6_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6LPM4_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6QFA2_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6QFA2_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5YR37_BCL2L1-      ---------------g---ga-----------------cacttttgtgga
A0A2K6UWY8_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
E2IV77_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K6UWY8_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5EBP4_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
E2IV75_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
F7IT34_BCL2L1-02        ggagaacggcggctgg---ga-----------------cacttttgtgga
F7IT34_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A2K5EBP4_BCL2L1-      ggagaacggcggctgg---ga-----------------cacttttgtgga
M3Z2H9_BCL2L1-01        ggagaacggcggctgg---ga-----------------cactttcgtgga
Q76LT7_BCL2L1-01        ggagaacggcggctgg---ga-----------------tacttttgtgga
Q8SQ42_BCL2L1-01        ggagaacggcggctgg---ga-----------------tacttttgtgga
M3XA94_BCL2L1-01        ggagaacggcggctgg---ga-----------------cacttttgtgga
A0A452SDS4_BCL2L1-      ggagaacggcggctgg---ga-----------------cactttcgtgga
A0A384D3U1_BCL2L1-      ggagaacggcggctgg---ga-----------------cactttcgtgga
A0A452ILL8_BCL2L1-      agagaatggcggttgg---ga-----------------gcggtttgtgga
A0A452ILL8_BCL2L1-      agagaatggcggttgg---ga-----------------gcggtttgtgga
K7F655_BCL2L1-01        agagaatggcggttgg---ga-----------------gcgctttgtgga
U3JSL7_BCL2L1-01        ggagaatggcggatgg---ga-----------------gcgctttgtgga
Q4U2V6_BCL2L1-01        ggagaatggcggatgg---ga-----------------gcgctttgtgga
H0Z8G3_BCL2L1-01        ggagaatggcggatgg---ga-----------------gcgctttgtgga
Q07816_BCL2L1-04        ggagaatggcggctgg---ga-----------------gcgctttgtgga
Q07816_BCL2L1-03        ggagaatggcggctgg---ga-----------------gcgctttgtgga
Q07816_BCL2L1-02        ggagaatggcggctgg---ga-----------------gcgctttgtgga
Q07816_BCL2L1-01        ggagaatggcggctgg---ga-----------------gcgctttgtgga
G1N5N5_BCL2L1-01        ggagaatggcggctgg---ga-----------------gcgctttgtgga
H3ANS8_BCL2L1-01        ggaacaaggaggatgg---gc-----------------aaccataataca
A0A3B5K6B9_BCL2L1-      gagtcaaggaggatgg---gt-----------------ccgttttgctga
A0A3B5K6B9_BCL2L1-      gagtcaaggaggatgg---gt-----------------ccgttttgctga
H3CH49_BCL2L1-01        gagtcaaggaggatgg---ga-----------------acgttttgctga
C1BLI0_BCL2L1-01        gagacagggtggatgg---ga-----------------ccgatttgctga
A0A3P8XFS0_BCL2L1-      aattcaaggaggatgg---ga-----------------tcgttttgctga
A0A3P8XFS0_BCL2L1-      aattcaaggaggatgg---ga-----------------tcgttttgctga
A0A286MU87_BCL2L1-      gagccaaggcggatgg-----------------------------gcaga
C0HAD8_BCL2L1-01        gagccaaggaggatgg---ga-----------------ccgttttgcaga
A0A345BSW9_BCL2L1-      gagccaaggaggatg-----------------------------------
Q90Z98_BCL2L1-01        aagccaaggaggatgg---ga-----------------acgctttgcaga
Q90Z98_BCL2L1-02        aagccaaggaggatgg---ga-----------------acgctttgcaga
A0A059PJI5_BCL2L1-      agagcaaggaggatgg---ga-----------------acggtttgcaga
A0A3B3ZN55_BCL2L1-      ctcgcaagggggatgg---gc-----------------ccgtttcgcaga
A0A3B3ZN55_BCL2L1-      ctcgcaagggggatgg---gc-----------------ccgtttcgcaga
D2ITA2_BCL2L1-02        gagcaacggaggatgg---aa-----------------acactttgctgc
A0A3P8UWG7_BCL2L1-      aacccaaggtggatgg---ga-----------------gcattttgcgga
A0A3B3QRZ2_BCL2L1-      gcggcagggaggatgg---ga-----------------ccgttttgctga
A0A3B1JJ42_BCL2L1-      ggagcaaggaggatgg---ga-----------------acgctttgcaga
A0A3B4DTL9_BCL2L1-      ggaacaaggaggatgg---ga-----------------gcgctttgcaga
A0A3P8XYL5_BCL2L1-      gagccaaggaggatgg---ga-----------------ccgttttgcaga
B5XAY3_BCL2L1-01        gagccaaggaggatgg---ga-----------------ccggtttgcaga
A0A3B3TFR4_BCL2L1-      aacccaaggaggatgg---ga-----------------tcgcttcgccga
A0A3Q3DUT7_BCL2L1-      gagccaaggaggatgg---ca-----------------acgctttgccga
A0A3Q3DUT7_BCL2L1-      gagccaaggaggatgg---ca-----------------acgctttgccga
A0A3Q3DUT7_BCL2L1-      gagccaaggaggatgg---ca-----------------acgctttgccga
W5MG74_BCL2L1-01        gagtcagggaggatgg---ga-----------------caggtttgcgga
A0A3Q3WIW8_BCL2L1-      gagccagggaggatgg---ca-----------------acgctttgccga
A0A2U9BY16_BCL2L1-      aagtcaaggaggatgg---ga-----------------gcactttgctga
A0A3B5PQJ0_BCL2L1-      aagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3P9N9Y4_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgtttcgctga
A0A3B3WI27_BCL2L1-      gagccaaggaggatgg---ga-----------------ccgtttcgctga
A0A087X9B7_BCL2L1-      gagccaaggaggatgg---ga-----------------ccgtttcgctga
A0A3B3TUS7_BCL2L1-      gagccaaggaggatgg---ga-----------------ccgtttcgctga
A0A3Q2FR43_BCL2L1-      gagccaaggaggatgg---ga-----------------acgctttgctga
A0A3Q2QPL9_BCL2L1-      gagccagggaggatgg---ga-----------------gcgctttgctga
A0A3Q3B3X5_BCL2L1-      gagtcaagggggatgg---ga-----------------gcgctttgctga
A0A3Q0RTF8_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgctttgctga
I3IZK7_BCL2L1-01        gagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3Q4N4B5_BCL2L1-      gagccaaggaggatgg---ga-----------------gcacttcgctga
A0A3Q2X557_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3P8P0F1_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3P9D632_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3P9D632_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttcgctga
A0A3B4FNX1_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttcgctga
G3NJY1_BCL2L1-01        gaaccagggaggctgg----------------------------------
A0A3B3IB64_BCL2L1-      gagccaaggcggatgg---ga-----------------gcgttttgctga
A0A3P9JYH1_BCL2L1-      gagccaaggcggatgg---ga-----------------gcgttttgctga
A0A3B3DHA1_BCL2L1-      gagccaaggcggatgg---ga-----------------gcgttttgctga
C3VIT1_BCL2L1-01        gagccagggaggatgg---ga-----------------acgcttcgctga
A0A3B4Z3X2_BCL2L1-      gagccaaggcggatgg---ga-----------------ccgcttcgctga
A0A3B4Z3X2_BCL2L1-      gagccaaggcggatgg---ga-----------------ccgcttcgctga
A0A3Q1GS47_BCL2L1-      gggccagggaggatgg---ga-----------------gcgttttgctga
A0A3Q1GS47_BCL2L1-      gggccagggaggatgg---ga-----------------gcgttttgctga
A0A3Q1DHJ3_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgttttgctga
A0A3Q1DHJ3_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgttttgctga
A0A3Q1DHJ3_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgttttgctga
A0A3P8TL99_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgttttgctga
A0A3P8TL99_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgttttgctga
A0A219P0Y3_BCL2L1-      gagccaaagaggatgg---ga-----------------gcgcttcgccga
A0A3Q3G2E1_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttctctga
A0A3Q3G2E1_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttctctga
A0A3Q3G2E1_BCL2L1-      gagccaaggaggatgg---ga-----------------gcgcttctctga
A0A3B4V3T1_BCL2L1-      gagtcaaggaggatgg---ga-----------------gcgctttgctga
A0A3B4XU17_BCL2L1-      gagtcaaggaggatgg---ga-----------------gcgatttgctga
A0A3Q3IVF5_BCL2L1-      aggccaaggaggatgg---ga-----------------gcgctttgctga
A0A3Q3MX20_BCL2L1-      aagccagggaggatgg---ga-----------------gcactttgctga
A0A3Q1GZ93_BCL2L1-      aagccaaggaggatgg---ga-----------------gcgctttgctga
A0A3Q1GZ93_BCL2L1-      aagccaaggaggatgg---ga-----------------gcgctttgctga
A0A3Q1GZ93_BCL2L1-      aagccaaggaggatgg---ga-----------------gcgctttgctga
A0A0D6DR75_BCL2L1-      aagtcaaggaggatgg---ga-----------------gcactttgctga
A0A3B3E2W4_BCL2L1-      cagtcaaggaggatgg---ga-----------------ttgctttgcaca
A0A3B3ICL7_BCL2L1-      cagtcatggaggatgg---ga-----------------ttgctttgcacg
A0A3B3ICL7_BCL2L1-      cagtcatggaggatgg---ga-----------------ttgctttgcacg
A0A3B4BFZ8_BCL2L1-      aaaccagggaggctgg---gc-----------------cagctttgctca
A0A3P8VMA1_BCL2L1-      gagccaaggaggctgg---ga-----------------ccgttttgctga
A0A0F7L1T6_BCL2L1-      gagtcaaggaggatgg---ga-----------------ttgcttcgcgaa
H2U5I3_BCL2L1-01        gagtcaaggaggatgg---ga-----------------ttgcttcgcgaa
H2U5I3_BCL2L1-02        gagtcaaggaggatgg---ga-----------------ttgcttcgcgaa
G3P7B4_BCL2L1-01        gagccagggaggatgg---ga-----------------ctgttttgctga
A0A3Q3FUB6_BCL2L1-      gagccagggaggatgg---ga-----------------ctgctttgttga
A0A3Q3X5M5_BCL2L1-      gagtcaaggtggatgg---gg-----------------ctgctttgctga
A0A2U9BIG9_BCL2L1-      gagccaaggaggctgg---gg-----------------ctgctttgcgga
A0A3Q1JZ46_BCL2L1-      gagccagggaggatgg---ga-----------------ctgctttgctga
A0A3Q1JZ46_BCL2L1-      gagccagggaggatgg---ga-----------------ctgctttgctga
A0A3Q3NFM4_BCL2L1-      gagccaaggaggctgg---ga-----------------ctgctttgctga
A0A3Q3NFM4_BCL2L1-      gagccaaggaggctgg---ga-----------------ctgctttgctga
A0A3Q3J5K3_BCL2L1-      gaaccaaggaggctgg---ga-----------------ctgctttgcaga
A0A3B4V9K8_BCL2L1-      gagccaaggaggctgg---ga-----------------ctgctttgctga
A0A3B4XS24_BCL2L1-      gagccaaggaggctgg---ga-----------------ctgctttgctga
A0A3B5B4X7_BCL2L1-      aagccaaggaggatgg---ga-----------------gtgctttgctga
A0A3Q1EVP6_BCL2L1-      gagccaaggagactgg---ga-----------------gtgctttgctga
A0A3Q1BQA0_BCL2L1-      aagccaaggaggatgg---ga-----------------gtgctttgctga
A0A3P8U812_BCL2L1-      aagccaaggaggatgg---ga-----------------gtgctttgctga
E6ZFR0_BCL2L1-01        gagccaaggaggatgg---ga-----------------ctgctttgctga
A0A0B4KJI5_BCL2L1-      gagccaaggaggatgg---ga-----------------ctcctttgctga
A0A3Q3BEB7_BCL2L1-      cagccagggaggatgg---ga-----------------cagcttcgctga
A0A3Q2C6K4_BCL2L1-      cagccagggaggatgg---ga-----------------ctgctttgctaa
A0A3Q2NRP4_BCL2L1-      cagccaggggggatgg---ga-----------------atgctttgctaa
A0A3B5MGS2_BCL2L1-      gagccagggaggatgg---ga-----------------ccgctttgctaa
M4A558_BCL2L1-01        gagccagggaggatgg---ga-----------------ccgctttgctaa
A0A3P9QFB3_BCL2L1-      gagccagggaggatgg---ga-----------------ccacttcgctaa
A0A3B3XN57_BCL2L1-      gagccagggaggatgg---ga-----------------ccgcttcgctaa
A0A087YBW4_BCL2L1-      aagccagggaggatgg---ga-----------------ccgcttcgctaa
A0A3B3VWI7_BCL2L1-      aagccagggaggatgg---ga-----------------ccgcttcgctaa
                                                                          

R4JQR8_BCL2L1-01        a-gcctataaccaag---gacagaatcataatgacagtccgtgggatgtg
A0A346RRN1_BCL2L1-      a-tactataaccaag---cacagaaccataatgacaatcagtggaacttg
Q6GLI5_BCL2L1-01        t-ctgtacggaaaggg--agctgccgcc-----cagagcagggaagggcc
Q2TAP5_BCL2L1-01        c-ctgtatggaaagaa--tgccgcagcc-----cagagcagagaaagcca
Q91828_BCL2L1-01        c-ctgtatggaaagaa--tgccgcagcc-----cagagcagagaaagcca
H9GHK7_BCL2L1-01        -----------atcaa------------------------aggggggaca
F6WA14_BCL2L1-01        a-ctttatgggaatga--tgcagctgca-----gagagccggaagggcca
G3WKX6_BCL2L1-01        g-ctttatgggaatga--tgcagcagca-----gagagccggaagggcca
A0A452FIG6_BCL2L1-      a-ttctgtgaaaacaa--tacagcaacc-----gagagccaaaagggcca
A0A452FIG6_BCL2L1-      a-ttctgtgaaaacaa--tacagcaacc-----gagagccaaaagggcca
A0A3Q1LRT3_BCL2L1-      a-ctctacgaaagcaa--tacaacaaac-----gagagccagaagggcca
A0A452E1B1_BCL2L1-      a-ctctacgaaaacaa--tacagcaacc-----gagagccaaaagggcca
W5PSA5_BCL2L1-01        a-ctctacgaaaacaa--tacagcaacc-----gagagccaaaagggcca
G3SPN0_BCL2L1-01        ------------------ttcagtacct-----cagtgaaggaag-----
H0X6V2_BCL2L1-01        --ctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggcaa
P53563_BCL2L1-03        cgccccttgtgtgtct--ctcctctgtg-----gagatccctaactgc--
P53563_BCL2L1-02        cgccccttgtgtgtct--ctcctctgtg-----gagatccctaactgc--
P53563_BCL2L1-04        cgccccttgtgtgtct--ctcctctgtg-----gagatccctaactgc--
P53563_BCL2L1-01        t-ctctacgggaacaa--tgcagcagcc-----gagagccggaaaggcca
O35843_BCL2L1-01        t-cttcagaaggcttg--ttcaagtgcc-----aggagtggcggagca--
Q64373_BCL2L1-09        t-ctctacgggaacaa--tgcagcagcc-----gagagccggaaaggcca
Q64373_BCL2L1-01        t-ctctacgggaacaa--tgcagcagcc-----gagagccggaaaggcca
Q64373_BCL2L1-03        -------taagaacca--cgc-----------------------------
Q64373_BCL2L1-04        -------taagaacca--cgc-----------------------------
B2Z3Z4_BCL2L1-01        a-ctctacggaaacaa--tgcagcagct-----gagagccggaaaggcca
Q9MYW4_BCL2L1-01        a-ctctacggcaacaa--cgcagcagcc-----gagagccgcaagggcca
O77737_BCL2L1-01        a-ctctacggaaacaa--tgcagcagct-----gagagccggaagggcca
A0A286Y5D6_BCL2L1-      a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
G1P9D2_BCL2L1-01        a-ctctacgggaacaa--cgcagcagcc-----gagagccggaagggcca
Q05KJ0_BCL2L1-02        a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
Q05KJ0_BCL2L1-01        a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
A0A452FWV3_BCL2L1-      a-ctctatgggaacaa--cgcagcagcc-----gagagccggaagggcca
Q9MZS7_BCL2L1-01        a-ctctacgggaacaa--cgcagcagcc-----gagagccggaagggcca
F6WQI0_BCL2L1-02        g-accttctgctactt--cgtttcatccctgatgagactctca--ggcca
A0A2U3V0P1_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccggaagggcca
A0A1L5BWY3_BCL2L1-      a-ctctatggaaacaa--tgcagcagct-----gagagccggaagggcca
A0A287CZ07_BCL2L1-      a-ctctacaggaataa--tgcggcagca-----gagagccggaagggcca
I3MUP5_BCL2L1-01        a-ctctacgggaataa--tgcagcagca-----gagagccggaagggcca
I3MUP5_BCL2L1-02        a-ctctacgggaataa--tgcagcagca-----gagagccggaagggcca
I3MUP5_BCL2L1-03        a-ctctacgggaataa--tgcagcagca-----gagagccggaagggcca
F6WQI0_BCL2L1-01        a-ctctacgggaacaa--cgcggcagcc-----gaaagccggaagggcca
E2IV76_BCL2L1-01        a-ctctacgggaacaa--tgcagcagct-----gagagccggaagggcca
A0A2K6G3C5_BCL2L1-      a-ctctacggaaacaa--tgcagcagct-----gagagccggaagggcca
A0A2K6G3C5_BCL2L1-      a-ctctacggaaacaa--tgcagcagct-----gagagccggaagggcca
G1RER8_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2J8VIH3_BCL2L1-      a-ctctatgggaacaa--tgcagcagct-----gagagccgaaagggcca
Q07817_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
Q07817_BCL2L1-03        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
Q07817_BCL2L1-02        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
G3RY91_BCL2L1-02        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
G3RY91_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5H963_BCL2L1-      a-ctctatgggaacaa--tgcagcagct-----gagagccgaaagggcca
A0A2K5H963_BCL2L1-      a-ctctatgggaacaa--tgcagcagct-----gagagccgaaagggcca
Q2PFS6_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5M8B1_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5M8B1_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6LPM4_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6QFA2_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5VPG2_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
F6UKR4_BCL2L1-02        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5YR37_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5YR37_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5VPG2_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
F6UKR4_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A0D9RJZ8_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
I7GKS6_BCL2L1-01        a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6LPM4_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6QFA2_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6QFA2_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K5YR37_BCL2L1-      a-ctctatgggaacaa--tgcagcagcc-----gagagccgaaagggcca
A0A2K6UWY8_BCL2L1-      a-ctctatggaaacaa--tgcagcagcc-----gagagcagaaagggcca
E2IV77_BCL2L1-01        a-ctctatggaaacaa--tgcagcagcc-----gagagcagaaagggcca
A0A2K6UWY8_BCL2L1-      a-ctctatggaaacaa--tgcagcagcc-----gagagcagaaagggcca
A0A2K5EBP4_BCL2L1-      a-ctctatggaaacaa--tgcggcagcc-----gagagccgaaagggcca
E2IV75_BCL2L1-01        a-ctctatggaaacaa--tgcggcagcc-----gagagccgaaagggcca
F7IT34_BCL2L1-02        a-ctctatggaaacaa--tgcggcagcc-----gagagccgaaagggcca
F7IT34_BCL2L1-01        a-ctctatggaaacaa--tgcggcagcc-----gagagccgaaagggcca
A0A2K5EBP4_BCL2L1-      a-ctctatggaaacaa--tgcggcagcc-----gagagccgaaagggcca
M3Z2H9_BCL2L1-01        a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
Q76LT7_BCL2L1-01        a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
Q8SQ42_BCL2L1-01        a-ctctacgggaacaa--tgcagcagcc-----gagagccggaagggcca
M3XA94_BCL2L1-01        a-ctctacgggaacaa--tgcagcggcc-----gagagccggaagggcca
A0A452SDS4_BCL2L1-      a-ctctacgggaacaa--tgcagcggct-----gaaagccggaagggcca
A0A384D3U1_BCL2L1-      a-ctctacgggaacaa--tgcagcggct-----gaaagccggaagggcca
A0A452ILL8_BCL2L1-      t-ctctatgggaatga--cgctgctgcc-----aagagcaggaaaggcca
A0A452ILL8_BCL2L1-      t-ctctatgggaatga--cgctgctgcc-----aagagcaggaaaggcca
K7F655_BCL2L1-01        t-ctctacgggaacga--tgctgctgcc-----aagagcaggaaaggcca
U3JSL7_BCL2L1-01        c-ctctatgggaacga--tgctgctgcc-----gaggtgagaaaaggcca
Q4U2V6_BCL2L1-01        c-ctctatgggaacga--tgctgctgcc-----gagatgagaaaaggcca
H0Z8G3_BCL2L1-01        --ctctat--gaacga--tgctgctgcc-----gagatgagaaaaggcca
Q07816_BCL2L1-04        t-ctgtatgggaacaa--cgctgctgcc-----gagctgaggaagggcca
Q07816_BCL2L1-03        t-ctgtatgggaacaa--cgctgctgcc-----gagctgaggaagggcca
Q07816_BCL2L1-02        t-ctgtatgggaacaa--cgctgctgcc-----gagctgaggaagggcca
Q07816_BCL2L1-01        t-ctgtatgggaacaa--cgctgctgcc-----gagctgaggaagggcca
G1N5N5_BCL2L1-01        c-ctgtatgggaataa--tgctgctgcc-----gagctgaggaagggcca
H3ANS8_BCL2L1-01        c-attgacggggttga--cgctat-gca-----gcgctcaaaca---cca
A0A3B5K6B9_BCL2L1-      a-ctctttgggcagga--tgcagcagca-----gaaagcaggagatctca
A0A3B5K6B9_BCL2L1-      a-ctctttgggcagga--tgcagcagca-----gaaagcaggagatctca
H3CH49_BCL2L1-01        a-ctcttcgggcagga--cgcggctgca-----gaaagccgcaggtccca
C1BLI0_BCL2L1-01        c-attttcggcaggga--tgctgctgct-----gaggttcgacgttccca
A0A3P8XFS0_BCL2L1-      c-atttttggcagaga--tgcagctgca-----gacatccgacgttccca
A0A3P8XFS0_BCL2L1-      c-atttttggcagaga--tgcagctgca-----gacatccgacgttccca
A0A286MU87_BCL2L1-      g-atctttggcagaga--tgctgctgca-----gacgttcgacggtctca
C0HAD8_BCL2L1-01        g-atctttggcagaga--tgctgctgca-----gacgttcgacggtctca
A0A345BSW9_BCL2L1-      ---------------------------g-----gtgagtggaaaattact
Q90Z98_BCL2L1-01        g-atctttggaaaaga--tgcagcggcg-----gaaagcaggaaatcgca
Q90Z98_BCL2L1-02        g-atctttggaaaaga--tgcagcggcg-----gaaagcaggaaatcgca
A0A059PJI5_BCL2L1-      g-atctttgggaaaga--tgcagcagca-----gaaggcagaaggtcaca
A0A3B3ZN55_BCL2L1-      g-atctacgggcagga--cgccgccgcg-----cagagccgccattccga
A0A3B3ZN55_BCL2L1-      g-atctacgggcagga--cgccgccgcg-----cagagccgccattccga
D2ITA2_BCL2L1-02        g-gtttttggaagcga--cgcggcagcg-----ggagcgaggcgtacccg
A0A3P8UWG7_BCL2L1-      a-ctctttggtcagga--tgcagcagcg-----gagagccggaggtcaca
A0A3B3QRZ2_BCL2L1-      a-atctttgggaagga--tgcagcagct-----gagagcaggaggtccca
A0A3B1JJ42_BCL2L1-      g-atctttgggaacga--cacagcagca-----gagagcagaaggatgca
A0A3B4DTL9_BCL2L1-      g-atctttgggaagga--tgccgcagca-----gagagcagaaggtcaca
A0A3P8XYL5_BCL2L1-      g-atctttgggaagga--tgctgcagcc-----aacagcaggaagtctca
B5XAY3_BCL2L1-01        g-atctttggaatgga--cgctgcagcc-----gagagcaggaagtctca
A0A3B3TFR4_BCL2L1-      g-atcttcggcaacga--cgcagccgcc-----gaaggccgccgctctcg
A0A3Q3DUT7_BCL2L1-      a-atttttggccacga--cgcggcagcg-----gaggtccgccgctccca
A0A3Q3DUT7_BCL2L1-      a-atttttggccacga--cgcggcagcg-----gaggtccgccgctccca
A0A3Q3DUT7_BCL2L1-      a-atttttggccacga--cgcggcagcg-----gaggtccgccgctccca
W5MG74_BCL2L1-01        g-atctttggcaagga--tgcggctgcg-----gagtaccggagatcaca
A0A3Q3WIW8_BCL2L1-      a-atcttcggacagga--cgcggctgct-----gagagcaggaggtctca
A0A2U9BY16_BCL2L1-      a-atcttcgggcagga--cgcggcggca-----gggagtcgaaggtctca
A0A3B5PQJ0_BCL2L1-      g-atcttcgggggcaa--cgcggcggca-----gagagcagaagatctca
A0A3P9N9Y4_BCL2L1-      g-atcttcgggggcaa--cgcggcggca-----gagagcagaagatctca
A0A3B3WI27_BCL2L1-      g-atcttcgggggcaa--cgcggcggca-----gagagcagaagatctca
A0A087X9B7_BCL2L1-      g-atcttcgggggcaa--cgcggcggca-----gagagcagaagatctca
A0A3B3TUS7_BCL2L1-      g-atcttcgggggcaa--cgcggcggca-----gagagcagaagatctca
A0A3Q2FR43_BCL2L1-      a-atcttcggaggcga--cgcagcggct-----gagagcagaaggtctca
A0A3Q2QPL9_BCL2L1-      a-atctttgggggcaa--cgcagcggcg-----gagagcagaaggtctca
A0A3Q3B3X5_BCL2L1-      a-atcttcggcgacaa--cgcggcggct-----gaaagcagaatctctca
A0A3Q0RTF8_BCL2L1-      a-atctttgggcagga--cgcggcggct-----gaaagccggaggtctca
I3IZK7_BCL2L1-01        a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3Q4N4B5_BCL2L1-      a-atctttgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3Q2X557_BCL2L1-      a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3P8P0F1_BCL2L1-      a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3P9D632_BCL2L1-      a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3P9D632_BCL2L1-      a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
A0A3B4FNX1_BCL2L1-      a-atcttcgggcagga--tgcggcggct-----gaaagccggaggtctca
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      a-atctttgggcagga--agccgcggct-----gagagcagaaggtctca
A0A3P9JYH1_BCL2L1-      a-atctttgggcagga--agccgcggct-----gagagcagaaggtctca
A0A3B3DHA1_BCL2L1-      a-atctttgggcagga--ggccgcagcc-----gaaagcagaaggtctca
C3VIT1_BCL2L1-01        g-atcttcgggcagga--cgcggcggcc-----gaaagcaggaggtctca
A0A3B4Z3X2_BCL2L1-      a-atcttcggccagga--cgcggcagcc-----gagagccggaggtctca
A0A3B4Z3X2_BCL2L1-      a-atcttcggccagga--cgcggcagcc-----gagagccggaggtctca
A0A3Q1GS47_BCL2L1-      g-atcttcggtcagga--cgcggcggcc-----gagagcaggaggtctca
A0A3Q1GS47_BCL2L1-      g-atcttcggtcagga--cgcggcggcc-----gagagcaggaggtctca
A0A3Q1DHJ3_BCL2L1-      a-atcttcggtcagga--cgcggcggct-----gagagcaggaagtctca
A0A3Q1DHJ3_BCL2L1-      a-atcttcggtcagga--cgcggcggct-----gagagcaggaagtctca
A0A3Q1DHJ3_BCL2L1-      a-atcttcggtcagga--cgcggcggct-----gagagcaggaagtctca
A0A3P8TL99_BCL2L1-      a-atcttcggtcagga--cgcggcggcc-----gagagcaggaagtctca
A0A3P8TL99_BCL2L1-      a-atcttcggtcagga--cgcggcggcc-----gagagcaggaagtctca
A0A219P0Y3_BCL2L1-      a-atcttcgggcagga--cgcggcggca-----gagagcaggaggtctca
A0A3Q3G2E1_BCL2L1-      a-atctttgggcagga--tgcggcggga-----gagatcaggaggtctca
A0A3Q3G2E1_BCL2L1-      a-atctttgggcagga--tgcggcggga-----gagatcaggaggtctca
A0A3Q3G2E1_BCL2L1-      a-atctttgggcagga--tgcggcggga-----gagatcaggaggtctca
A0A3B4V3T1_BCL2L1-      a-atcttcgggcagga--cgcagcagca-----gagagcaggaggtctca
A0A3B4XU17_BCL2L1-      a-atctttgggcagga--cgcagcagca-----gacagcaggaggtctca
A0A3Q3IVF5_BCL2L1-      a-ctctttgggcagga--tgcggcggca-----gagaacaggaggtctca
A0A3Q3MX20_BCL2L1-      a-atctttgggcagga--tgcagcagca-----gagagcaggaggtccca
A0A3Q1GZ93_BCL2L1-      g-ctcttcggccacga--cgcagcagca-----gagggcaggcggtctca
A0A3Q1GZ93_BCL2L1-      g-ctcttcggccacga--cgcagcagca-----gagggcaggcggtctca
A0A3Q1GZ93_BCL2L1-      g-ctcttcggccacga--cgcagcagca-----gagggcaggcggtctca
A0A0D6DR75_BCL2L1-      a-atcttcgggcatga--tgcagctgca-----gagagcaggaggtctca
A0A3B3E2W4_BCL2L1-      g-ctgtatgggcagga--tggcgctgca-----gaagcgagaagatttca
A0A3B3ICL7_BCL2L1-      g-ctgtatggccagaa--cggcgctgca-----gaagcgaggagatttca
A0A3B3ICL7_BCL2L1-      g-ctgtatggccagaa--cggcgctgca-----gaagcgaggagatttca
A0A3B4BFZ8_BCL2L1-      a-atttttgggcagaa--tgcagcagga-----gaggccagaaggtcccg
A0A3P8VMA1_BCL2L1-      g-atttttggcacaga--ctgtattcca-----agaacgaggagttgtcg
A0A0F7L1T6_BCL2L1-      g-atttttggggacga--cgccgcggca-----gaggggaggagagctcg
H2U5I3_BCL2L1-01        g-atttttggggacga--cgccgcggca-----gaggggaggagagctcg
H2U5I3_BCL2L1-02        g-atttttggggacga--cgccgcggca-----gaggggaggagagctcg
G3P7B4_BCL2L1-01        c-attttcgggcggga--cggcgcggca-----gcggcgaggagatctca
A0A3Q3FUB6_BCL2L1-      a-attttcggacgggg--cgctgttgga-----gaagtgaggagatctcg
A0A3Q3X5M5_BCL2L1-      g-gtttttgggcacaa--cgccgctgca-----gaagcaaggagatctca
A0A2U9BIG9_BCL2L1-      g-atttttgggcaagg--cgccggcgca-----gaagcaaggagatatcg
A0A3Q1JZ46_BCL2L1-      g-atatttgggcaaga--tgccgctgct-----gaggcgaggagatctcg
A0A3Q1JZ46_BCL2L1-      g-atatttgggcaaga--tgccgctgct-----gaggcgaggagatctcg
A0A3Q3NFM4_BCL2L1-      g-atttttgggcgaga--tgcagctgca-----gaagcaaggagatcaca
A0A3Q3NFM4_BCL2L1-      g-atttttgggcgaga--tgcagctgca-----gaagcaaggagatcaca
A0A3Q3J5K3_BCL2L1-      g-atttttgggcgaga--taacgctgca-----gaagtgcgaagatctca
A0A3B4V9K8_BCL2L1-      g-atgtttgggcaaga--cgccgctgca-----gaagcgaggagatctcg
A0A3B4XS24_BCL2L1-      g-atgtttgggcaaga--cgccgctgca-----gaagcgaggagatctcg
A0A3B5B4X7_BCL2L1-      a-attttcgggcaaga--cgccgccgca-----gaagcacggagatctcg
A0A3Q1EVP6_BCL2L1-      g-atttttgggcagaa--cgccgctgca-----gaagcacggaggtctcg
A0A3Q1BQA0_BCL2L1-      g-atttttgggcagaa--cgccgctgca-----gaagcacgaaggtctcg
A0A3P8U812_BCL2L1-      g-atttttgggcagaa--cgccgctgca-----gaagcacgaaggtctcg
E6ZFR0_BCL2L1-01        g-gtttttgggcgaga--cgccgccgca-----gaagcgaggagatctcg
A0A0B4KJI5_BCL2L1-      g-gtttttgggcgaga--cgcagctgca-----gaagcgaggagatctcg
A0A3Q3BEB7_BCL2L1-      g-atgtacgggcgaga--tgccgctgca-----gaagcgaggaggtttca
A0A3Q2C6K4_BCL2L1-      g-ctgtacggccaaga--cgccgctgca-----gaggggcggagatctca
A0A3Q2NRP4_BCL2L1-      g-ctgtacggccagga--cgccgccgca-----gcgggccggaggtttca
A0A3B5MGS2_BCL2L1-      c-ctgtacggccagga--cgccgctgca-----gagggccggaggtttcg
M4A558_BCL2L1-01        c-ctgtacggccagga--cgccgctgca-----gagggccggaggtttcg
A0A3P9QFB3_BCL2L1-      c-ctgtacggccagga--cgccgctgca-----gagggccggaggtttcg
A0A3B3XN57_BCL2L1-      c-ctgtacggccagga--cgccgctgca-----gagggccggaggtttcg
A0A087YBW4_BCL2L1-      c-ctgtacggccagga--tgccgctgca-----gagggccggaggtttcg
A0A3B3VWI7_BCL2L1-      c-ctgtacggccagga--tgccgctgca-----gagggccggaggtttcg
                                                                          

R4JQR8_BCL2L1-01        ----aaagg----------acttgttaaatacggagcaataggtgt----
A0A346RRN1_BCL2L1-      ----ggaga----------atttgtacgttatggggccattggtgt----
Q6GLI5_BCL2L1-01        ----ggagc----------ggtt---tggccggtggctaatggcca----
Q2TAP5_BCL2L1-01        ----ggaac----------gatt---tggcaggttgc---tgacta----
Q91828_BCL2L1-01        ----ggaac----------gatt---tggcaggttgc---tgacta----
H9GHK7_BCL2L1-01        -----aatc----------attt---ca-------gttatctacac----
F6WA14_BCL2L1-01        ----ggaac----------gctt---caaccgatggctgctgactg----
G3WKX6_BCL2L1-01        ----ggaac----------gctt---caacagatggctgctgactg----
A0A452FIG6_BCL2L1-      ----ggagc----------gctt---caactgctggtccctgacgg----
A0A452FIG6_BCL2L1-      ----ggagc----------gctt---caactgctggtccctgacgg----
A0A3Q1LRT3_BCL2L1-      ----agagc----------gttt---caactgctggtccctgacga----
A0A452E1B1_BCL2L1-      ----agagc----------actt---caaccgctggtccctgacgg----
W5PSA5_BCL2L1-01        ----agagc----------acct---caaccgctggtccctgacgg----
G3SPN0_BCL2L1-01        -------------------acat---agcctatgtgttcattcagg----
H0X6V2_BCL2L1-01        -------------------tttt---tgctctttggctgcagctgggaga
P53563_BCL2L1-03        -------------------------------------cctttttgg----
P53563_BCL2L1-02        -------------------------------------cctttttgg----
P53563_BCL2L1-04        -------------------------------------cctttttgg----
P53563_BCL2L1-01        ----ggagc----------gttt---caaccgctggttcctgacgg----
O35843_BCL2L1-01        -------------------------------------cgtttgtga----
Q64373_BCL2L1-09        ----ggagc----------gctt---caaccgctggttcctgacgg----
Q64373_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
Q64373_BCL2L1-03        -------------------------------------cccttgtgt----
Q64373_BCL2L1-04        -------------------------------------cccttgtgt----
B2Z3Z4_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
Q9MYW4_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
O77737_BCL2L1-01        ----ggaac----------gctt---caaccgatggttcctgacgg----
A0A286Y5D6_BCL2L1-      ----ggagc----------gctt---caaccgctggttgctgacgg----
G1P9D2_BCL2L1-01        ----ggaac----------gctt---caatcgctggttcctgacgg----
Q05KJ0_BCL2L1-02        ----ggagc----------gctt---caaccgctggttcctgacgg----
Q05KJ0_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A452FWV3_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
Q9MZS7_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
F6WQI0_BCL2L1-02        aggcggagccttacagctagctc---caagctacagtgctttttgg----
A0A2U3V0P1_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A1L5BWY3_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacag----
A0A287CZ07_BCL2L1-      ----ggagc----------gctt---caaccgttggttcctgacgg----
I3MUP5_BCL2L1-01        ----ggagc----------gctt---caaccgttggttcctgacgg----
I3MUP5_BCL2L1-02        ----ggagc----------gctt---caaccgttggttcctgacgg----
I3MUP5_BCL2L1-03        ----ggagc----------gctt---caaccgttggttcctgacgg----
F6WQI0_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
E2IV76_BCL2L1-01        ----ggaac----------gctt---caaccgctggttcctgacgg----
A0A2K6G3C5_BCL2L1-      ----ggaac----------gctt---caaccgctggttcctgacgg----
A0A2K6G3C5_BCL2L1-      ----ggaac----------gctt---caaccgctggttcctgacgg----
G1RER8_BCL2L1-01        ----ggaac----------gctt---caaccgctggttcctgacgg----
A0A2J8VIH3_BCL2L1-      ----ggaac----------gctt---caaccgctggttcctgacgg----
Q07817_BCL2L1-01        ----ggaac----------gctt---caaccgctggttcctgacgg----
Q07817_BCL2L1-03        ----ggaac----------gctt---caaccgctggttcctgacgg----
Q07817_BCL2L1-02        ----ggaac----------gctt---caaccgctggttcctgacgg----
G3RY91_BCL2L1-02        ----ggaac----------gctt---caaccgctggttcctgacgg----
G3RY91_BCL2L1-01        ----ggaac----------gctt---caaccgctggttcctgacgg----
A0A2K5H963_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5H963_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
Q2PFS6_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5M8B1_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5M8B1_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6LPM4_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6QFA2_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5VPG2_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
F6UKR4_BCL2L1-02        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5YR37_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5YR37_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5VPG2_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
F6UKR4_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A0D9RJZ8_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
I7GKS6_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6LPM4_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6QFA2_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6QFA2_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5YR37_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6UWY8_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
E2IV77_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K6UWY8_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5EBP4_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
E2IV75_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacag----
F7IT34_BCL2L1-02        ----ggagc----------gctt---caaccgctggttcctgacgg----
F7IT34_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacgg----
A0A2K5EBP4_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacgg----
M3Z2H9_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacag----
Q76LT7_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacag----
Q8SQ42_BCL2L1-01        ----ggagc----------gctc---caaccgctggttcctgacag----
M3XA94_BCL2L1-01        ----ggagc----------gctt---caaccgctggttcctgacag----
A0A452SDS4_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacag----
A0A384D3U1_BCL2L1-      ----ggagc----------gctt---caaccgctggttcctgacag----
A0A452ILL8_BCL2L1-      ----ggagc----------agtt---caacaggtggcttctgaccg----
A0A452ILL8_BCL2L1-      ----ggagc----------agtt---caacaggtggcttctgaccg----
K7F655_BCL2L1-01        ----ggagc----------agtt---caacagggggctgctgacgg----
U3JSL7_BCL2L1-01        ----ggaga----------cctt---caacaaatggctcctgaccg----
Q4U2V6_BCL2L1-01        ----ggaga----------cctt---caacaaatggctcctgaccg----
H0Z8G3_BCL2L1-01        ----ggag-------------tt---caacaaatggctcctgacgg----
Q07816_BCL2L1-04        ----ggaga----------cctt---caacaaatggctcctcaccg----
Q07816_BCL2L1-03        ----ggaga----------cctt---caacaaatggctcctcaccg----
Q07816_BCL2L1-02        ----ggaga----------cctt---caacaaatggctcctcaccg----
Q07816_BCL2L1-01        ----ggaga----------cctt---caacaaatggctcctcaccg----
G1N5N5_BCL2L1-01        ----ggaga----------cctt---caacaaatggctcctgaccg----
H3ANS8_BCL2L1-01        ----ggag--------------t---gaaaaattgggttttgttgg----
A0A3B5K6B9_BCL2L1-      ----ggaga----------gatt---cagaaacggactcctggtgg----
A0A3B5K6B9_BCL2L1-      ----ggaga----------gatt---cagaaacggactcctggtgg----
H3CH49_BCL2L1-01        ----ggagc----------gatt---ccgaaacgggctgtttctgg----
C1BLI0_BCL2L1-01        ----ggaga----------acct---aagaagatggctgctagtag----
A0A3P8XFS0_BCL2L1-      ----agaaa----------gctt---gaggaaatggctgctatttg----
A0A3P8XFS0_BCL2L1-      ----agaaa----------gctt---gaggaaatggctgctatttg----
A0A286MU87_BCL2L1-      ----ggaga----------gcat---aattaaatggctgctagttg----
C0HAD8_BCL2L1-01        ----ggaga----------gcat---aattaaatggctgctagttg----
A0A345BSW9_BCL2L1-      ----tgca---------------------------tttctttcc------
Q90Z98_BCL2L1-01        ----agaaa----------gctt---caagaaatggttgtttgcag----
Q90Z98_BCL2L1-02        ----agaaa----------gctt---caagaaatggttgtttgcag----
A0A059PJI5_BCL2L1-      ----ggaaa----------gctt---taagaagtggctgctggcag----
A0A3B3ZN55_BCL2L1-      ----agaac----------gctt---caagaaatggctttttgccg----
A0A3B3ZN55_BCL2L1-      ----agaac----------gctt---caagaaatggctttttgccg----
D2ITA2_BCL2L1-02        ----ggaca----------gtca---caggagatggatgctggtgg----
A0A3P8UWG7_BCL2L1-      ----ggaga----------gttt---taagaaatggttgctggctg----
A0A3B3QRZ2_BCL2L1-      ----agaga----------actt---caaaaagtggctgttagctg----
A0A3B1JJ42_BCL2L1-      ----ggaac----------gcta---taagatgtggctgctggtgg----
A0A3B4DTL9_BCL2L1-      ----ggaga----------actt---taagaagtggctgctggcag----
A0A3P8XYL5_BCL2L1-      ----ggaga----------gctt---taagaagtggctgctggcag----
B5XAY3_BCL2L1-01        ----ggaga----------gctt---taagaagtggcttctggcag----
A0A3B3TFR4_BCL2L1-      ----ggaga----------ggtt---ccagcagtggctgccggcgg----
A0A3Q3DUT7_BCL2L1-      ----ggaga----------gttt---caagaagtggcttttggccg----
A0A3Q3DUT7_BCL2L1-      ----ggaga----------gttt---caagaagtggcttttggccg----
A0A3Q3DUT7_BCL2L1-      ----ggaga----------gttt---caagaagtggcttttggccg----
W5MG74_BCL2L1-01        ----ggaga----------gctt---caagaagtggctgctggcgg----
A0A3Q3WIW8_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggccg----
A0A2U9BY16_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcag----
A0A3B5PQJ0_BCL2L1-      ----ggaga----------gctt---caaaaactggctgctgctgg----
A0A3P9N9Y4_BCL2L1-      ----ggaga----------gctt---caaaaactggctgctgctgg----
A0A3B3WI27_BCL2L1-      ----ggaga----------gctt---caaaaactggctgctgctgg----
A0A087X9B7_BCL2L1-      ----ggaga----------gctt---caaaaactggctgctgctgg----
A0A3B3TUS7_BCL2L1-      ----ggaga----------gctt---caaaaactggctgctgctgg----
A0A3Q2FR43_BCL2L1-      ----ggaga----------gcct---gaagaactggctgctgctgg----
A0A3Q2QPL9_BCL2L1-      ----ggaga----------gctt---caagaactggctgctgctgg----
A0A3Q3B3X5_BCL2L1-      ----ggagg----------gttt---aaagaagtggctgctggtgg----
A0A3Q0RTF8_BCL2L1-      ----ggaga----------gctt---caagaagtggctgcttgtgg----
I3IZK7_BCL2L1-01        ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3Q4N4B5_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3Q2X557_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3P8P0F1_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3P9D632_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3P9D632_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
A0A3B4FNX1_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggtgg----
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3P9JYH1_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3B3DHA1_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
C3VIT1_BCL2L1-01        ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3B4Z3X2_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3B4Z3X2_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3Q1GS47_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3Q1GS47_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3Q1DHJ3_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3Q1DHJ3_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3Q1DHJ3_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3P8TL99_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A3P8TL99_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggtgg----
A0A219P0Y3_BCL2L1-      ----ggaga----------gttt---caaaaagtggctgctggcgg----
A0A3Q3G2E1_BCL2L1-      ----ggaga----------gttt---caaaaagtggctgctggcgg----
A0A3Q3G2E1_BCL2L1-      ----ggaga----------gttt---caaaaagtggctgctggcgg----
A0A3Q3G2E1_BCL2L1-      ----ggaga----------gttt---caaaaagtggctgctggcgg----
A0A3B4V3T1_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcgg----
A0A3B4XU17_BCL2L1-      ----ggaga----------gttt---taagaagtggctgctggcgg----
A0A3Q3IVF5_BCL2L1-      ----ggaga----------gctt---caagaagtggctgctggcgg----
A0A3Q3MX20_BCL2L1-      ----agaga----------attt---caagaagtggctgctggcag----
A0A3Q1GZ93_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcag----
A0A3Q1GZ93_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcag----
A0A3Q1GZ93_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcag----
A0A0D6DR75_BCL2L1-      ----ggaga----------gttt---caagaagtggctgctggcgg----
A0A3B3E2W4_BCL2L1-      ----agaga----------cgct---gaaaaagtggacgctggtcg----
A0A3B3ICL7_BCL2L1-      ----agaga----------cgct---gaagaagtggatgctggtca----
A0A3B3ICL7_BCL2L1-      ----agaga----------cgct---gaagaagtggatgctggtca----
A0A3B4BFZ8_BCL2L1-      ----agaga----------ctct---gaagaaatggctgctagttg----
A0A3P8VMA1_BCL2L1-      ----ggaca----------cagt---gagaagatggctgctagtgg----
A0A0F7L1T6_BCL2L1-      ----cgaga----------acct---gagtagatggatgctgggcg----
H2U5I3_BCL2L1-01        ----cgaga----------acct---gagtagatggatgctgggcg----
H2U5I3_BCL2L1-02        ----cgaga----------acct---gagtagatggatgctgggcg----
G3P7B4_BCL2L1-01        ----ggaga----------cgat---gagaaggtggctgctcgtcg----
A0A3Q3FUB6_BCL2L1-      ----ggaaa----------ctct---caccagatggctgctagttg----
A0A3Q3X5M5_BCL2L1-      ----ggaga----------ctct---gaatagatggctcctagtcg----
A0A2U9BIG9_BCL2L1-      ----ggaga----------gcgt---gaggcgatggctgctagttg----
A0A3Q1JZ46_BCL2L1-      ----ggagg----------ctct---gagaagatggctgctagttg----
A0A3Q1JZ46_BCL2L1-      ----ggagg----------ctct---gagaagatggctgctagttg----
A0A3Q3NFM4_BCL2L1-      ----ggaaa----------ccct---gaggaggtggctgctagttg----
A0A3Q3NFM4_BCL2L1-      ----ggaaa----------ccct---gaggaggtggctgctagttg----
A0A3Q3J5K3_BCL2L1-      ----ggaga----------ccct---gaggagatggctgctagttg----
A0A3B4V9K8_BCL2L1-      ----ggaag----------ctgt---gatgaagtggctgctagttg----
A0A3B4XS24_BCL2L1-      ----ggagg----------ctgt---gaggaggtggctgctagttg----
A0A3B5B4X7_BCL2L1-      ----ggatt----------ctct---gaagcgatggctgctagtcg----
A0A3Q1EVP6_BCL2L1-      ----ggata----------ctct---gaagcgatggctgctagccg----
A0A3Q1BQA0_BCL2L1-      ----ggata----------ctct---gaagagatggctgctagtcg----
A0A3P8U812_BCL2L1-      ----ggata----------ctct---gaagagatggctgctagtcg----
E6ZFR0_BCL2L1-01        ----ggaga----------ctct---gagtagatggctgctaattg----
A0A0B4KJI5_BCL2L1-      ----ggaga----------ctct---gagtcggtggctgctggttg----
A0A3Q3BEB7_BCL2L1-      ----ggagt----------ccct---gaagaaatggctgctagctg----
A0A3Q2C6K4_BCL2L1-      ----cgaga----------catt---gaacaaatggctgctagttg----
A0A3Q2NRP4_BCL2L1-      ----ggaga----------cgtt---gaacaaatggctgctagtcg----
A0A3B5MGS2_BCL2L1-      ----ggaga----------cctt---gaacaaatggctgctagttg----
M4A558_BCL2L1-01        ----ggaga----------cctt---gaacaaatggctgctagttg----
A0A3P9QFB3_BCL2L1-      ----ggaga----------cctt---gaacaaatggctgctagtcg----
A0A3B3XN57_BCL2L1-      ----ggaga----------cctt---gaacaaatggctgctagtcg----
A0A087YBW4_BCL2L1-      ----ggaga----------cctt---gaacaaatggctgctagtcg----
A0A3B3VWI7_BCL2L1-      ----ggaga----------cctt---gaacaaatggctgctagtcg----
                                                                          

R4JQR8_BCL2L1-01        -aata-ggcgc---------------------------------------
A0A346RRN1_BCL2L1-      -ggtt-ggtgc---------------------------------------
Q6GLI5_BCL2L1-01        -tagt-gactgtga--------ctgc----tgc-----------------
Q2TAP5_BCL2L1-01        -tagt-gattctga--------ctgg----tgt-----------------
Q91828_BCL2L1-01        -tagt-gatgctga--------ctgg----tgt-----------------
H9GHK7_BCL2L1-01        -gcat-catt------------ccgaagtctgt-----------------
F6WA14_BCL2L1-01        -gcat-gacagtgg--------ccgg----tgt-----------------
G3WKX6_BCL2L1-01        -gcat-gacagtgg--------ctgg----tgt-----------------
A0A452FIG6_BCL2L1-      -ctgt-gactttgg--------ctgg-----g---ggatcaggactcagc
A0A452FIG6_BCL2L1-      -ctgt-gactttgg--------ctgg-----gctcgctcttcaactcata
A0A3Q1LRT3_BCL2L1-      --cac-gactgtgg--------ctgt----ttg-----------------
A0A452E1B1_BCL2L1-      -acgt-gactgtgg--------ctgg----tat-----------------
W5PSA5_BCL2L1-01        -acat-gactgtgg--------ccgg----tat-----------------
G3SPN0_BCL2L1-01        -tcaaaacctatg---------caag----tgg-----------------
H0X6V2_BCL2L1-01        tgctt-gactatag-----------g------------------------
P53563_BCL2L1-03        -tctcctggcatgg--------ttgt----tgaagatatcgattattcag
P53563_BCL2L1-02        -tctcctggcatgg--------ttgt----tgaagatatcgattattcag
P53563_BCL2L1-04        -tctcctggcatgg--------ttgt----tgaagatatcgattattcag
P53563_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
O35843_BCL2L1-01        -tcccagcctttgg--------gagg----tggaaacagaaggatcggaa
Q64373_BCL2L1-09        -gcat-gactgtgg--------ctgg----tgt-----------------
Q64373_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
Q64373_BCL2L1-03        -gtcc-gccccttg--------cttg----tgt-----------------
Q64373_BCL2L1-04        -gtcc-gccccttg--------cttg----tgt-----------------
B2Z3Z4_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
Q9MYW4_BCL2L1-01        -gcat-gaccgtgg--------ctgg----cgt-----------------
O77737_BCL2L1-01        -gcat-gactctag--------ctgg----ggt-----------------
A0A286Y5D6_BCL2L1-      -gcgt-gactgtgg--------ctgg----cgt-----------------
G1P9D2_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
Q05KJ0_BCL2L1-02        -gcat-gactgtgg--------ctgg----tgt-----------------
Q05KJ0_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
A0A452FWV3_BCL2L1-      -gcat-gactgtgg--------ctgg----tgt-----------------
Q9MZS7_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
F6WQI0_BCL2L1-02        -gca--gactccagagctcccctcggaactaga-----------------
A0A2U3V0P1_BCL2L1-      -gcat-gactgtgg--------ctgg----cgt-----------------
A0A1L5BWY3_BCL2L1-      -gcat-gactgtgg--------ctgg----tgt-----------------
A0A287CZ07_BCL2L1-      -gcat-gactgtgg--------ccgg----tgt-----------------
I3MUP5_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
I3MUP5_BCL2L1-02        -gcat-gactgtgg--------ccgg----cgt-----------------
I3MUP5_BCL2L1-03        -gcat-gactgtgg--------ccgg----cgt-----------------
F6WQI0_BCL2L1-01        -gcat-gactgtgg--------ctgg----tgt-----------------
E2IV76_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
A0A2K6G3C5_BCL2L1-      -gcat-gactgtgg--------ctgg----cgt-----------------
A0A2K6G3C5_BCL2L1-      -gcat-gactgtgg--------ctgg----cgt-----------------
G1RER8_BCL2L1-01        -gc-----------------------------------------------
A0A2J8VIH3_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
Q07817_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
Q07817_BCL2L1-03        -gcat-gactgtgg--------ccgg----cgt-----------------
Q07817_BCL2L1-02        -gcat-gactgtgg--------ccgg----cgt-----------------
G3RY91_BCL2L1-02        -gcat-gactgtgg--------ccgg----cgt-----------------
G3RY91_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5H963_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5H963_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
Q2PFS6_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5M8B1_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5M8B1_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6LPM4_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6QFA2_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5VPG2_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
F6UKR4_BCL2L1-02        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5YR37_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5YR37_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5VPG2_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
F6UKR4_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A0D9RJZ8_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
I7GKS6_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6LPM4_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6QFA2_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6QFA2_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5YR37_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6UWY8_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
E2IV77_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K6UWY8_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5EBP4_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
E2IV75_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
F7IT34_BCL2L1-02        -gcat-gactgtgg--------ccgg----cgt-----------------
F7IT34_BCL2L1-01        -gcat-gactgtgg--------ccgg----cgt-----------------
A0A2K5EBP4_BCL2L1-      -gcat-gactgtgg--------ccgg----cgt-----------------
M3Z2H9_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
Q76LT7_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
Q8SQ42_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
M3XA94_BCL2L1-01        -gcat-gactgtgg--------ctgg----cgt-----------------
A0A452SDS4_BCL2L1-      -gcat-gactgtgg--------ctgg----cgt-----------------
A0A384D3U1_BCL2L1-      -gcat-gactgtgg--------ctgg----cgt-----------------
A0A452ILL8_BCL2L1-      -gggc-gactctgg--------cagg----agt-----------------
A0A452ILL8_BCL2L1-      -gggc-gactctgg--------cagg----agt-----------------
K7F655_BCL2L1-01        -gggc-gactgtgg--------ccgg----cgt-----------------
U3JSL7_BCL2L1-01        -gggc-gacggtgg--------ccgg----agt-----------------
Q4U2V6_BCL2L1-01        -gggc-gacggtgg--------ccgg----agt-----------------
H0Z8G3_BCL2L1-01        -gggc-gacggtgg--------ccgg----agt-----------------
Q07816_BCL2L1-04        -gggc-gaccgtgg--------ccgg----agt-----------------
Q07816_BCL2L1-03        -gggc-gaccgtgg--------ccgg----agt-----------------
Q07816_BCL2L1-02        -gggc-gaccgtgg--------ccgg----agt-----------------
Q07816_BCL2L1-01        -gggc-gaccgtgg--------ccgg----agt-----------------
G1N5N5_BCL2L1-01        -gggc-gaccgtgg--------ccgg----agt-----------------
H3ANS8_BCL2L1-01        -gttt----tttttttc-----cttt------------------------
A0A3B5K6B9_BCL2L1-      -ggat-gagcctggcag-----cagg------------------------
A0A3B5K6B9_BCL2L1-      -ggat-gagcctggcag-----cagg------------------------
H3CH49_BCL2L1-01        -gcat-gagtctggcgg-----cagg------------------------
C1BLI0_BCL2L1-01        -gggc-gatactgcttg-----cagg------------------------
A0A3P8XFS0_BCL2L1-      -ggat-g-------------------------------------------
A0A3P8XFS0_BCL2L1-      -gggt-gatgctgcttt-----cagg------------------------
A0A286MU87_BCL2L1-      -gggt-gattctgcttt-----cagg------------------------
C0HAD8_BCL2L1-01        -gggt-gattctgcttt-----cagg------------------------
A0A345BSW9_BCL2L1-      ------taccttgttcc-----c---------------------------
Q90Z98_BCL2L1-01        -gaat-gaccttgctca-----cggg------------------------
Q90Z98_BCL2L1-02        -gaat-gaccttgctca-----cggg------------------------
A0A059PJI5_BCL2L1-      -gtgt-gacactcttca-----cggg------------------------
A0A3B3ZN55_BCL2L1-      -gaat-gaccctggtca-----ccgg------------------------
A0A3B3ZN55_BCL2L1-      -gaat-gaccctggtca-----ccgg------------------------
D2ITA2_BCL2L1-02        -gcgc-ggcgctgctga-----ctgg------------------------
A0A3P8UWG7_BCL2L1-      -ggat-gacgctggtga-----cagg------------------------
A0A3B3QRZ2_BCL2L1-      -ggat-gacgctcatca-----ctgg------------------------
A0A3B1JJ42_BCL2L1-      -ggat-gaccctgttca-----cagg------------------------
A0A3B4DTL9_BCL2L1-      -ggat-gaccctggtca-----cagg------------------------
A0A3P8XYL5_BCL2L1-      -gaat-gacgctggtta-----cagg------------------------
B5XAY3_BCL2L1-01        -ggat-gaccctggtca-----cagg------------------------
A0A3B3TFR4_BCL2L1-      -cgat-ggcgctggtcg-----cggg------------------------
A0A3Q3DUT7_BCL2L1-      -gggt-gaccttggtga-----ccgg------------------------
A0A3Q3DUT7_BCL2L1-      -gggt-gaccttggtga-----ccgg------------------------
A0A3Q3DUT7_BCL2L1-      -gggt-gaccttggtga-----ccgg------------------------
W5MG74_BCL2L1-01        -gcat-gactctggtta-----cggg------------------------
A0A3Q3WIW8_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A2U9BY16_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A3B5PQJ0_BCL2L1-      -ggat-gagcgtggtga-----cggc------------------------
A0A3P9N9Y4_BCL2L1-      -ggat-gagcgtggtga-----cggc------------------------
A0A3B3WI27_BCL2L1-      -ggat-gagtgtggtga-----cggc------------------------
A0A087X9B7_BCL2L1-      -ggat-gagtgtggtga-----cggc------------------------
A0A3B3TUS7_BCL2L1-      -ggat-gagtgtggtga-----cggc------------------------
A0A3Q2FR43_BCL2L1-      -ggat-gagcgtggcca-----ccgc------------------------
A0A3Q2QPL9_BCL2L1-      -ggat-gagcgtggtga-----cggc------------------------
A0A3Q3B3X5_BCL2L1-      -ggat-gacggtggtga-----ccgc------------------------
A0A3Q0RTF8_BCL2L1-      -gcat-gacggtggtga-----ccgg------------------------
I3IZK7_BCL2L1-01        -ggat-gacggtggtga-----cggg------------------------
A0A3Q4N4B5_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
A0A3Q2X557_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
A0A3P8P0F1_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
A0A3P9D632_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
A0A3P9D632_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
A0A3B4FNX1_BCL2L1-      -ggat-gacggtggtga-----cagg------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      -ggat-gacggtggcga-----ccgg------------------------
A0A3P9JYH1_BCL2L1-      -ggat-gacggtggcga-----ccgg------------------------
A0A3B3DHA1_BCL2L1-      -ggat-gacggtggcga-----ccgg------------------------
C3VIT1_BCL2L1-01        -ggat-gaccgtggtga-----ccgg------------------------
A0A3B4Z3X2_BCL2L1-      -ggat-gacggtggtga-----ccgg------------------------
A0A3B4Z3X2_BCL2L1-      -ggat-gacggtggtga-----ccgg------------------------
A0A3Q1GS47_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3Q1GS47_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3Q1DHJ3_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3Q1DHJ3_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3Q1DHJ3_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3P8TL99_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3P8TL99_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A219P0Y3_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A3Q3G2E1_BCL2L1-      -ggat-gacgctggtga-----ccgg------------------------
A0A3Q3G2E1_BCL2L1-      -ggat-gacgctggtga-----ccgg------------------------
A0A3Q3G2E1_BCL2L1-      -ggat-gacgctggtga-----ccgg------------------------
A0A3B4V3T1_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A3B4XU17_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A3Q3IVF5_BCL2L1-      -ggat-gaccctggtga-----ccgg------------------------
A0A3Q3MX20_BCL2L1-      -ggat-gacgctggtga-----ctgg------------------------
A0A3Q1GZ93_BCL2L1-      -gcat-gaccctggtga-----ctgg------------------------
A0A3Q1GZ93_BCL2L1-      -gcat-gaccctggtga-----ctgg------------------------
A0A3Q1GZ93_BCL2L1-      -gcat-gaccctggtga-----ctgg------------------------
A0A0D6DR75_BCL2L1-      -ggat-gacggtggtga-----cggg------------------------
A0A3B3E2W4_BCL2L1-      -cagt-ggcacttctaa-----ccgg------------------------
A0A3B3ICL7_BCL2L1-      -cagt-ggcccttttaa-----ctgg------------------------
A0A3B3ICL7_BCL2L1-      -cagt-ggcccttttaa-----ctgg------------------------
A0A3B4BFZ8_BCL2L1-      -gagt-agggttgctag-----ctgg------------------------
A0A3P8VMA1_BCL2L1-      -gagc-aggcctgcttg-----cagc------------------------
A0A0F7L1T6_BCL2L1-      -gatt-ggcgctgctga-----tggg------------------------
H2U5I3_BCL2L1-01        -gatt-ggcgctgctga-----tggg------------------------
H2U5I3_BCL2L1-02        -gatt-ggcgctgctga-----tggg------------------------
G3P7B4_BCL2L1-01        -gggt-ggcgctgctaa-----tggg------------------------
A0A3Q3FUB6_BCL2L1-      -gaat-ggcgctgctaa-----tggg------------------------
A0A3Q3X5M5_BCL2L1-      -gggt-ggcgctgctaa-----tggg------------------------
A0A2U9BIG9_BCL2L1-      -gagt-ggggatgctga-----cagg------------------------
A0A3Q1JZ46_BCL2L1-      -gagt-ggtgctgctca-----cggg------------------------
A0A3Q1JZ46_BCL2L1-      -gagt-ggtgctgctca-----cggg------------------------
A0A3Q3NFM4_BCL2L1-      -gagt-ggcgctgctaa-----cggg------------------------
A0A3Q3NFM4_BCL2L1-      -gagt-ggcgctgctaa-----cggg------------------------
A0A3Q3J5K3_BCL2L1-      -gagt-ggtgctgctaa-----cagg------------------------
A0A3B4V9K8_BCL2L1-      -gagt-ggcaatgttgg-----cagg------------------------
A0A3B4XS24_BCL2L1-      -gagt-ggcgatgttgg-----cagg------------------------
A0A3B5B4X7_BCL2L1-      -gagg-ggcgctgctaa-----cggg------------------------
A0A3Q1EVP6_BCL2L1-      -gagg-ggtgctgctaa-----tggg------------------------
A0A3Q1BQA0_BCL2L1-      -gagg-ggtgctgctaa-----tggg------------------------
A0A3P8U812_BCL2L1-      -gagg-ggtgctgctaa-----tggg------------------------
E6ZFR0_BCL2L1-01        -gggt-ggcgctgctaa-----tggg------------------------
A0A0B4KJI5_BCL2L1-      -gagt-ggcgctgctaa-----tggg------------------------
A0A3Q3BEB7_BCL2L1-      -gagc-ggcgctgctgg-----ctgg------------------------
A0A3Q2C6K4_BCL2L1-      -gtgc-ggctctgctcg-----gcgg------------------------
A0A3Q2NRP4_BCL2L1-      -gcgc-ggctctgctaa-----ccgg------------------------
A0A3B5MGS2_BCL2L1-      -gtgt-ggctctgctga-----ccgg------------------------
M4A558_BCL2L1-01        -gtgt-ggctctgctga-----ccgg------------------------
A0A3P9QFB3_BCL2L1-      -gtgt-ggctctgctga-----ccgg------------------------
A0A3B3XN57_BCL2L1-      -gtgt-ggctctgctga-----ccgg------------------------
A0A087YBW4_BCL2L1-      -gtgt-ggctctgctga-----ccgg------------------------
A0A3B3VWI7_BCL2L1-      -gtgt-ggctctgctga-----ccgg------------------------
                                                                          

R4JQR8_BCL2L1-01        ------aatggcg-----------------------------ttaag---
A0A346RRN1_BCL2L1-      ------ccttgcc-----------------------------cttgg---
Q6GLI5_BCL2L1-01        ------aacctta-----------------------------ttggtct-
Q2TAP5_BCL2L1-01        ------tttcgca-----------------------------ttggtct-
Q91828_BCL2L1-01        ------tttcgca-----------------------------ttggtct-
H9GHK7_BCL2L1-01        ------------------------------------------ctgaaca-
F6WA14_BCL2L1-01        ------agtcctg-----------------------------ctggggt-
G3WKX6_BCL2L1-01        ------agtcctg-----------------------------ctggggt-
A0A452FIG6_BCL2L1-      aggaaggcagctgtctctaaagataccc--------------cttggct-
A0A452FIG6_BCL2L1-      gtgactgttcctttcattacagtcattcatgttttgcacaagcttgtgt-
A0A3Q1LRT3_BCL2L1-      ------gcatttt-----------------------------cttaatta
A0A452E1B1_BCL2L1-      ------ggctctg-----------------------------ctgggct-
W5PSA5_BCL2L1-01        ------ggctctg-----------------------------ctgggct-
G3SPN0_BCL2L1-01        ------gaagtta-----------------------------gtccagt-
H0X6V2_BCL2L1-01        ------agttat---------------------------------gggt-
P53563_BCL2L1-03        ga----gacattc-----------------------------ctggctt-
P53563_BCL2L1-02        ga----gacattc-----------------------------ctggctt-
P53563_BCL2L1-04        ga----gacattc-----------------------------ctggc-t-
P53563_BCL2L1-01        ------agttctg-----------------------------ctgggct-
O35843_BCL2L1-01        gttcaaggccctc-----------------------------ctcagct-
Q64373_BCL2L1-09        ------ggttctg-----------------------------ctgggct-
Q64373_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q64373_BCL2L1-03        ------ctctctt-----------------------------ctctgtg-
Q64373_BCL2L1-04        ------ctctctt-----------------------------ctctgtg-
B2Z3Z4_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q9MYW4_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
O77737_BCL2L1-01        ------ggttctg-----------------------------ctgggtt-
A0A286Y5D6_BCL2L1-      ------ggttctg-----------------------------ctgggct-
G1P9D2_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q05KJ0_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
Q05KJ0_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A452FWV3_BCL2L1-      ------ggttctg-----------------------------ctgggct-
Q9MZS7_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
F6WQI0_BCL2L1-02        ------ggttttt-----------------------------ct---ct-
A0A2U3V0P1_BCL2L1-      ------gcttctg-----------------------------ctgggct-
A0A1L5BWY3_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A287CZ07_BCL2L1-      ------ggttctg-----------------------------ctgggct-
I3MUP5_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
I3MUP5_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
I3MUP5_BCL2L1-03        ------ggttctg-----------------------------ctgggct-
F6WQI0_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
E2IV76_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K6G3C5_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6G3C5_BCL2L1-      ------ggttctg-----------------------------ctgggct-
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      ------ggttctg-----------------------------ctgggct-
Q07817_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q07817_BCL2L1-03        ------ggttctg-----------------------------ctgggct-
Q07817_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
G3RY91_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
G3RY91_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K5H963_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5H963_BCL2L1-      ------ggttctg-----------------------------ctgggct-
Q2PFS6_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K5M8B1_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5M8B1_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6LPM4_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6QFA2_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5VPG2_BCL2L1-      ------ggttctg-----------------------------ctgggct-
F6UKR4_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
A0A2K5YR37_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5YR37_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5VPG2_BCL2L1-      ------ggttctg-----------------------------ctgggct-
F6UKR4_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A0D9RJZ8_BCL2L1-      ------ggttctg-----------------------------ctgggct-
I7GKS6_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K6LPM4_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6QFA2_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6QFA2_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5YR37_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K6UWY8_BCL2L1-      ------ggttctg-----------------------------ctgggct-
E2IV77_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K6UWY8_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A2K5EBP4_BCL2L1-      ------ggttctg-----------------------------ctgggct-
E2IV75_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
F7IT34_BCL2L1-02        ------ggttctg-----------------------------ctgggct-
F7IT34_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A2K5EBP4_BCL2L1-      ------ggttctg-----------------------------ctgggct-
M3Z2H9_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q76LT7_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
Q8SQ42_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
M3XA94_BCL2L1-01        ------ggttctg-----------------------------ctgggct-
A0A452SDS4_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A384D3U1_BCL2L1-      ------ggttctg-----------------------------ctgggct-
A0A452ILL8_BCL2L1-      ------gctcctg-----------------------------ctgggct-
A0A452ILL8_BCL2L1-      ------gctcctg-----------------------------ctgggct-
K7F655_BCL2L1-01        ------gctcctc-----------------------------ctgggct-
U3JSL7_BCL2L1-01        ------gcttctg-----------------------------ctgggat-
Q4U2V6_BCL2L1-01        ------gcttctg-----------------------------ctgggat-
H0Z8G3_BCL2L1-01        ------gcttctg-----------------------------ctgggat-
Q07816_BCL2L1-04        ------gcttctg-----------------------------ctgggat-
Q07816_BCL2L1-03        ------gcttctg-----------------------------ctgggat-
Q07816_BCL2L1-02        ------gcttctg-----------------------------ctgggat-
Q07816_BCL2L1-01        ------gcttctg-----------------------------ctgggat-
G1N5N5_BCL2L1-01        ------gcttctg-----------------------------ctgggat-
H3ANS8_BCL2L1-01        ------cttctgc-----------------------------gtggggtg
A0A3B5K6B9_BCL2L1-      ------gatcgca-----------------------------atcgggt-
A0A3B5K6B9_BCL2L1-      ------gatcgca-----------------------------atcgggt-
H3CH49_BCL2L1-01        ------gatcgcc-----------------------------ctcggct-
C1BLI0_BCL2L1-01        ------agtgttg-----------------------------gtcggct-
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      ------agtgctg-----------------------------gttggca-
A0A286MU87_BCL2L1-      ------agtgctg-----------------------------gtcggca-
C0HAD8_BCL2L1-01        ------agtgctg-----------------------------gtcggca-
A0A345BSW9_BCL2L1-      ------tttcttc-----------------------------------a-
Q90Z98_BCL2L1-01        ------tgtcgtc-----------------------------gttgggg-
Q90Z98_BCL2L1-02        ------tgtcgtc-----------------------------gttgggg-
A0A059PJI5_BCL2L1-      ------ggtggtg-----------------------------gtgggct-
A0A3B3ZN55_BCL2L1-      ------ggtcgtg-----------------------------gtggggt-
A0A3B3ZN55_BCL2L1-      ------ggtcgtg-----------------------------gtggggt-
D2ITA2_BCL2L1-02        ------ggtgctg-----------------------------ctcgggg-
A0A3P8UWG7_BCL2L1-      ------cgtggtg-----------------------------gtgggct-
A0A3B3QRZ2_BCL2L1-      ------agttgtt-----------------------------gtgggct-
A0A3B1JJ42_BCL2L1-      ------aattgtg-----------------------------gtgggct-
A0A3B4DTL9_BCL2L1-      ------ggttgtg-----------------------------gtgggct-
A0A3P8XYL5_BCL2L1-      ------agttgtc-----------------------------gttgggt-
B5XAY3_BCL2L1-01        ------agtcgtc-----------------------------gtagggt-
A0A3B3TFR4_BCL2L1-      ------agcgctg-----------------------------gtcggct-
A0A3Q3DUT7_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3Q3DUT7_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3Q3DUT7_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
W5MG74_BCL2L1-01        ------gctggtg-----------------------------gtgggct-
A0A3Q3WIW8_BCL2L1-      ------agtcgtg-----------------------------gttggct-
A0A2U9BY16_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3B5PQJ0_BCL2L1-      ------cttcata-----------------------------gccgggt-
A0A3P9N9Y4_BCL2L1-      ------cttcata-----------------------------gccgggt-
A0A3B3WI27_BCL2L1-      ------cttcata-----------------------------gccgggt-
A0A087X9B7_BCL2L1-      ------cttcata-----------------------------gccgggt-
A0A3B3TUS7_BCL2L1-      ------cttcata-----------------------------gccgggt-
A0A3Q2FR43_BCL2L1-      ------cctcata-----------------------------gccggct-
A0A3Q2QPL9_BCL2L1-      ------cttcata-----------------------------gccggct-
A0A3Q3B3X5_BCL2L1-      ------ggtggtg-----------------------------gcgggtt-
A0A3Q0RTF8_BCL2L1-      ------cgtcgtg-----------------------------gcaggtg-
I3IZK7_BCL2L1-01        ------cgttgtg-----------------------------gctggtg-
A0A3Q4N4B5_BCL2L1-      ------cgtcgtg-----------------------------gcgggtg-
A0A3Q2X557_BCL2L1-      ------cgttgtg-----------------------------gcgggtg-
A0A3P8P0F1_BCL2L1-      ------cgttgtg-----------------------------gcgggtg-
A0A3P9D632_BCL2L1-      ------cgttgtg-----------------------------gcgggtg-
A0A3P9D632_BCL2L1-      ------cgttgtg-----------------------------gcgggtg-
A0A3B4FNX1_BCL2L1-      ------cgttgtg-----------------------------gcgggtg-
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      ------cgtcctg-----------------------------gtgggat-
A0A3P9JYH1_BCL2L1-      ------cgtcctg-----------------------------gtgggat-
A0A3B3DHA1_BCL2L1-      ------cgtcctg-----------------------------gtgggat-
C3VIT1_BCL2L1-01        ------ggtggtg-----------------------------gtgggct-
A0A3B4Z3X2_BCL2L1-      ------ggtcgtg-----------------------------gtcggtt-
A0A3B4Z3X2_BCL2L1-      ------ggtcgtg-----------------------------gtcggtt-
A0A3Q1GS47_BCL2L1-      ------ggtggtg-----------------------------gtggggt-
A0A3Q1GS47_BCL2L1-      ------ggtggtg-----------------------------gtggggt-
A0A3Q1DHJ3_BCL2L1-      ------ggtggtg-----------------------------gtgggat-
A0A3Q1DHJ3_BCL2L1-      ------ggtggtg-----------------------------gtgggat-
A0A3Q1DHJ3_BCL2L1-      ------ggtggtg-----------------------------gtgggat-
A0A3P8TL99_BCL2L1-      ------ggtggtg-----------------------------gtgggat-
A0A3P8TL99_BCL2L1-      ------ggtggtg-----------------------------gtgggat-
A0A219P0Y3_BCL2L1-      ------agttgtg-----------------------------gtgggct-
A0A3Q3G2E1_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3Q3G2E1_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3Q3G2E1_BCL2L1-      ------ggtcgtg-----------------------------gtgggct-
A0A3B4V3T1_BCL2L1-      ------ggttgtg-----------------------------gtgggct-
A0A3B4XU17_BCL2L1-      ------ggttgtg-----------------------------gtgggct-
A0A3Q3IVF5_BCL2L1-      ------cgtcgtg-----------------------------gtgggct-
A0A3Q3MX20_BCL2L1-      ------ggtcgtg-----------------------------gtgggtt-
A0A3Q1GZ93_BCL2L1-      ------ggtcgtg-----------------------------gtggggt-
A0A3Q1GZ93_BCL2L1-      ------ggtcgtg-----------------------------gtggggt-
A0A3Q1GZ93_BCL2L1-      ------ggtcgtg-----------------------------gtggggt-
A0A0D6DR75_BCL2L1-      ------cgttgtg-----------------------------gctggtg-
A0A3B3E2W4_BCL2L1-      ------actgctg-----------------------------cttggtt-
A0A3B3ICL7_BCL2L1-      ------actgctg-----------------------------ctgggtg-
A0A3B3ICL7_BCL2L1-      ------actgctg-----------------------------ctgggtg-
A0A3B4BFZ8_BCL2L1-      ------agtgctg-----------------------------gttgcta-
A0A3P8VMA1_BCL2L1-      ------agtgttg-----------------------------attggtg-
A0A0F7L1T6_BCL2L1-      ------agttttg-----------------------------gtcggcg-
H2U5I3_BCL2L1-01        ------agttttg-----------------------------gtcggcg-
H2U5I3_BCL2L1-02        ------agttttg-----------------------------gtcggcg-
G3P7B4_BCL2L1-01        ------agtgctc-----------------------------gtcggta-
A0A3Q3FUB6_BCL2L1-      ------agtcgtg-----------------------------gttggtg-
A0A3Q3X5M5_BCL2L1-      ------agttatg-----------------------------gtcggtg-
A0A2U9BIG9_BCL2L1-      ------agtgctg-----------------------------attgcta-
A0A3Q1JZ46_BCL2L1-      ------agtgctg-----------------------------ttaggtg-
A0A3Q1JZ46_BCL2L1-      ------agtgctg-----------------------------ttaggtg-
A0A3Q3NFM4_BCL2L1-      ------agtgctg-----------------------------ataggtg-
A0A3Q3NFM4_BCL2L1-      ------agtgctg-----------------------------ataggtg-
A0A3Q3J5K3_BCL2L1-      ------agtgctg-----------------------------gttggtg-
A0A3B4V9K8_BCL2L1-      ------agtgctg-----------------------------atgggcg-
A0A3B4XS24_BCL2L1-      ------agtgctg-----------------------------atgggcg-
A0A3B5B4X7_BCL2L1-      ------agtgctg-----------------------------gctggtg-
A0A3Q1EVP6_BCL2L1-      ------agtgctg-----------------------------gctggtg-
A0A3Q1BQA0_BCL2L1-      ------agttctg-----------------------------gctggtg-
A0A3P8U812_BCL2L1-      ------agttctg-----------------------------gctggtg-
E6ZFR0_BCL2L1-01        ------agctgtg-----------------------------gtcgggg-
A0A0B4KJI5_BCL2L1-      ------agttgtg-----------------------------ctcggtg-
A0A3Q3BEB7_BCL2L1-      ------gctgctt-----------------------------ctcggcg-
A0A3Q2C6K4_BCL2L1-      ------agttctg-----------------------------ctcactg-
A0A3Q2NRP4_BCL2L1-      ------atttctg-----------------------------ctcgtcg-
A0A3B5MGS2_BCL2L1-      ------agctctg-----------------------------ctcgtcg-
M4A558_BCL2L1-01        ------agctctg-----------------------------ctcgtcg-
A0A3P9QFB3_BCL2L1-      ------agctctg-----------------------------ctcgtca-
A0A3B3XN57_BCL2L1-      ------agctctg-----------------------------ctcgtca-
A0A087YBW4_BCL2L1-      ------agctctg-----------------------------ctcgtca-
A0A3B3VWI7_BCL2L1-      ------agctctg-----------------------------ctcgtca-
                                                                          

R4JQR8_BCL2L1-01        -------------------------------tgcttttctac--------
A0A346RRN1_BCL2L1-      -------------------------------tgctttactac--------
Q6GLI5_BCL2L1-01        -------------------------------cctacctgagg--------
Q2TAP5_BCL2L1-01        -------------------------------gctacatgagg--------
Q91828_BCL2L1-01        -------------------------------gctacatgagg--------
H9GHK7_BCL2L1-01        -------------------------------cttacattgat--------
F6WA14_BCL2L1-01        -------------------------------ccctattcagc--------
G3WKX6_BCL2L1-01        -------------------------------ccctgttcagc--------
A0A452FIG6_BCL2L1-      -------------------------------caccttcccctctccccat
A0A452FIG6_BCL2L1-      -------------------------------tcccttccttttgttaca-
A0A3Q1LRT3_BCL2L1-      aacatatatttaccaaacaacccagcaattgtactcttgagcatttatc-
A0A452E1B1_BCL2L1-      -------------------------------tgctcttcaac--------
W5PSA5_BCL2L1-01        -------------------------------tgctcttcaac--------
G3SPN0_BCL2L1-01        -------------------------------gtttcctcacc--------
H0X6V2_BCL2L1-01        -------------------------------tattct-------------
P53563_BCL2L1-03        -------------------------------cactttaatac--------
P53563_BCL2L1-02        -------------------------------cactttaatac--------
P53563_BCL2L1-04        -------------------------------cactttaa-----------
P53563_BCL2L1-01        -------------------------------cactcttcagt--------
O35843_BCL2L1-01        -------------------------------atta---------------
Q64373_BCL2L1-09        -------------------------------cactcttcagt--------
Q64373_BCL2L1-01        -------------------------------cactcttcagt--------
Q64373_BCL2L1-03        -------------------------------aacatccc-----------
Q64373_BCL2L1-04        -------------------------------aacatccc-----------
B2Z3Z4_BCL2L1-01        -------------------------------ctctcttcagt--------
Q9MYW4_BCL2L1-01        -------------------------------ccctcttcagc--------
O77737_BCL2L1-01        -------------------------------cgctcttcagt--------
A0A286Y5D6_BCL2L1-      -------------------------------cgctcttcagt--------
G1P9D2_BCL2L1-01        -------------------------------cactcttcagt--------
Q05KJ0_BCL2L1-02        -------------------------------cgctcttcagt--------
Q05KJ0_BCL2L1-01        -------------------------------cgctcttcagt--------
A0A452FWV3_BCL2L1-      -------------------------------cgctcttcagt--------
Q9MZS7_BCL2L1-01        -------------------------------cgctcttcagt--------
F6WQI0_BCL2L1-02        -------------------------------cgctcttcaggaaatgcc-
A0A2U3V0P1_BCL2L1-      -------------------------------cgctcttcagt--------
A0A1L5BWY3_BCL2L1-      -------------------------------cgctcttcagt--------
A0A287CZ07_BCL2L1-      -------------------------------cacttttcagt--------
I3MUP5_BCL2L1-01        -------------------------------cgcttttcagt--------
I3MUP5_BCL2L1-02        -------------------------------cgcttttcagt--------
I3MUP5_BCL2L1-03        -------------------------------cgcttttcagt--------
F6WQI0_BCL2L1-01        -------------------------------cactcttcagt--------
E2IV76_BCL2L1-01        -------------------------------cgcttttcagt--------
A0A2K6G3C5_BCL2L1-      -------------------------------cgctcttcagt--------
A0A2K6G3C5_BCL2L1-      -------------------------------cgctcttcagt--------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      -------------------------------cactcttcagt--------
Q07817_BCL2L1-01        -------------------------------cactcttcagt--------
Q07817_BCL2L1-03        -------------------------------cactcttcagt--------
Q07817_BCL2L1-02        -------------------------------cactcttcagt--------
G3RY91_BCL2L1-02        -------------------------------cactcttcagt--------
G3RY91_BCL2L1-01        -------------------------------cactcttcagt--------
A0A2K5H963_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5H963_BCL2L1-      -------------------------------cactcttcagt--------
Q2PFS6_BCL2L1-01        -------------------------------cactcttcagt--------
A0A2K5M8B1_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5M8B1_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K6LPM4_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K6QFA2_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5VPG2_BCL2L1-      -------------------------------cactcttcagt--------
F6UKR4_BCL2L1-02        -------------------------------cactcttcagt--------
A0A2K5YR37_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5YR37_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5VPG2_BCL2L1-      -------------------------------cactcttcagt--------
F6UKR4_BCL2L1-01        -------------------------------cactcttcagt--------
A0A0D9RJZ8_BCL2L1-      -------------------------------cactcttcagt--------
I7GKS6_BCL2L1-01        -------------------------------cactcttcagt--------
A0A2K6LPM4_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K6QFA2_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K6QFA2_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K5YR37_BCL2L1-      -------------------------------cactcttcagt--------
A0A2K6UWY8_BCL2L1-      -------------------------------cactctttagt--------
E2IV77_BCL2L1-01        -------------------------------cactctttagt--------
A0A2K6UWY8_BCL2L1-      -------------------------------cactctttagt--------
A0A2K5EBP4_BCL2L1-      -------------------------------cactctttagt--------
E2IV75_BCL2L1-01        -------------------------------cactctttagt--------
F7IT34_BCL2L1-02        -------------------------------cactctttagt--------
F7IT34_BCL2L1-01        -------------------------------cactctttagt--------
A0A2K5EBP4_BCL2L1-      -------------------------------cactctttagt--------
M3Z2H9_BCL2L1-01        -------------------------------cactcttcagt--------
Q76LT7_BCL2L1-01        -------------------------------cgctcttcagt--------
Q8SQ42_BCL2L1-01        -------------------------------cactcttcagt--------
M3XA94_BCL2L1-01        -------------------------------cactcttcagt--------
A0A452SDS4_BCL2L1-      -------------------------------cgctcttcagt--------
A0A384D3U1_BCL2L1-      -------------------------------cgctcttcagt--------
A0A452ILL8_BCL2L1-      -------------------------------ctctgctgagc--------
A0A452ILL8_BCL2L1-      -------------------------------ctctgctgagc--------
K7F655_BCL2L1-01        -------------------------------cgctgctgagc--------
U3JSL7_BCL2L1-01        -------------------------------cgctgctgagc--------
Q4U2V6_BCL2L1-01        -------------------------------ccctgctgagc--------
H0Z8G3_BCL2L1-01        -------------------------------ccctgctgagc--------
Q07816_BCL2L1-04        -------------------------------ccctgctgagc--------
Q07816_BCL2L1-03        -------------------------------ccctgctgagc--------
Q07816_BCL2L1-02        -------------------------------ccctgctgagc--------
Q07816_BCL2L1-01        -------------------------------ccctgctgagc--------
G1N5N5_BCL2L1-01        -------------------------------ccctgctgagc--------
H3ANS8_BCL2L1-01        gaaagaaacctcaaa----------------ctctttttgcg--------
A0A3B5K6B9_BCL2L1-      -------------------------------cgttcatagtg--------
A0A3B5K6B9_BCL2L1-      -------------------------------cgttcatagtg--------
H3CH49_BCL2L1-01        -------------------------------ccttcatcgtc--------
C1BLI0_BCL2L1-01        -------------------------------ctctcattgca--------
A0A3P8XFS0_BCL2L1-      -----------------------------------------g--------
A0A3P8XFS0_BCL2L1-      -------------------------------ctctcctcatg--------
A0A286MU87_BCL2L1-      -------------------------------ctctcatcatg--------
C0HAD8_BCL2L1-01        -------------------------------ctctcatcatg--------
A0A345BSW9_BCL2L1-      -------------------------------gtttaatcaca--------
Q90Z98_BCL2L1-01        -------------------------------gactcattgca--------
Q90Z98_BCL2L1-02        -------------------------------gactcattgca--------
A0A059PJI5_BCL2L1-      -------------------------------ccttcatcgct--------
A0A3B3ZN55_BCL2L1-      -------------------------------cactgctcgcc--------
A0A3B3ZN55_BCL2L1-      -------------------------------cactgctcgcc--------
D2ITA2_BCL2L1-02        -------------------------------ctctgctcgcc--------
A0A3P8UWG7_BCL2L1-      -------------------------------ccctgattgcc--------
A0A3B3QRZ2_BCL2L1-      -------------------------------ctctcattgca--------
A0A3B1JJ42_BCL2L1-      -------------------------------ctctcatcgct--------
A0A3B4DTL9_BCL2L1-      -------------------------------ccctcatcgct--------
A0A3P8XYL5_BCL2L1-      -------------------------------ctcttattgct--------
B5XAY3_BCL2L1-01        -------------------------------cactcttcgct--------
A0A3B3TFR4_BCL2L1-      -------------------------------tcctcatcgcc--------
A0A3Q3DUT7_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3Q3DUT7_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3Q3DUT7_BCL2L1-      -------------------------------cgctcatcgcc--------
W5MG74_BCL2L1-01        -------------------------------cctacatcgcc--------
A0A3Q3WIW8_BCL2L1-      -------------------------------cgctcattgtc--------
A0A2U9BY16_BCL2L1-      -------------------------------cactgattgcc--------
A0A3B5PQJ0_BCL2L1-      -------------------------------ccatcttcgcc--------
A0A3P9N9Y4_BCL2L1-      -------------------------------ccatctttgcc--------
A0A3B3WI27_BCL2L1-      -------------------------------ccatcttcgcc--------
A0A087X9B7_BCL2L1-      -------------------------------ccatcttcgcc--------
A0A3B3TUS7_BCL2L1-      -------------------------------ccatcttcgcc--------
A0A3Q2FR43_BCL2L1-      -------------------------------ccatcttcgcc--------
A0A3Q2QPL9_BCL2L1-      -------------------------------ccatcttcgtc--------
A0A3Q3B3X5_BCL2L1-      -------------------------------cgctcttcgcc--------
A0A3Q0RTF8_BCL2L1-      -------------------------------cactcatcgcg--------
I3IZK7_BCL2L1-01        -------------------------------ctcttatcgcg--------
A0A3Q4N4B5_BCL2L1-      -------------------------------cgcttatcgcg--------
A0A3Q2X557_BCL2L1-      -------------------------------cgcttatcgcg--------
A0A3P8P0F1_BCL2L1-      -------------------------------cgcttatcgcg--------
A0A3P9D632_BCL2L1-      -------------------------------cgcttatcgcg--------
A0A3P9D632_BCL2L1-      -------------------------------cgcttatcgcg--------
A0A3B4FNX1_BCL2L1-      -------------------------------cgcttatcgcg--------
G3NJY1_BCL2L1-01        --------------------------------------cgtt--------
A0A3B3IB64_BCL2L1-      -------------------------------ccttcctcgcc--------
A0A3P9JYH1_BCL2L1-      -------------------------------ccttcctcgcc--------
A0A3B3DHA1_BCL2L1-      -------------------------------ccttcatcgcc--------
C3VIT1_BCL2L1-01        -------------------------------cgctgttcgcc--------
A0A3B4Z3X2_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3B4Z3X2_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3Q1GS47_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3Q1GS47_BCL2L1-      -------------------------------cgctcatcgcc--------
A0A3Q1DHJ3_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3Q1DHJ3_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3Q1DHJ3_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3P8TL99_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3P8TL99_BCL2L1-      -------------------------------cactcatcgcc--------
A0A219P0Y3_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3Q3G2E1_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3Q3G2E1_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3Q3G2E1_BCL2L1-      -------------------------------cactcatcgcc--------
A0A3B4V3T1_BCL2L1-      -------------------------------cactgattgcc--------
A0A3B4XU17_BCL2L1-      -------------------------------cactgatcgcc--------
A0A3Q3IVF5_BCL2L1-      -------------------------------cactcatcatc--------
A0A3Q3MX20_BCL2L1-      -------------------------------cacttattgcc--------
A0A3Q1GZ93_BCL2L1-      -------------------------------cactcatagcg--------
A0A3Q1GZ93_BCL2L1-      -------------------------------cactcatagcg--------
A0A3Q1GZ93_BCL2L1-      -------------------------------cactcatagcg--------
A0A0D6DR75_BCL2L1-      -------------------------------ctcttatcgcg--------
A0A3B3E2W4_BCL2L1-      -------------------------------tgctcattgcc--------
A0A3B3ICL7_BCL2L1-      -------------------------------tgctcatcacc--------
A0A3B3ICL7_BCL2L1-      -------------------------------tgctcatcacc--------
A0A3B4BFZ8_BCL2L1-      -------------------------------tgctcattgct--------
A0A3P8VMA1_BCL2L1-      -------------------------------ttctgatcact--------
A0A0F7L1T6_BCL2L1-      -------------------------------ctttcatcgtc--------
H2U5I3_BCL2L1-01        -------------------------------ctttcatcgtc--------
H2U5I3_BCL2L1-02        -------------------------------ctttcatcgtc--------
G3P7B4_BCL2L1-01        -------------------------------tggtcatggtc--------
A0A3Q3FUB6_BCL2L1-      -------------------------------tttacatcgct--------
A0A3Q3X5M5_BCL2L1-      -------------------------------tgttcattgct--------
A0A2U9BIG9_BCL2L1-      -------------------------------tgttcatcgct--------
A0A3Q1JZ46_BCL2L1-      -------------------------------tgctcattgct--------
A0A3Q1JZ46_BCL2L1-      -------------------------------tgctcattgct--------
A0A3Q3NFM4_BCL2L1-      -------------------------------tgctcatcgct--------
A0A3Q3NFM4_BCL2L1-      -------------------------------tgctcatcgct--------
A0A3Q3J5K3_BCL2L1-      -------------------------------tgcttgtcgct--------
A0A3B4V9K8_BCL2L1-      -------------------------------tgctcatcgtt--------
A0A3B4XS24_BCL2L1-      -------------------------------tgctcatcgtt--------
A0A3B5B4X7_BCL2L1-      -------------------------------tgctcatcgct--------
A0A3Q1EVP6_BCL2L1-      -------------------------------tactcattgct--------
A0A3Q1BQA0_BCL2L1-      -------------------------------tgctcattgct--------
A0A3P8U812_BCL2L1-      -------------------------------tgctcattgct--------
E6ZFR0_BCL2L1-01        -------------------------------ttctcattgct--------
A0A0B4KJI5_BCL2L1-      -------------------------------tcctcatcgct--------
A0A3Q3BEB7_BCL2L1-      -------------------------------tgctcgtggct--------
A0A3Q2C6K4_BCL2L1-      -------------------------------tgcttgttgct--------
A0A3Q2NRP4_BCL2L1-      -------------------------------tgctcttcgcc--------
A0A3B5MGS2_BCL2L1-      -------------------------------tgttcgtcgct--------
M4A558_BCL2L1-01        -------------------------------tgttcgtcgct--------
A0A3P9QFB3_BCL2L1-      -------------------------------tgtttatcgct--------
A0A3B3XN57_BCL2L1-      -------------------------------tgtttgtcgct--------
A0A087YBW4_BCL2L1-      -------------------------------tgttcgtcgct--------
A0A3B3VWI7_BCL2L1-      -------------------------------tgttcgtcgct--------
                                                                          

R4JQR8_BCL2L1-01        -atagaacg-----------tga---------------------------
A0A346RRN1_BCL2L1-      -aaagggta-----------tga---------------------------
Q6GLI5_BCL2L1-01        -cgtcga-------------tag---------------------------
Q2TAP5_BCL2L1-01        -cgccga-------------tag---------------------------
Q91828_BCL2L1-01        -cgccga-------------tag---------------------------
H9GHK7_BCL2L1-01        --------------------tga---------------------------
F6WA14_BCL2L1-01        -cggaag-------------tga---------------------------
G3WKX6_BCL2L1-01        -cggaag-------------tga---------------------------
A0A452FIG6_BCL2L1-      gctcaag----cctac----tga---------------------------
A0A452FIG6_BCL2L1-      gctatagagaccttacaatttaa---------------------------
A0A3Q1LRT3_BCL2L1-      tgggaga-------------tacgcaacattactgtag------------
A0A452E1B1_BCL2L1-      -acataa-------------------------------------------
W5PSA5_BCL2L1-01        -tgtaag-------------------------------------------
G3SPN0_BCL2L1-01        -ctgaca-------------caa---------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        -cagggg-------------ttaactttgggaatattgatgaccctgttt
P53563_BCL2L1-02        -cagggg-------------ttaactttgggaatattgatgaccctgttt
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        -cggaag-------------tga---------------------------
O35843_BCL2L1-01        --------------------tag---------------------------
Q64373_BCL2L1-09        -cggaag-------------tga---------------------------
Q64373_BCL2L1-01        -cggaag-------------tga---------------------------
Q64373_BCL2L1-03        --------------------taa---------------------------
Q64373_BCL2L1-04        --------------------taa---------------------------
B2Z3Z4_BCL2L1-01        -cggaag-------------tga---------------------------
Q9MYW4_BCL2L1-01        -cggaaa-------------tga---------------------------
O77737_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A286Y5D6_BCL2L1-      -cggaaa-------------tga---------------------------
G1P9D2_BCL2L1-01        -cggaaa-------------tga---------------------------
Q05KJ0_BCL2L1-02        -cggaaa-------------tga---------------------------
Q05KJ0_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A452FWV3_BCL2L1-      -cggaaa-------------tga---------------------------
Q9MZS7_BCL2L1-01        -cggaaa-------------tga---------------------------
F6WQI0_BCL2L1-02        attgcaa-------------tga---------------------------
A0A2U3V0P1_BCL2L1-      -cggaaa-------------tga---------------------------
A0A1L5BWY3_BCL2L1-      -cggaaa-------------tga---------------------------
A0A287CZ07_BCL2L1-      -cggaaa-------------tga---------------------------
I3MUP5_BCL2L1-01        -cggaaa-------------tga---------------------------
I3MUP5_BCL2L1-02        -cggaaa-------------tga---------------------------
I3MUP5_BCL2L1-03        -cggaaa-------------tga---------------------------
F6WQI0_BCL2L1-01        -cggaag-------------tga---------------------------
E2IV76_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K6G3C5_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6G3C5_BCL2L1-      -cggaaa-------------tga---------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      -cggaaa-------------tga---------------------------
Q07817_BCL2L1-01        -cggaaa-------------tga---------------------------
Q07817_BCL2L1-03        -cggaaa-------------tga---------------------------
Q07817_BCL2L1-02        -cggaaa-------------tga---------------------------
G3RY91_BCL2L1-02        -cggaaa-------------tga---------------------------
G3RY91_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K5H963_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5H963_BCL2L1-      -cggaaa-------------tga---------------------------
Q2PFS6_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K5M8B1_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5M8B1_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6LPM4_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6QFA2_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5VPG2_BCL2L1-      -cggaaa-------------tga---------------------------
F6UKR4_BCL2L1-02        -cggaaa-------------tga---------------------------
A0A2K5YR37_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5YR37_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5VPG2_BCL2L1-      -cggaaa-------------tga---------------------------
F6UKR4_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A0D9RJZ8_BCL2L1-      -cggaaa-------------tga---------------------------
I7GKS6_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K6LPM4_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6QFA2_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6QFA2_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5YR37_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K6UWY8_BCL2L1-      -cggaaa-------------tga---------------------------
E2IV77_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K6UWY8_BCL2L1-      -cggaaa-------------tga---------------------------
A0A2K5EBP4_BCL2L1-      -cggaaa-------------tga---------------------------
E2IV75_BCL2L1-01        -cggaaa-------------tga---------------------------
F7IT34_BCL2L1-02        -cggaaa-------------tga---------------------------
F7IT34_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A2K5EBP4_BCL2L1-      -cggaaa-------------tga---------------------------
M3Z2H9_BCL2L1-01        -cggaaa-------------tga---------------------------
Q76LT7_BCL2L1-01        -cggaaa-------------tga---------------------------
Q8SQ42_BCL2L1-01        -cggaaa-------------tga---------------------------
M3XA94_BCL2L1-01        -cggaaa-------------tga---------------------------
A0A452SDS4_BCL2L1-      -cggaaa-------------tga---------------------------
A0A384D3U1_BCL2L1-      -cggaaa-------------tga---------------------------
A0A452ILL8_BCL2L1-      -cgcaag-------------taa---------------------------
A0A452ILL8_BCL2L1-      -cgcaag-------------taa---------------------------
K7F655_BCL2L1-01        -cgcaag-------------tag---------------------------
U3JSL7_BCL2L1-01        -cgcaag-------------tga---------------------------
Q4U2V6_BCL2L1-01        -cgcaag-------------tga---------------------------
H0Z8G3_BCL2L1-01        -cgcaag-------------tga---------------------------
Q07816_BCL2L1-04        -cgcaag-------------tgaccccatggttgtgtcccctggcaccag
Q07816_BCL2L1-03        -cgcaag-------------tga---------------------------
Q07816_BCL2L1-02        -cgcaag-------------tga---------------------------
Q07816_BCL2L1-01        -cgcaag-------------tga---------------------------
G1N5N5_BCL2L1-01        -cgcaag-------------tga---------------------------
H3ANS8_BCL2L1-01        -caaa---------------tga---------------------------
A0A3B5K6B9_BCL2L1-      -aggaaactcctg-------tga---------------------------
A0A3B5K6B9_BCL2L1-      -aggaaactcctg-------tga---------------------------
H3CH49_BCL2L1-01        -atgagg-------------------------------------------
C1BLI0_BCL2L1-01        -aagaaacatcat-------tga---------------------------
A0A3P8XFS0_BCL2L1-      -aaaatgcgcaatggacc--tga---------------------------
A0A3P8XFS0_BCL2L1-      -aagaaacgccag-------taa---------------------------
A0A286MU87_BCL2L1-      -aagaaacgccag-------tga---------------------------
C0HAD8_BCL2L1-01        -aagaaacgccag-------tga---------------------------
A0A345BSW9_BCL2L1-      -aagagcc-tttg-------taa---------------------------
Q90Z98_BCL2L1-01        -cagaaacgcctg-------tga---------------------------
Q90Z98_BCL2L1-02        -cagaaacgcctg-------tga---------------------------
A0A059PJI5_BCL2L1-      -cagaagcgcctg-------taa---------------------------
A0A3B3ZN55_BCL2L1-      -cagagacgcctg-------tga---------------------------
A0A3B3ZN55_BCL2L1-      -cagagacgcctg-------tga---------------------------
D2ITA2_BCL2L1-02        -aagaaacatgtc-------tag---------------------------
A0A3P8UWG7_BCL2L1-      -cagaaacgtctc-------tga---------------------------
A0A3B3QRZ2_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3B1JJ42_BCL2L1-      -cagaagcgtctg-------taa---------------------------
A0A3B4DTL9_BCL2L1-      -cagaagcgtctg-------taa---------------------------
A0A3P8XYL5_BCL2L1-      -cagaaacgcctg-------tga---------------------------
B5XAY3_BCL2L1-01        -cagaaacgcctg-------tga---------------------------
A0A3B3TFR4_BCL2L1-      -aagaaacgccag-------tga---------------------------
A0A3Q3DUT7_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3Q3DUT7_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3Q3DUT7_BCL2L1-      -cagaagcgcctg-------tga---------------------------
W5MG74_BCL2L1-01        -aagaaacgctta-------tag---------------------------
A0A3Q3WIW8_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A2U9BY16_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3B5PQJ0_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3P9N9Y4_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3B3WI27_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A087X9B7_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3B3TUS7_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3Q2FR43_BCL2L1-      -cacaaacgcctg-------tga---------------------------
A0A3Q2QPL9_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q3B3X5_BCL2L1-      -cagaagcgcctg-------tga---------------------------
A0A3Q0RTF8_BCL2L1-      -caaaaacgcctg-------tga---------------------------
I3IZK7_BCL2L1-01        -caaaaacgcctg-------tga---------------------------
A0A3Q4N4B5_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3Q2X557_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3P8P0F1_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3P9D632_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3P9D632_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3B4FNX1_BCL2L1-      -caaaaacgcctg-------tga---------------------------
G3NJY1_BCL2L1-01        -caga----catt-------tga---------------------------
A0A3B3IB64_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3P9JYH1_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3B3DHA1_BCL2L1-      -cagaaacgcctg-------tga---------------------------
C3VIT1_BCL2L1-01        -cagaaacgcctg-------tga---------------------------
A0A3B4Z3X2_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3B4Z3X2_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1GS47_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1GS47_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1DHJ3_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1DHJ3_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1DHJ3_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3P8TL99_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3P8TL99_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A219P0Y3_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q3G2E1_BCL2L1-      -cagaaacgcctg-------tag---------------------------
A0A3Q3G2E1_BCL2L1-      -cagaaacgcctg-------tag---------------------------
A0A3Q3G2E1_BCL2L1-      -cagaaacgcctg-------tag---------------------------
A0A3B4V3T1_BCL2L1-      -caaaagcgcctg-------tga---------------------------
A0A3B4XU17_BCL2L1-      -caaaagcgcctg-------tga---------------------------
A0A3Q3IVF5_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q3MX20_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1GZ93_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1GZ93_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A3Q1GZ93_BCL2L1-      -cagaaacgcctg-------tga---------------------------
A0A0D6DR75_BCL2L1-      -caaaaacgcctg-------tga---------------------------
A0A3B3E2W4_BCL2L1-      -aagaaacgg----------tga---------------------------
A0A3B3ICL7_BCL2L1-      -aagaaacgg----------tga---------------------------
A0A3B3ICL7_BCL2L1-      -aagaaacgg----------tga---------------------------
A0A3B4BFZ8_BCL2L1-      -aagaaatag----------------------------------------
A0A3P8VMA1_BCL2L1-      -aaaaagcat----------tga---------------------------
A0A0F7L1T6_BCL2L1-      -aagaaacat----------tga---------------------------
H2U5I3_BCL2L1-01        -aagaaacat----------tga---------------------------
H2U5I3_BCL2L1-02        -aagaaacat----------tga---------------------------
G3P7B4_BCL2L1-01        -aagaagcgg----------tga---------------------------
A0A3Q3FUB6_BCL2L1-      -aagaaacat----------taa---------------------------
A0A3Q3X5M5_BCL2L1-      -aagaaacag----------taa---------------------------
A0A2U9BIG9_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q1JZ46_BCL2L1-      -aagaaacgg----------tga---------------------------
A0A3Q1JZ46_BCL2L1-      -aagaaacgg----------tga---------------------------
A0A3Q3NFM4_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q3NFM4_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q3J5K3_BCL2L1-      -aagaaattg----------tga---------------------------
A0A3B4V9K8_BCL2L1-      -aagaaacat----------taa---------------------------
A0A3B4XS24_BCL2L1-      -aagaaacat----------taa---------------------------
A0A3B5B4X7_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q1EVP6_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q1BQA0_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3P8U812_BCL2L1-      -aagaaacag----------tga---------------------------
E6ZFR0_BCL2L1-01        -aagaaacat----------tga---------------------------
A0A0B4KJI5_BCL2L1-      -aagaaacag----------tga---------------------------
A0A3Q3BEB7_BCL2L1-      -aagaagcgt----------taa---------------------------
A0A3Q2C6K4_BCL2L1-      -aagaaacga----------tga---------------------------
A0A3Q2NRP4_BCL2L1-      -aagaaacga----------tga---------------------------
A0A3B5MGS2_BCL2L1-      -aagaaacga----------tga---------------------------
M4A558_BCL2L1-01        -aagaaacga----------tga---------------------------
A0A3P9QFB3_BCL2L1-      -aagaaacga----------tga---------------------------
A0A3B3XN57_BCL2L1-      -aagaaacga----------tga---------------------------
A0A087YBW4_BCL2L1-      -aagaaacga----------tga---------------------------
A0A3B3VWI7_BCL2L1-      -aagaaacga----------tga---------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        ttaaggaacctgtatttttcattctggctacccttgtggccccgcagttt
P53563_BCL2L1-02        ttaaggaacctgtatttttcattctggctacccttgtggccccgcagttt
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        gatggctgcgccttcacacatccaccacgcagctcccgagcaccatcacc
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A452FIG6_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-03        catagttttgttccaatttctcggcaaagaaaaacagcctgtgtgtttac
P53563_BCL2L1-02        catagttttgttccaatttctcggcaaagaaaaacagcctgtgtgtttac
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        atcacggggcgctcaccccgctccacggagcttccttcctcgcgccgcca
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
A0A3B3ZN55_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1GS47_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        ----------------
A0A346RRN1_BCL2L1-      ----------------
Q6GLI5_BCL2L1-01        ----------------
Q2TAP5_BCL2L1-01        ----------------
Q91828_BCL2L1-01        ----------------
H9GHK7_BCL2L1-01        ----------------
F6WA14_BCL2L1-01        ----------------
G3WKX6_BCL2L1-01        ----------------
A0A452FIG6_BCL2L1-      ----------------
A0A452FIG6_BCL2L1-      ----------------
A0A3Q1LRT3_BCL2L1-      ----------------
A0A452E1B1_BCL2L1-      ----------------
W5PSA5_BCL2L1-01        ----------------
G3SPN0_BCL2L1-01        -tggttcaccacccaa
H0X6V2_BCL2L1-01        ----------------
P53563_BCL2L1-03        ttggcttaaaacctag
P53563_BCL2L1-02        ttggcttaaaacctag
P53563_BCL2L1-04        ----------------
P53563_BCL2L1-01        ----------------
O35843_BCL2L1-01        ----------------
Q64373_BCL2L1-09        ----------------
Q64373_BCL2L1-01        ----------------
Q64373_BCL2L1-03        ----------------
Q64373_BCL2L1-04        ----------------
B2Z3Z4_BCL2L1-01        ----------------
Q9MYW4_BCL2L1-01        ----------------
O77737_BCL2L1-01        ----------------
A0A286Y5D6_BCL2L1-      ----------------
G1P9D2_BCL2L1-01        ----------------
Q05KJ0_BCL2L1-02        ----------------
Q05KJ0_BCL2L1-01        ----------------
A0A452FWV3_BCL2L1-      ----------------
Q9MZS7_BCL2L1-01        ----------------
F6WQI0_BCL2L1-02        ----------------
A0A2U3V0P1_BCL2L1-      ----------------
A0A1L5BWY3_BCL2L1-      ----------------
A0A287CZ07_BCL2L1-      ----------------
I3MUP5_BCL2L1-01        ----------------
I3MUP5_BCL2L1-02        ----------------
I3MUP5_BCL2L1-03        ----------------
F6WQI0_BCL2L1-01        ----------------
E2IV76_BCL2L1-01        ----------------
A0A2K6G3C5_BCL2L1-      ----------------
A0A2K6G3C5_BCL2L1-      ----------------
G1RER8_BCL2L1-01        ----------------
A0A2J8VIH3_BCL2L1-      ----------------
Q07817_BCL2L1-01        ----------------
Q07817_BCL2L1-03        ----------------
Q07817_BCL2L1-02        ----------------
G3RY91_BCL2L1-02        ----------------
G3RY91_BCL2L1-01        ----------------
A0A2K5H963_BCL2L1-      ----------------
A0A2K5H963_BCL2L1-      ----------------
Q2PFS6_BCL2L1-01        ----------------
A0A2K5M8B1_BCL2L1-      ----------------
A0A2K5M8B1_BCL2L1-      ----------------
A0A2K6LPM4_BCL2L1-      ----------------
A0A2K6QFA2_BCL2L1-      ----------------
A0A2K5VPG2_BCL2L1-      ----------------
F6UKR4_BCL2L1-02        ----------------
A0A2K5YR37_BCL2L1-      ----------------
A0A2K5YR37_BCL2L1-      ----------------
A0A2K5VPG2_BCL2L1-      ----------------
F6UKR4_BCL2L1-01        ----------------
A0A0D9RJZ8_BCL2L1-      ----------------
I7GKS6_BCL2L1-01        ----------------
A0A2K6LPM4_BCL2L1-      ----------------
A0A2K6QFA2_BCL2L1-      ----------------
A0A2K6QFA2_BCL2L1-      ----------------
A0A2K5YR37_BCL2L1-      ----------------
A0A2K6UWY8_BCL2L1-      ----------------
E2IV77_BCL2L1-01        ----------------
A0A2K6UWY8_BCL2L1-      ----------------
A0A2K5EBP4_BCL2L1-      ----------------
E2IV75_BCL2L1-01        ----------------
F7IT34_BCL2L1-02        ----------------
F7IT34_BCL2L1-01        ----------------
A0A2K5EBP4_BCL2L1-      ----------------
M3Z2H9_BCL2L1-01        ----------------
Q76LT7_BCL2L1-01        ----------------
Q8SQ42_BCL2L1-01        ----------------
M3XA94_BCL2L1-01        ----------------
A0A452SDS4_BCL2L1-      ----------------
A0A384D3U1_BCL2L1-      ----------------
A0A452ILL8_BCL2L1-      ----------------
A0A452ILL8_BCL2L1-      ----------------
K7F655_BCL2L1-01        ----------------
U3JSL7_BCL2L1-01        ----------------
Q4U2V6_BCL2L1-01        ----------------
H0Z8G3_BCL2L1-01        ----------------
Q07816_BCL2L1-04        gctccttttgtcgtag
Q07816_BCL2L1-03        ----------------
Q07816_BCL2L1-02        ----------------
Q07816_BCL2L1-01        ----------------
G1N5N5_BCL2L1-01        ----------------
H3ANS8_BCL2L1-01        ----------------
A0A3B5K6B9_BCL2L1-      ----------------
A0A3B5K6B9_BCL2L1-      ----------------
H3CH49_BCL2L1-01        ----------------
C1BLI0_BCL2L1-01        ----------------
A0A3P8XFS0_BCL2L1-      ----------------
A0A3P8XFS0_BCL2L1-      ----------------
A0A286MU87_BCL2L1-      ----------------
C0HAD8_BCL2L1-01        ----------------
A0A345BSW9_BCL2L1-      ----------------
Q90Z98_BCL2L1-01        ----------------
Q90Z98_BCL2L1-02        ----------------
A0A059PJI5_BCL2L1-      ----------------
A0A3B3ZN55_BCL2L1-      ----------------
A0A3B3ZN55_BCL2L1-      ----------------
D2ITA2_BCL2L1-02        ----------------
A0A3P8UWG7_BCL2L1-      ----------------
A0A3B3QRZ2_BCL2L1-      ----------------
A0A3B1JJ42_BCL2L1-      ----------------
A0A3B4DTL9_BCL2L1-      ----------------
A0A3P8XYL5_BCL2L1-      ----------------
B5XAY3_BCL2L1-01        ----------------
A0A3B3TFR4_BCL2L1-      ----------------
A0A3Q3DUT7_BCL2L1-      ----------------
A0A3Q3DUT7_BCL2L1-      ----------------
A0A3Q3DUT7_BCL2L1-      ----------------
W5MG74_BCL2L1-01        ----------------
A0A3Q3WIW8_BCL2L1-      ----------------
A0A2U9BY16_BCL2L1-      ----------------
A0A3B5PQJ0_BCL2L1-      ----------------
A0A3P9N9Y4_BCL2L1-      ----------------
A0A3B3WI27_BCL2L1-      ----------------
A0A087X9B7_BCL2L1-      ----------------
A0A3B3TUS7_BCL2L1-      ----------------
A0A3Q2FR43_BCL2L1-      ----------------
A0A3Q2QPL9_BCL2L1-      ----------------
A0A3Q3B3X5_BCL2L1-      ----------------
A0A3Q0RTF8_BCL2L1-      ----------------
I3IZK7_BCL2L1-01        ----------------
A0A3Q4N4B5_BCL2L1-      ----------------
A0A3Q2X557_BCL2L1-      ----------------
A0A3P8P0F1_BCL2L1-      ----------------
A0A3P9D632_BCL2L1-      ----------------
A0A3P9D632_BCL2L1-      ----------------
A0A3B4FNX1_BCL2L1-      ----------------
G3NJY1_BCL2L1-01        ----------------
A0A3B3IB64_BCL2L1-      ----------------
A0A3P9JYH1_BCL2L1-      ----------------
A0A3B3DHA1_BCL2L1-      ----------------
C3VIT1_BCL2L1-01        ----------------
A0A3B4Z3X2_BCL2L1-      ----------------
A0A3B4Z3X2_BCL2L1-      ----------------
A0A3Q1GS47_BCL2L1-      ----------------
A0A3Q1GS47_BCL2L1-      ----------------
A0A3Q1DHJ3_BCL2L1-      ----------------
A0A3Q1DHJ3_BCL2L1-      ----------------
A0A3Q1DHJ3_BCL2L1-      ----------------
A0A3P8TL99_BCL2L1-      ----------------
A0A3P8TL99_BCL2L1-      ----------------
A0A219P0Y3_BCL2L1-      ----------------
A0A3Q3G2E1_BCL2L1-      ----------------
A0A3Q3G2E1_BCL2L1-      ----------------
A0A3Q3G2E1_BCL2L1-      ----------------
A0A3B4V3T1_BCL2L1-      ----------------
A0A3B4XU17_BCL2L1-      ----------------
A0A3Q3IVF5_BCL2L1-      ----------------
A0A3Q3MX20_BCL2L1-      ----------------
A0A3Q1GZ93_BCL2L1-      ----------------
A0A3Q1GZ93_BCL2L1-      ----------------
A0A3Q1GZ93_BCL2L1-      ----------------
A0A0D6DR75_BCL2L1-      ----------------
A0A3B3E2W4_BCL2L1-      ----------------
A0A3B3ICL7_BCL2L1-      ----------------
A0A3B3ICL7_BCL2L1-      ----------------
A0A3B4BFZ8_BCL2L1-      ----------------
A0A3P8VMA1_BCL2L1-      ----------------
A0A0F7L1T6_BCL2L1-      ----------------
H2U5I3_BCL2L1-01        ----------------
H2U5I3_BCL2L1-02        ----------------
G3P7B4_BCL2L1-01        ----------------
A0A3Q3FUB6_BCL2L1-      ----------------
A0A3Q3X5M5_BCL2L1-      ----------------
A0A2U9BIG9_BCL2L1-      ----------------
A0A3Q1JZ46_BCL2L1-      ----------------
A0A3Q1JZ46_BCL2L1-      ----------------
A0A3Q3NFM4_BCL2L1-      ----------------
A0A3Q3NFM4_BCL2L1-      ----------------
A0A3Q3J5K3_BCL2L1-      ----------------
A0A3B4V9K8_BCL2L1-      ----------------
A0A3B4XS24_BCL2L1-      ----------------
A0A3B5B4X7_BCL2L1-      ----------------
A0A3Q1EVP6_BCL2L1-      ----------------
A0A3Q1BQA0_BCL2L1-      ----------------
A0A3P8U812_BCL2L1-      ----------------
E6ZFR0_BCL2L1-01        ----------------
A0A0B4KJI5_BCL2L1-      ----------------
A0A3Q3BEB7_BCL2L1-      ----------------
A0A3Q2C6K4_BCL2L1-      ----------------
A0A3Q2NRP4_BCL2L1-      ----------------
A0A3B5MGS2_BCL2L1-      ----------------
M4A558_BCL2L1-01        ----------------
A0A3P9QFB3_BCL2L1-      ----------------
A0A3B3XN57_BCL2L1-      ----------------
A0A087YBW4_BCL2L1-      ----------------
A0A3B3VWI7_BCL2L1-      ----------------
                                        

© 1998-2019