Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

114 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

R4JQR8_BCL2L1-01        ---------------------------------------------atgaa
Q6GLI5_BCL2L1-01        ---------------------------------------------atgga
Q2TAP5_BCL2L1-01        ---------------------------------------------atgga
Q91828_BCL2L1-01        ---------------------------------------------atgga
H3ANS8_BCL2L1-01        ------------------------------------------aaaatgtc
H9GHK7_BCL2L1-01        ---------------------------------------------atgtc
U3IS71_BCL2L1-01        ---------------------------------------------atgtc
K7F655_BCL2L1-01        ---------------------------------------------atgtc
G1N5N5_BCL2L1-01        ---------------------------------------------atgtc
Q07816_BCL2L1-03        ---------------------------------------------atgtc
Q07816_BCL2L1-01        ---------------------------------------------atgtc
Q07816_BCL2L1-02        ---------------------------------------------atgtc
U3JSL7_BCL2L1-01        ---------------------------------------------atgta
Q4U2V6_BCL2L1-01        ---------------------------------------------atgtc
H0Z8G3_BCL2L1-01        ---------------------------------------------atgta
F6WA14_BCL2L1-01        ---------------------------------------------atgtc
G3WKX6_BCL2L1-01        ---------------------------------------------atgtc
W5PSA5_BCL2L1-01        ---------------------------------------------atgtc
G3SPN0_BCL2L1-01        ---------------------------------------------atgtc
H0X6V2_BCL2L1-01        ---------------------------------------------atgtc
P53563_BCL2L1-04        ---------------------------------------------atgtc
P53563_BCL2L1-02        ---------------------------------------------atgtc
P53563_BCL2L1-03        ---------------------------------------------atgtc
P53563_BCL2L1-01        ---------------------------------------------atgtc
O35843_BCL2L1-01        ---------------------------------------------atgtc
Q64373_BCL2L1-09        ---------------------------------------------atgtc
Q64373_BCL2L1-01        ---------------------------------------------atgtc
Q64373_BCL2L1-03        ---------------------------------------------atgtc
Q64373_BCL2L1-04        ---------------------------------------------atgtc
B2Z3Z4_BCL2L1-01        ---------------------------------------------atgtc
A0A1U7QU73_BCL2L1-      ---------------------------------------------atgtc
Q9MYW4_BCL2L1-01        ---------------------------------------------atgtc
A0A1S3EPX7_BCL2L1-      ---------------------------------------------atgtc
O77737_BCL2L1-01        ---------------------------------------------atgtc
A0A286Y5D6_BCL2L1-      ---------------------------------------------atgtc
G1P9D2_BCL2L1-01        ---------------------------------------------atgtc
Q05KJ0_BCL2L1-01        ---------------------------------------------atgtc
Q9MZS7_BCL2L1-01        ---------------------------------------------atgtc
A0A1S2ZQT6_BCL2L1-      ---------------------------------------------atgtc
A0A1L5BWY3_BCL2L1-      ---------------------------------------------atgtc
A0A287CZ07_BCL2L1-      ---------------------------------------------atgtc
I3MUP5_BCL2L1-03        ---------------------------------------------atgtc
I3MUP5_BCL2L1-02        ---------------------------------------------atgtc
I3MUP5_BCL2L1-01        ---------------------------------------------atgtc
F6WQI0_BCL2L1-01        ---------------------------------------------atgtc
E2IV76_BCL2L1-01        ---------------------------------------------atgtc
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ---------------------------------------------atgtc
G1RER8_BCL2L1-01        ---------------------------------------------atgtc
A0A2J8VIH3_BCL2L1-      ---------------------------------------------atgtc
Q07817_BCL2L1-03        ---------------------------------------------atgtc
Q07817_BCL2L1-01        ---------------------------------------------atgtc
Q07817_BCL2L1-02        ---------------------------------------------atgtc
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ---------------------------------------------atgtc
A0A2K5H963_BCL2L1-      ---------------------------------------------atgtc
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ---------------------------------------------atgtc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ---------------------------------------------atgtc
A0A2K5VPG2_BCL2L1-      ---------------------------------------------atgtc
F6UKR4_BCL2L1-01        ---------------------------------------------atgtc
A0A0D9RJZ8_BCL2L1-      ---------------------------------------------atgtc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ---------------------------------------------atgtc
A0A2K6QFA2_BCL2L1-      ---------------------------------------------atgtc
A0A2K6QFA2_BCL2L1-      ---------------------------------------------atgtc
A0A2K5YR37_BCL2L1-      ---------------------------------------------atgtc
A0A2K6UWY8_BCL2L1-      ---------------------------------------------atgtc
E2IV77_BCL2L1-01        ---------------------------------------------atgtc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        ---------------------------------------------atgtc
F7IT34_BCL2L1-01        ---------------------------------------------atgtc
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ---------------------------------------------atgtc
E2IV75_BCL2L1-01        ---------------------------------------------atgtc
M3Z2H9_BCL2L1-01        ---------------------------------------------atgtc
M3XA94_BCL2L1-01        ---------------------------------------------atgtc
Q76LT7_BCL2L1-01        ---------------------------------------------atgtc
Q8SQ42_BCL2L1-01        ---------------------------------------------atgtc
A0A087YBW4_BCL2L1-      ---------------------------------------------atgtc
M4A558_BCL2L1-01        ---------------------------------------------atggc
A0A0F7L1T6_BCL2L1-      ---------------------------------------------atgtc
H2U5I3_BCL2L1-01        ---------------------------------------------atgtc
H2U5I3_BCL2L1-02        ---------------------------------------------atgtc
G3P7B4_BCL2L1-01        ---------------------------------------------atggc
E6ZFR0_BCL2L1-01        ---------------------------------------------atgtc
A0A0B4KJI5_BCL2L1-      ---------------------------------------------atgtc
D2ITA2_BCL2L1-02        ---------------------------atgagcattgacacaagcatgtc
C1BLI0_BCL2L1-01        ---------------------------------------------atgtc
A0A286MU87_BCL2L1-      ---------------------------------------------atgtc
C0HAD8_BCL2L1-01        ---------------------------------------------atgtc
Q90Z98_BCL2L1-01        ---------------------------------------------atgtc
Q90Z98_BCL2L1-02        ---------------------------------------------atgtc
H2SNZ8_BCL2L1-02        ---------------------------------------------atgtc
H2SNZ8_BCL2L1-01        ---------------------------------------------atgtc
H3CH49_BCL2L1-01        cgaagtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtc
A0A059PJI5_BCL2L1-      ---------------------------------------------atgtc
B5XAY3_BCL2L1-01        ------------------------------------------atgatgac
W5MG74_BCL2L1-01        ------------------------------------------aagatgtc
A0A087X9B7_BCL2L1-      ---------------------------------------------atgtc
A0A2U9BY16_BCL2L1-      ---------------------------------------------atgtc
A0A0D6DR75_BCL2L1-      ---------------------------------------------atgtc
I3IZK7_BCL2L1-01        ---------------------------------------tacaaaatgtc
A0A219P0Y3_BCL2L1-      ---------------------------------------------atgtg
G3NJY1_BCL2L1-01        ---------------------------------------------atgtc
C3VIT1_BCL2L1-01        ---------------------------------------------atgtc

R4JQR8_BCL2L1-01        ccagtttagttcaagatatttagtggcagactttattaatgaccgacttc
Q6GLI5_BCL2L1-01        gggcagcagt---agagatctggtggagaagtttgtttgcaagaaactgt
Q2TAP5_BCL2L1-01        gggcagcagt---agagatctggtggagaagtttgttagtaagaaacttt
Q91828_BCL2L1-01        gggcagcagt---agagatctggtggagaagtttgttagtaagaaacttt
H3ANS8_BCL2L1-01        ct---tcaac---aggttgctggtggtggaccatatatcccagaagctga
H9GHK7_BCL2L1-01        gagcagtaac---cgagcgctcgtggtggacttcctttcctacaagctgt
U3IS71_BCL2L1-01        cagcggcaac---cgggagctggtgatcgactttgtctcctacaagctgt
K7F655_BCL2L1-01        gaacactaac---agggaattagtgattgacttcctctcctacaagctat
G1N5N5_BCL2L1-01        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
Q07816_BCL2L1-03        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
Q07816_BCL2L1-01        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
Q07816_BCL2L1-02        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
U3JSL7_BCL2L1-01        cagcagtaat---cgggagttagtgattgactttgtttcttacaagctct
Q4U2V6_BCL2L1-01        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
H0Z8G3_BCL2L1-01        cagcagtaac---cgggagttagtgattgactttgtttcctacaagctct
F6WA14_BCL2L1-01        gcacagtaac---cgggagctggtgattgactttctttcttacaagctct
G3WKX6_BCL2L1-01        tcacagtaac---cgggagctggtggttgactttctttcttacaagcttt
W5PSA5_BCL2L1-01        tcagagcaac---cgggaactagtggttgactttctctcttacaagtttt
G3SPN0_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
H0X6V2_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttatctcctacaagcttt
P53563_BCL2L1-04        tcagagcaac---cgggagctggtggttgactttctctcctacaagctct
P53563_BCL2L1-02        tcagagcaac---cgggagctggtggttgactttctctcctacaagctct
P53563_BCL2L1-03        tcagagcaac---cgggagctggtggttgactttctctcctacaagctct
P53563_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagctct
O35843_BCL2L1-01        tcagagcaac---cgggagctggtggtcgactttctctcctacaagcttt
Q64373_BCL2L1-09        tcagagcaac---cgggagctggtggtcgactttctctcctacaagcttt
Q64373_BCL2L1-01        tcagagcaac---cgggagctggtggtcgactttctctcctacaagcttt
Q64373_BCL2L1-03        tcagagcaac---cgggagctggtggtcgactttctctcctacaagcttt
Q64373_BCL2L1-04        tcagagcaac---cgggagctggtggtcgactttctctcctacaagcttt
B2Z3Z4_BCL2L1-01        tcagagcaac---cgggagctagtggttgactttctctcctacaagttct
A0A1U7QU73_BCL2L1-      tcagagcaac---cgggagctagtggttgactttctctcctacaagctct
Q9MYW4_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A1S3EPX7_BCL2L1-      tcagagcaac---cgtgagctggtggttgactttctctcctacaagcttt
O77737_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A286Y5D6_BCL2L1-      tcaaagcaac---tgggagctggtggttgactttctctcctacaagcttt
G1P9D2_BCL2L1-01        tcagagcaac---cgggaactggtggttgactttctctcctacaagcttt
Q05KJ0_BCL2L1-01        tcagagtaac---cgggagctggtggttgactttctctcttacaagcttt
Q9MZS7_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcttacaagcttt
A0A1S2ZQT6_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A1L5BWY3_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A287CZ07_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
I3MUP5_BCL2L1-03        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
I3MUP5_BCL2L1-02        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
I3MUP5_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
F6WQI0_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
E2IV76_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
G1RER8_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2J8VIH3_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
Q07817_BCL2L1-03        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
Q07817_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
Q07817_BCL2L1-02        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctataagcttt
A0A2K5H963_BCL2L1-      tcagagcaac---cgggagctagtggttgactttctctcctacaagcttt
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K5VPG2_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
F6UKR4_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A0D9RJZ8_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K6QFA2_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K6QFA2_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K5YR37_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K6UWY8_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
E2IV77_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
F7IT34_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
E2IV75_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
M3Z2H9_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
M3XA94_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
Q76LT7_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
Q8SQ42_BCL2L1-01        tcagagcaac---cgggagctggtggttgactttctctcctacaagcttt
A0A087YBW4_BCL2L1-      ctacagcaac---agagaactggtggagttctacataagctacaaattgt
M4A558_BCL2L1-01        ctacagcaac---agagaactggtggagttctacataagctacaaattgt
A0A0F7L1T6_BCL2L1-      gtataacaac---agagagctggtggagcacttcttaagatacaagctgt
H2U5I3_BCL2L1-01        gtataacaac---agagagctggtggagcacttcttaagatacaagctgt
H2U5I3_BCL2L1-02        gtataacaac---agagagctggtggagcacttcttaagatacaagctgt
G3P7B4_BCL2L1-01        gaacattaac---agggagctggtggagttcttcctaagctacaagctgt
E6ZFR0_BCL2L1-01        gtacagtaac---agagagctggtggagttctttataagctataaactgt
A0A0B4KJI5_BCL2L1-      gtacagtaac---agagagctagtggagtcctttttaagctacaaactgt
D2ITA2_BCL2L1-02        gatcagtaac---agagaactggtgttcttcttcctaagccataaactgt
C1BLI0_BCL2L1-01        ttacagtaac---cgtgagctggtggtgttcttcataagctataaacttt
A0A286MU87_BCL2L1-      ttacagtaac---agggaactggtggtgttttttataagctatagactgt
C0HAD8_BCL2L1-01        ttacagtaac---agggaactggtggtgttttttataagctatagactgt
Q90Z98_BCL2L1-01        ttactataac---cgagaactggtggtattttttatcaaatataaactct
Q90Z98_BCL2L1-02        ttactataac---cgagaactggtggtattttttatcaaatataaactct
H2SNZ8_BCL2L1-02        tca---aaac---agagaactggtcattttctatattaagtacaaactct
H2SNZ8_BCL2L1-01        tca---aaac---agagaactggtcattttctatattaagtacaaactct
H3CH49_BCL2L1-01        tct---aaac---agagaactggtcattttctacattaaatacaaacttt
A0A059PJI5_BCL2L1-      ttactacaac---agagaacttgtcgtgtacttcatcaagtacaagctct
B5XAY3_BCL2L1-01        ttacaacaac---agagaactggtggtgtactatattacctataaactat
W5MG74_BCL2L1-01        atacagcaac---agagacctcgtcgtctactacatcaactataaactct
A0A087X9B7_BCL2L1-      acg---aaac---agagaactggtgcttttctacattaagtttaaactgt
A0A2U9BY16_BCL2L1-      tca---gaac---aaagaactggtggttttctacatacagtataaactct
A0A0D6DR75_BCL2L1-      tca---aaac---agagaactggtggtttactacataacatataaactgt
I3IZK7_BCL2L1-01        tca---aaac---agagaactggtgcttttctacataaggtataaactct
A0A219P0Y3_BCL2L1-      tca---aaac---agagaactggtggtttgctacataaaatataaactaa
G3NJY1_BCL2L1-01        tca---aaac---agagaactggtggttttctacataaactataaactct
C3VIT1_BCL2L1-01        tca---aaac---agagaactggtggttttctacataaagtataaactct

R4JQR8_BCL2L1-01        --------------------------------------------------
Q6GLI5_BCL2L1-01        cccagaaaggagcctgcggggagttctccagcaa----------------
Q2TAP5_BCL2L1-01        cccagaatgaagcctgcaggaagttctccaataa----------------
Q91828_BCL2L1-01        cccagaatgaagcctgcaggaagttctccaataa----------------
H3ANS8_BCL2L1-01        tgcagcggggataccagtggagggaggttggtgagcaggaccacggtgg-
H9GHK7_BCL2L1-01        cgcagcggggccacagctggcatgagattga-ga-------------tg-
U3IS71_BCL2L1-01        cgcagaaaggctacagctggagccagctggagga-------------ag-
K7F655_BCL2L1-01        cgcagaggggacacagctggagctggttcgaggg-------------gg-
G1N5N5_BCL2L1-01        cgcagaaggggcactgctggagcgagctggagga-------------ag-
Q07816_BCL2L1-03        cacagagggggcactgctggagcgagctggagga-------------ag-
Q07816_BCL2L1-01        cacagagggggcactgctggagcgagctggagga-------------ag-
Q07816_BCL2L1-02        cacagagggggcactgctggagcgagctggagga-------------ag-
U3JSL7_BCL2L1-01        cacagaaaggctacagctggagtcagctggagga-------------gg-
Q4U2V6_BCL2L1-01        cacagaaaggatacagctggagtcagctggaaga-------------gg-
H0Z8G3_BCL2L1-01        cacagaaaggatacagctggagtcagctggaaga-------------gg-
F6WA14_BCL2L1-01        cacagaaaggatacaattggagtcagtttgaaga-------------t--
G3WKX6_BCL2L1-01        cacagaagggatacaattggagtcagtttgaaga-------------t--
W5PSA5_BCL2L1-01        ttcagaaaggatacagctggagtcagtttagtga-------------ca-
G3SPN0_BCL2L1-01        cccagaaaggatacagttggagtcagtttagtga-------------tg-
H0X6V2_BCL2L1-01        cccagaaaggatacagctggagtcagtttagcga-------------tg-
P53563_BCL2L1-04        cccagaaaggatacagctggagtcagtttagcga-------------tg-
P53563_BCL2L1-02        cccagaaaggatacagctggagtcagtttagcga-------------tg-
P53563_BCL2L1-03        cccagaaaggatacagctggagtcagtttagcga-------------tg-
P53563_BCL2L1-01        cccagaaaggatacagctggagtcagtttagcga-------------tg-
O35843_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q64373_BCL2L1-09        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q64373_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q64373_BCL2L1-03        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q64373_BCL2L1-04        cccagaaaggatacagctggagtcagtttagtga-------------tg-
B2Z3Z4_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A1U7QU73_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q9MYW4_BCL2L1-01        cgcagaaaggatacagctggagtcagtttagtga-------------tg-
A0A1S3EPX7_BCL2L1-      cccagaaaggatacagctggagtcagtttagcga-------------tg-
O77737_BCL2L1-01        cccagaaaggatacagctggagtcagtttactga-------------tg-
A0A286Y5D6_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
G1P9D2_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q05KJ0_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q9MZS7_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A1S2ZQT6_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A1L5BWY3_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A287CZ07_BCL2L1-      cccagaaaggatacagctggagtcagtttagcga-------------tg-
I3MUP5_BCL2L1-03        cccagaaaggatacagctggagtcagtttagcga-------------tg-
I3MUP5_BCL2L1-02        cccagaaaggatacagctggagtcagtttagcga-------------tg-
I3MUP5_BCL2L1-01        cccagaaaggatacagctggagtcagtttagcga-------------tg-
F6WQI0_BCL2L1-01        cccagaaaggatacaactggagtcagtttagtga-------------cg-
E2IV76_BCL2L1-01        cccagaaaggatacagctggagtcagtttatcga-------------tg-
A0A2K6G3C5_BCL2L1-      ---------------------------------a-------------tg-
A0A2K6G3C5_BCL2L1-      cccagaaaggatacagctggagtcagtttatcga-------------tg-
G1RER8_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2J8VIH3_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q07817_BCL2L1-03        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q07817_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q07817_BCL2L1-02        cccagaaaggatacagctggagtcagtttagtga-------------tg-
G3RY91_BCL2L1-02        ---------------------------------a-------------tg-
G3RY91_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K5H963_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K5H963_BCL2L1-      ---------------------------------a-------------tg-
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      cccagaaaggatacagctggagtcaatttagtga-------------tg-
A0A2K5M8B1_BCL2L1-      ---------------------------------a-------------tg-
A0A2K6LPM4_BCL2L1-      ---------------------------------a-------------tg-
A0A2K6QFA2_BCL2L1-      ---------------------------------a-------------tg-
A0A2K5VPG2_BCL2L1-      ---------------------------------a-------------tg-
F6UKR4_BCL2L1-02        ---------------------------------a-------------tg-
A0A2K5YR37_BCL2L1-      ---------------------------------a-------------tg-
A0A2K5YR37_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K5VPG2_BCL2L1-      cccagaaaggatacagctggagtcaatttagtga-------------tg-
F6UKR4_BCL2L1-01        cccagaaaggatacagctggagtcaatttagtga-------------tg-
A0A0D9RJZ8_BCL2L1-      cccagaaaggatacagctggagtcaatttagtga-------------tg-
I7GKS6_BCL2L1-01        ---------------------------------a-------------tg-
A0A2K6LPM4_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K6QFA2_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K6QFA2_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K5YR37_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K6UWY8_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
E2IV77_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
A0A2K6UWY8_BCL2L1-      ---------------------------------a-------------tg-
F7IT34_BCL2L1-02        cccagaaaggatacagctggagtcagtttagtga-------------tg-
F7IT34_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
F7IT34_BCL2L1-03        ---------------------------------a-------------tg-
A0A2K5EBP4_BCL2L1-      ---------------------------------a-------------tg-
A0A2K5EBP4_BCL2L1-      cccagaaaggatacagctggagtcagtttagtga-------------tg-
E2IV75_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
M3Z2H9_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
M3XA94_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q76LT7_BCL2L1-01        cccagaaaggatacagctggagtcagtttagtga-------------tg-
Q8SQ42_BCL2L1-01        cccagaaaggatacagctggagtcggtttagtga-------------tg-
A0A087YBW4_BCL2L1-      ctcagagaaactattcaagctctctgctgaggtc-------------cg-
M4A558_BCL2L1-01        ctcagagaaactattcaagctctctgctgaggtc-------------cg-
A0A0F7L1T6_BCL2L1-      ctcagaggaactacccatcttctctgctgagacc-------------ag-
H2U5I3_BCL2L1-01        ctcagaggaactacccaacttctctgctgagacc-------------ag-
H2U5I3_BCL2L1-02        ctcagaggaactacccaacttctctgctgagacc-------------ag-
G3P7B4_BCL2L1-01        ctcagaagaaccacccaacctctctgttgaggcc-------------gg-
E6ZFR0_BCL2L1-01        ctcagaggaaccacccaacctctctactgaggcc-------------gg-
A0A0B4KJI5_BCL2L1-      ctcagaggaactatccaactgccctgctgaggcc-------------ag-
D2ITA2_BCL2L1-02        ctcagaggaattacaggcctattcccttccagcc-------------cg-
C1BLI0_BCL2L1-01        cacagaggaattatcctatttctcagttgggact-------------gg-
A0A286MU87_BCL2L1-      cccagaggaattattcatgttgtcaattggggct-------------gg-
C0HAD8_BCL2L1-01        cccagaggaattattcatgttgtcaattggggct-------------gg-
Q90Z98_BCL2L1-01        cgcagaggaactacccctgcaaccacattggact-------------ta-
Q90Z98_BCL2L1-02        cgcagaggaactacccctgcaaccacattggact-------------ta-
H2SNZ8_BCL2L1-02        cccaaagaaattaccctttcaatcacaatggact-------------cat
H2SNZ8_BCL2L1-01        cccaaagaaattaccctttcaatcacaatggact-------------cat
H3CH49_BCL2L1-01        cccaaagaaactaccctttgagtcacattg--------------------
A0A059PJI5_BCL2L1-      cccagaaaaactacccctgcgaccacatcggcct-------------ca-
B5XAY3_BCL2L1-01        cacagagggactaccccttcaaccacatggagct-------------ca-
W5MG74_BCL2L1-01        cgcagaagaactactcc----------tgggacc-------------ag-
A0A087X9B7_BCL2L1-      ctcagaggaactatccgatccaacacatattgcc-------------ca-
A0A2U9BY16_BCL2L1-      cccagaggaaatatcctctcaaccatatgggact-------------ta-
A0A0D6DR75_BCL2L1-      cggagaaaaactatcctctcaaccacttgggact-------------ca-
I3IZK7_BCL2L1-01        cccagagaaactatcctctcaaccacatagtact-------------ca-
A0A219P0Y3_BCL2L1-      cccagagaaactatcctctcaaccacatgggact-------------ca-
G3NJY1_BCL2L1-01        cccagaggaacttacccctcaaccacatagggct-------------gt-
C3VIT1_BCL2L1-01        cccagagaaactatcctctcaaccacatagtgct-------------ca-

R4JQR8_BCL2L1-01        -----------gaaaac---------atggaatg----------------
Q6GLI5_BCL2L1-01        ------------------------------------ctcccag-------
Q2TAP5_BCL2L1-01        ------------------------------------tccccaa-------
Q91828_BCL2L1-01        ------------------------------------t-cccaa-------
H3ANS8_BCL2L1-01        --tggag----gagaccgcgcgagggaagcacagactcccgaggaggggg
H9GHK7_BCL2L1-01        -----------gagagc----------ggg---gag------gaa-gcga
U3IS71_BCL2L1-01        --aggat----gagaac----------aggactgagttggcttcc-gagg
K7F655_BCL2L1-01        --aggat----gagatc----------aggactgaggctgcagaa-gagg
G1N5N5_BCL2L1-01        --aggat----gagaac----------aggactgacactgcagca-gagg
Q07816_BCL2L1-03        --aggat----gagaac----------aggactgacactgcagct-gagg
Q07816_BCL2L1-01        --aggat----gagaac----------aggactgacactgcagct-gagg
Q07816_BCL2L1-02        --aggat----gagaac----------aggactgacactgcagct-gagg
U3JSL7_BCL2L1-01        --aggat----gagaac----------aggactgactttgcaggg-gagg
Q4U2V6_BCL2L1-01        --aggat----gagaac----------aggactgactttgcaggg-gagg
H0Z8G3_BCL2L1-01        --aggat----gagaac----------aggactgactttgcaggg-gagg
F6WA14_BCL2L1-01        -----------gagaac----------aggactgaggttctagaa-gggg
G3WKX6_BCL2L1-01        -----------gagaac----------aggactgaggcctcagaa-ggga
W5PSA5_BCL2L1-01        --tggaa----gagaac----------agaactgagaccctagaa-ggga
G3SPN0_BCL2L1-01        --tggag----gagaat----------aggactggggcctcggaa-ggca
H0X6V2_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
P53563_BCL2L1-04        --tcgaa----gagaac----------aggactgaagccccagaa-gaaa
P53563_BCL2L1-02        --tcgaa----gagaac----------aggactgaagccccagaa-gaaa
P53563_BCL2L1-03        --tcgaa----gagaac----------aggactgaagccccagaa-gaaa
P53563_BCL2L1-01        --tcgaa----gagaac----------aggactgaagccccagaa-gaaa
O35843_BCL2L1-01        --ttgaa----gagaat----------aggactgaggccccagaa-gaaa
Q64373_BCL2L1-09        --tcgaa----gagaat----------aggactgaggccccagaa-gaaa
Q64373_BCL2L1-01        --tcgaa----gagaat----------aggactgaggccccagaa-gaaa
Q64373_BCL2L1-03        --tcgaa----gagaat----------aggactgaggccccagaa-gaaa
Q64373_BCL2L1-04        --tcgaa----gagaat----------aggactgaggccccagaa-gaaa
B2Z3Z4_BCL2L1-01        --tcgaa----gagaac----------aggactgaggccccagaa-ggaa
A0A1U7QU73_BCL2L1-      --tcgaa----gagaac----------aggactgaggccccagaa-ggag
Q9MYW4_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccggaa-ggga
A0A1S3EPX7_BCL2L1-      --tggaa----gagagc----------aggactgaggacccagaa-ggaa
O77737_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
A0A286Y5D6_BCL2L1-      --tggaa----gagaac----------aggactgaaggcccagaa-ggga
G1P9D2_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
Q05KJ0_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
Q9MZS7_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
A0A1S2ZQT6_BCL2L1-      --tggaa----gagaac----------agaactgaggcctcagaa-ggaa
A0A1L5BWY3_BCL2L1-      --tggaa----gagaat----------aggactgaggccccagaa-ggga
A0A287CZ07_BCL2L1-      --tggaa----gagaac----------aggactgaagccccagaa-ggga
I3MUP5_BCL2L1-03        --tggaa----gagaac----------aggactgaagccccagaa-ggga
I3MUP5_BCL2L1-02        --tggaa----gagaac----------aggactgaagccccagaa-ggga
I3MUP5_BCL2L1-01        --tggaa----gagaac----------aggactgaagccccagaa-ggga
F6WQI0_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
E2IV76_BCL2L1-01        --cagaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6G3C5_BCL2L1-      --cagaa----gagaac----------aggactgaggccccagaa-gcga
A0A2K6G3C5_BCL2L1-      --cagaa----gagaac----------aggactgaggccccagaa-gcga
G1RER8_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2J8VIH3_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
Q07817_BCL2L1-03        --tggaa----gagaac----------aggactgaggccccagaa-ggga
Q07817_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
Q07817_BCL2L1-02        --tggaa----gagaac----------aggactgaggccccagaa-ggga
G3RY91_BCL2L1-02        --tggaa----gagaac----------aggactgaggccccagaa-ggga
G3RY91_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5H963_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5H963_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5M8B1_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6LPM4_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6QFA2_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5VPG2_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
F6UKR4_BCL2L1-02        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5YR37_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5YR37_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5VPG2_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
F6UKR4_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A0D9RJZ8_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
I7GKS6_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6LPM4_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6QFA2_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6QFA2_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5YR37_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6UWY8_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
E2IV77_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K6UWY8_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
F7IT34_BCL2L1-02        --tggaa----gagaac----------aggactgaggccccagaa-ggga
F7IT34_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
F7IT34_BCL2L1-03        --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5EBP4_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
A0A2K5EBP4_BCL2L1-      --tggaa----gagaac----------aggactgaggccccagaa-ggga
E2IV75_BCL2L1-01        --tggaa----gagaac----------aggactgaggccccagaa-ggga
M3Z2H9_BCL2L1-01        --cagaa----gagaac----------agaactgaggccccagaa-ggga
M3XA94_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
Q76LT7_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
Q8SQ42_BCL2L1-01        --tggaa----gagaac----------agaactgaggccccagaa-ggga
A0A087YBW4_BCL2L1-      --aggccgac-ggggcc----------aggaccaatt-------------
M4A558_BCL2L1-01        --aggttgcc-gggggc----------aggaccaatt-------------
A0A0F7L1T6_BCL2L1-      --aggatact-gatgga----------aggacagagg-------------
H2U5I3_BCL2L1-01        --aggatact-gatgga----------aggacagagg-------------
H2U5I3_BCL2L1-02        --aggatact-gatgga----------aggacagagg-------------
G3P7B4_BCL2L1-01        --aggatgcc-ggcgga----------aggacggagg-------------
E6ZFR0_BCL2L1-01        --agaatgcc-ggtgaa----------aggactgagg-------------
A0A0B4KJI5_BCL2L1-      --atgatgct-ggtgga----------aggactgagg-------------
D2ITA2_BCL2L1-02        --agggggcaggtgagg-----------ggactgatgag-------gaca
C1BLI0_BCL2L1-01        --aagatgccagtgaac-----------ggactaatg-------------
A0A286MU87_BCL2L1-      --agggtgcaagtggac-----------ggactgacg-------------
C0HAD8_BCL2L1-01        --agggtgcaagtggac-----------ggactgagg-------------
Q90Z98_BCL2L1-01        --cagaagac-acaaat----------cggactgatg-------------
Q90Z98_BCL2L1-02        --cagaagac-acaaat----------cggactgatg-------------
H2SNZ8_BCL2L1-02        attagagcct-ccaagt----------aggactgatg-------------
H2SNZ8_BCL2L1-01        attagagcct-ccaagt----------aggactgatg-------------
H3CH49_BCL2L1-01        --tagagcct-tcaagt----------aggactgaag-------------
A0A059PJI5_BCL2L1-      --cggaagag-gtgaac-----------ggccaggtggc-------ggaa
B5XAY3_BCL2L1-01        --cggaagcc-cagaat----------cggactga---------------
W5MG74_BCL2L1-01        --ttcagcctggagggc----------aggaccggag-----------gc
A0A087X9B7_BCL2L1-      --atgagccc-ccggac----------agcaccgctgct-------gggg
A0A2U9BY16_BCL2L1-      --atgagcct-ccgaac----------aggactgatc-----------gg
A0A0D6DR75_BCL2L1-      --gtgagcct-ccaaac----------aggactgatg-----------ga
I3IZK7_BCL2L1-01        --acgagcct-ttgaac----------aggactgatg-----------gg
A0A219P0Y3_BCL2L1-      --tagagcct-ccaaac----------aggactgatg-----------gg
G3NJY1_BCL2L1-01        --ccgagcct-cccaac----------aggactggcg-g-------gggg
C3VIT1_BCL2L1-01        --atgagcct-ccgaac----------aggactggtgcc-------gggg

R4JQR8_BCL2L1-01        ----------------------------------cgatgggacaactgtc
Q6GLI5_BCL2L1-01        --------------------cccaagggcgtgtctaatggaa-------g
Q2TAP5_BCL2L1-01        --------------------cccaatgccatatctaatggaa-cttctac
Q91828_BCL2L1-01        --------------------cccaatgccatatctaatggaaccttctac
H3ANS8_BCL2L1-01        ccattccaggcatggacccacc------------caacggcag-ccaccc
H9GHK7_BCL2L1-01        tggagccagcaaacgagacggggaacaccct---caatgggagcccttct
U3IS71_BCL2L1-01        ccgc---------cgcggtg---------ct---caacgggagcccctcc
K7F655_BCL2L1-01        cg------------gagatggcaagcgtccc---taatgggagtccatcc
G1N5N5_BCL2L1-01        ca------------gagatggacagcgtcct---caatgggagcccatcc
Q07816_BCL2L1-03        ca------------gagatggacagcgtcct---caatgggagcccatcc
Q07816_BCL2L1-01        ca------------gagatggacagcgtcct---caatgggagcccatcc
Q07816_BCL2L1-02        ca------------gagatggacagcgtcct---caatgggagcccatcc
U3JSL7_BCL2L1-01        agga---------cgagatggacggcgtgct---caacggaagcccctcc
Q4U2V6_BCL2L1-01        agga---------cgagatggacggggtcct---caacgggagcccctcc
H0Z8G3_BCL2L1-01        agga---------cgagatggacggggtcct---caacgggagcccctcc
F6WA14_BCL2L1-01        c------------agagatacctagtactgt---gaatggcagtccctct
G3WKX6_BCL2L1-01        c------------agagatacctagtactgt---gaatggcagcccctct
W5PSA5_BCL2L1-01        cagaatcagatatggaaacccccagtgccat---cagtggcaacccatcc
G3SPN0_BCL2L1-01        ctgaatccgagatggagatccccagtgccat---caatggcaacccatcc
H0X6V2_BCL2L1-01        atgaatcagagctggagacccccagtgccat---taatggcaacccatcc
P53563_BCL2L1-04        ctgaaccagaaagggagacccccagtgccat---caatggcaacccatcc
P53563_BCL2L1-02        ctgaaccagaaagggagacccccagtgccat---caatggcaacccatcc
P53563_BCL2L1-03        ctgaaccagaaagggagacccccagtgccat---caatggcaacccatcc
P53563_BCL2L1-01        ctgaaccagaaagggagacccccagtgccat---caatggcaacccatcc
O35843_BCL2L1-01        ctgaagcagagagggagacccccagtgccat---caatggcaacccatcc
Q64373_BCL2L1-09        ctgaagcagagagggagacccccagtgccat---caatggcaacccatcc
Q64373_BCL2L1-01        ctgaagcagagagggagacccccagtgccat---caatggcaacccatcc
Q64373_BCL2L1-03        ctgaagcagagagggagacccccagtgccat---caatggcaacccatcc
Q64373_BCL2L1-04        ctgaagcagagagggagacccccagtgccat---caatggcaacccatcc
B2Z3Z4_BCL2L1-01        ctgaatcagagagggagacccccagtgccat---caatggcaacccatcc
A0A1U7QU73_BCL2L1-      ccgaatcagagagggagacccccagtgccat---caatggcaacccatcc
Q9MYW4_BCL2L1-01        ctggaccagagatggagacccccagtgccat---caatggcaacccagcc
A0A1S3EPX7_BCL2L1-      ctgaatcggagatggagacccccagtgctat---caatggcaacccatcc
O77737_BCL2L1-01        ctgaatcagaagcggaaacccctagtgccat---caatggcaacccatcc
A0A286Y5D6_BCL2L1-      ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
G1P9D2_BCL2L1-01        ctgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
Q05KJ0_BCL2L1-01        cagaatcagatatggaaacccccagtgccat---caatggcaacgcatcc
Q9MZS7_BCL2L1-01        cagaatcagatatggaaacccccagtgccat---caatggcaacccatct
A0A1S2ZQT6_BCL2L1-      ctgaatcagagatggaaacacccagtgccat---caatggcaacccatcc
A0A1L5BWY3_BCL2L1-      ttgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
A0A287CZ07_BCL2L1-      ctgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
I3MUP5_BCL2L1-03        ctgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
I3MUP5_BCL2L1-02        ctgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
I3MUP5_BCL2L1-01        ctgaatcagaggtggagacccccagtgccat---caatggcaacccatcc
F6WQI0_BCL2L1-01        ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
E2IV76_BCL2L1-01        ctgaatcggagatggaaacccccagtgccat---taatggcaacccatcc
A0A2K6G3C5_BCL2L1-      ctgaatcggagatggagacccccagtgccat---taatggcaacccatcc
A0A2K6G3C5_BCL2L1-      ctgaatcggagatggagacccccagtgccat---taatggcaacccatcc
G1RER8_BCL2L1-01        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2J8VIH3_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
Q07817_BCL2L1-03        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
Q07817_BCL2L1-01        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
Q07817_BCL2L1-02        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
G3RY91_BCL2L1-02        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
G3RY91_BCL2L1-01        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5H963_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5H963_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
Q2PFS6_BCL2L1-01        -----------atggagacccccagtgccat---caatggcaacccatcc
A0A2K5M8B1_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5M8B1_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6LPM4_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6QFA2_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5VPG2_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
F6UKR4_BCL2L1-02        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5YR37_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5YR37_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5VPG2_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
F6UKR4_BCL2L1-01        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A0D9RJZ8_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
I7GKS6_BCL2L1-01        ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6LPM4_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6QFA2_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6QFA2_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5YR37_BCL2L1-      ctgaatcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K6UWY8_BCL2L1-      ctgattcggagatggagacccccagtgccat---caatggcaacccagcc
E2IV77_BCL2L1-01        ctgattcggagatggagacccccagtgccat---caatggcaacccagcc
A0A2K6UWY8_BCL2L1-      ctgattcggagatggagacccccagtgccat---caat------------
F7IT34_BCL2L1-02        ctgattcggagatggagacccccagtgccat---caatggcaacccatcc
F7IT34_BCL2L1-01        ctgattcggagatggagacccccagtgccat---caatggcaacccatcc
F7IT34_BCL2L1-03        ctgattcggagatggagacccccagtgccat---caatggcaacccatcc
A0A2K5EBP4_BCL2L1-      ctgattcggagatggagacccccagtgccat---caat------------
A0A2K5EBP4_BCL2L1-      ctgattcggagatggagacccccagtgccat---caatggcaacccatcc
E2IV75_BCL2L1-01        ctgattcggagatggagacccccagtgccat---caatggcaacccatcc
M3Z2H9_BCL2L1-01        ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
M3XA94_BCL2L1-01        ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
Q76LT7_BCL2L1-01        ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
Q8SQ42_BCL2L1-01        ctgaatcagagatggagacccccagtgccat---caatggcaacccatcc
A0A087YBW4_BCL2L1-      --------gggatgggga----------------cagccgg---------
M4A558_BCL2L1-01        --------gggaagggga----------------cagccgg---------
A0A0F7L1T6_BCL2L1-      --------gagaaaagag----------------gagcccc---------
H2U5I3_BCL2L1-01        --------gagaaaagag----------------gagcccc---------
H2U5I3_BCL2L1-02        --------gagaaaagag----------------gagcccc---------
G3P7B4_BCL2L1-01        --------gagacaaggc----------------caactcg---------
E6ZFR0_BCL2L1-01        --------gagacaaggc----------------caactca---------
A0A0B4KJI5_BCL2L1-      --------cagacaaagc----------------caactca---------
D2ITA2_BCL2L1-02        --------agtccaacag----------------gattggt---------
C1BLI0_BCL2L1-01        --------ttgacaagac----------------caatgtctccccagtt
A0A286MU87_BCL2L1-      --------gagatgaggc----------------cattgca---------
C0HAD8_BCL2L1-01        --------gagatgacgc----------------cattgca---------
Q90Z98_BCL2L1-01        --------gggctgaaga----------------gaatggc---------
Q90Z98_BCL2L1-02        --------gggctgaaga----------------gaatggc---------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------gagaacgcgg----------------tgggagc---------
B5XAY3_BCL2L1-01        --------ggtgggacag----------------g--tgga---------
W5MG74_BCL2L1-01        --------gctgaggcgg----------------tgggttc---------
A0A087X9B7_BCL2L1-      acgcggccggggacgcgg----------------ggatgga---------
A0A2U9BY16_BCL2L1-      --------ggggaggcag----------------gtttggg---------
A0A0D6DR75_BCL2L1-      --------ggggaggttg----------------agtccgc---------
I3IZK7_BCL2L1-01        --------ggggcggcgg----------------ggttgga---------
A0A219P0Y3_BCL2L1-      --------ggggaggcag----------------ggttagg---------
G3NJY1_BCL2L1-01        --------gtagaggcag----------------gggcggc---------
C3VIT1_BCL2L1-01        --------acgggggtct----------------gggc------------

R4JQR8_BCL2L1-01        ctacgttagacttgccaccat----------------------------c
Q6GLI5_BCL2L1-01        t--------tcggagggcccc-------------ggg--gcc------ac
Q2TAP5_BCL2L1-01        t--------tcagagcgcccc-gg------ggaaggg--gcc------ac
Q91828_BCL2L1-01        t--------tcagagcgcccc-gg------ggaaggg--gcc------ac
H3ANS8_BCL2L1-01        t--catgcaggactcaatggt-gc---ggttaacgggttgccggctggca
H9GHK7_BCL2L1-01        tggcatcccagccccagccat-gt---catcaatggg--gcc-tcagaac
U3IS71_BCL2L1-01        tggcaccccccagctggccag-gt---agtgaacggc--gcc-gccgtgc
K7F655_BCL2L1-01        tggcatccaggtgccagccac-gt---agtgaacggg--gct-gccgggc
G1N5N5_BCL2L1-01        tggcacccgcctgccggccac-gt---agtgaatgga--gcc-gccgtgc
Q07816_BCL2L1-03        tggcacccccctgccggccac-gt---agtgaacgga--gcc-accgtgc
Q07816_BCL2L1-01        tggcacccccctgccggccac-gt---agtgaacgga--gcc-accgtgc
Q07816_BCL2L1-02        tggcacccccctgccggccac-gt---agtgaacgga--gcc-accgtgc
U3JSL7_BCL2L1-01        tggcacgcacccaccagccac-at---agtgaacgga--gcc-tccgtgc
Q4U2V6_BCL2L1-01        tggcacgcggccaccagccac-at---agtgaatgga--gcc-accgtgc
H0Z8G3_BCL2L1-01        tggcacgcggccaccagccac-at---agtgaatgga--gcc-accgtgc
F6WA14_BCL2L1-01        tggcaccctgctgacagccgt-gc---tgtgagtggg--gcc-acagggc
G3WKX6_BCL2L1-01        tggcaccctgctgacagccgt-gc---agtgagtggg--gcc-acaggac
W5PSA5_BCL2L1-01        tggcacctggcagatagccct-gt---ggtgaatgga--gcc-actggtc
G3SPN0_BCL2L1-01        cggcacctggcagacagccct-gc---ggtgaatgga--gct-actggcc
H0X6V2_BCL2L1-01        tggcacctggctgacagcccc-ac---ggtgaatgga--gcc-actggcc
P53563_BCL2L1-04        tggcacctggcggatagcccc-gc---ggtgaatgga--gcc-actggcc
P53563_BCL2L1-02        tggcacctggcggatagcccc-gc---ggtgaatgga--gcc-actggcc
P53563_BCL2L1-03        tggcacctggcggatagcccc-gc---ggtgaatgga--gcc-actggcc
P53563_BCL2L1-01        tggcacctggcggatagcccc-gc---ggtgaatgga--gcc-actggcc
O35843_BCL2L1-01        tggcacctggcggatagcccg-gc---cgtgaatgga--gcc-actggcc
Q64373_BCL2L1-09        tggcacctggcggatagcccg-gc---cgtgaatgga--gcc-actggcc
Q64373_BCL2L1-01        tggcacctggcggatagcccg-gc---cgtgaatgga--gcc-actggcc
Q64373_BCL2L1-03        tggcacctggcggatagcccg-gc---cgtgaatgga--gcc-actggcc
Q64373_BCL2L1-04        tggcacctggcggatagcccg-gc---cgtgaatgga--gcc-actggcc
B2Z3Z4_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtaaatgga--gcc-actggcc
A0A1U7QU73_BCL2L1-      tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-actggcc
Q9MYW4_BCL2L1-01        tggcacccggcggacagcccc-gc---ggtgaacgga--gcc-actggcc
A0A1S3EPX7_BCL2L1-      tggcacctggcggacagcccc-gcggtggtgaatgga--gcc-acgggtc
O77737_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A286Y5D6_BCL2L1-      tggcacctaactgatagtccc-ac---ggtgaatggg--gcc-actggcc
G1P9D2_BCL2L1-01        tggcacctggtggacagccct-gc---ggtgaatgga--gcc-actggcc
Q05KJ0_BCL2L1-01        tggcacctggcggatagccct-gc---tgtgaatgga--gcc-actggcc
Q9MZS7_BCL2L1-01        tggcacctggcggatagccct-gc---ggtgaatgga--gcc-accggcc
A0A1S2ZQT6_BCL2L1-      tggcacctggcggacagccct-gc---attgaatgga--gct-actggcc
A0A1L5BWY3_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A287CZ07_BCL2L1-      tggcatctggccgacagcccc-gc---gataaatgga--gcc-actggtc
I3MUP5_BCL2L1-03        tggcatctggccgacagcccc-gc---ggtaaatgga--gcc-actggtc
I3MUP5_BCL2L1-02        tggcatctggccgacagcccc-gc---ggtaaatgga--gcc-actggtc
I3MUP5_BCL2L1-01        tggcatctggccgacagcccc-gc---ggtaaatgga--gcc-actggtc
F6WQI0_BCL2L1-01        tggcacctggcggacagcccc-ac---ggggaatgga--gcc-actggcc
E2IV76_BCL2L1-01        tggcacctggcagacagccct-cc---agcgaatgga--gcc-actggcc
A0A2K6G3C5_BCL2L1-      t-------------------------------------------------
A0A2K6G3C5_BCL2L1-      tggcacctggcggacagcccc-cc---agcgaatgga--gcc-actggcc
G1RER8_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2J8VIH3_BCL2L1-      tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-actggcc
Q07817_BCL2L1-03        tggcacctggcagacagcccc-gc---ggtgaatgga--gcc-actggcc
Q07817_BCL2L1-01        tggcacctggcagacagcccc-gc---ggtgaatgga--gcc-actggcc
Q07817_BCL2L1-02        tggcacctggcagacagcccc-gc---ggtgaatgga--gcc-actggcc
G3RY91_BCL2L1-02        t-------------------------------------------------
G3RY91_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5H963_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5H963_BCL2L1-      t-------------------------------------------------
Q2PFS6_BCL2L1-01        tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5M8B1_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5M8B1_BCL2L1-      t-------------------------------------------------
A0A2K6LPM4_BCL2L1-      tgg-----------------------------------------------
A0A2K6QFA2_BCL2L1-      tgg-----------------------------------------------
A0A2K5VPG2_BCL2L1-      tgg-----------------------------------------------
F6UKR4_BCL2L1-02        tgg-----------------------------------------------
A0A2K5YR37_BCL2L1-      tgg-----------------------------------------------
A0A2K5YR37_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5VPG2_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
F6UKR4_BCL2L1-01        tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A0D9RJZ8_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
I7GKS6_BCL2L1-01        tgg-----------------------------------------------
A0A2K6LPM4_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K6QFA2_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K6QFA2_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K5YR37_BCL2L1-      tggcacctggtggacagcccc-gc---ggtgaatgga--gcc-actggcc
A0A2K6UWY8_BCL2L1-      tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-acgggcc
E2IV77_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-acgggcc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        tggcacctggcggacagccca-gt---ggtgaatgga--gcc-acgggcc
F7IT34_BCL2L1-01        tggcacctggcggacagccca-gt---ggtgaatgga--gcc-acgggcc
F7IT34_BCL2L1-03        tggcacctggcggacagccca-gt--------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-acgggcc
E2IV75_BCL2L1-01        tggcacctggcggacagcccc-gc---ggtgaatgga--gcc-acgggcc
M3Z2H9_BCL2L1-01        tggcacctggcggacagccct-gc---ggtgaatgga--gcc-actggcc
M3XA94_BCL2L1-01        tggcacttggcggacagccct-gc---ggtgaatgga--gcc-actggcc
Q76LT7_BCL2L1-01        tggcacttggcagacagccct-gc---ggtgaatgga--gcc-actggcc
Q8SQ42_BCL2L1-01        tggcacttggcagacagccct-gc---ggtgaatgga--gcc-actggcc
A0A087YBW4_BCL2L1-      ------ggccctagcaatggt-ccgctggtcaacagc------tg---gg
M4A558_BCL2L1-01        ------gtccctagcaatggc-cggctggtcaacagc------cg---gg
A0A0F7L1T6_BCL2L1-      ------gctgcttccaatggc-ctgctggtccgcagc------ag---ga
H2U5I3_BCL2L1-01        ------ggtgcttccaatggc-ctgctggtccgcagc------ag---ga
H2U5I3_BCL2L1-02        ------ggtgcttccaatggc-ctgctggtccgcagc------ag---ga
G3P7B4_BCL2L1-01        ------gcgtccg---------ttcctggac-gcggg------ag---ca
E6ZFR0_BCL2L1-01        ------gctgccagaaacggc-ttgctggccagcaag------aa---ca
A0A0B4KJI5_BCL2L1-      ------gctgccacaaatggc-ctgctggccaacagc------ag---ca
D2ITA2_BCL2L1-02        -----aataatgggttacggttgaa-----cgacgg------------ta
C1BLI0_BCL2L1-01        aatggatctgttgaaaatgac------------cgaa------at----t
A0A286MU87_BCL2L1-      aatgggtctgtggggaactac------------cgga------ac----a
C0HAD8_BCL2L1-01        aatgggtctgtgg---------------------gga------ac----a
Q90Z98_BCL2L1-01        gagggggcagcagg-agcgacaactcttgttaatggc------accatga
Q90Z98_BCL2L1-02        gagggggcagcagg-agcgacaactcttgttaatggc------accatga
H2SNZ8_BCL2L1-02        -----ggcagtttgtaactac-tca--gttcaatgga------actttta
H2SNZ8_BCL2L1-01        -----ggcagtttgtaactac-tca--gttcaatgga------actttta
H3CH49_BCL2L1-01        -----ggcagtttggaaccac-cca--gtccaatgga------actttta
A0A059PJI5_BCL2L1-      gggagagtcggagacgccgacagcagtcgttaatggc------accctaa
B5XAY3_BCL2L1-01        agggggtgcggcagtcctaac-ata--cgtcaacggg------ac-----
W5MG74_BCL2L1-01        ggggagcccgaacgcagagga-gcg--tacgaacggc------gcggcca
A0A087X9B7_BCL2L1-      cgacgagcagacgttggagac-gca--cgctaatggg------actttta
A0A2U9BY16_BCL2L1-      ggaggaacagcagacagcgcc-gca--tgccaacgga------actctaa
A0A0D6DR75_BCL2L1-      tgaggaacagcggatagcgac-gca--cgccaacggt------actttta
I3IZK7_BCL2L1-01        tgaggaacagcgaatagacac-aca--cgccaatggg------actttta
A0A219P0Y3_BCL2L1-      tgaggagcagcgggtagcgac-aca--cgccaacggg------actttta
G3NJY1_BCL2L1-01        tggtgggcagcggggagcgac-gca--ctccaacggg------actttca
C3VIT1_BCL2L1-01        -gaggagcagagcacagagac-gca--cgccaacggg------actttta

R4JQR8_BCL2L1-01        acaaattcagct--------------------------------------
Q6GLI5_BCL2L1-01        acag-ggcattgtggg------ggag------------------------
Q2TAP5_BCL2L1-01        gcag-ggcattgtgga------ggag------------------------
Q91828_BCL2L1-01        gcag-ggcattgtgga------ggag------------------------
H3ANS8_BCL2L1-01        gcagcagccgcctggaagcccaggcg---gtgtcgg--------------
H9GHK7_BCL2L1-01        accccgaactccttgaagaggaggaggaagaaaacc--------------
U3IS71_BCL2L1-01        accggagcagcctggaggtccacgag---cttgttc--------------
K7F655_BCL2L1-01        acagtaacagccttgaagcccatgaa---agggttc--------------
G1N5N5_BCL2L1-01        acaggagcagcctggaagttcatgaa---attgttc--------------
Q07816_BCL2L1-03        accggagcagcctggaagttcatgaa---attgttc--------------
Q07816_BCL2L1-01        accggagcagcctggaagttcatgaa---attgttc--------------
Q07816_BCL2L1-02        accggagcagcctggaagttcatgaa---attgttc--------------
U3JSL7_BCL2L1-01        accagagcagcctcgaagtccatgag---atccgtc--------------
Q4U2V6_BCL2L1-01        accagagcagcctcgaagtccatgag---atccgtc--------------
H0Z8G3_BCL2L1-01        accagaacagcctcgaagtccatgag---atccgtc--------------
F6WA14_BCL2L1-01        acagcagcagcctggatgcccatgag---acaatac--------------
G3WKX6_BCL2L1-01        acagcagcagcctggatgcccatgag---acaattc--------------
W5PSA5_BCL2L1-01        acagcagaagcttggacaccgggaaa---atgatcc--------------
G3SPN0_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
H0X6V2_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
P53563_BCL2L1-04        acagcagcagtttggatgcgcgggag---gtaatcc--------------
P53563_BCL2L1-02        acagcagcagtttggatgcgcgggag---gtaatcc--------------
P53563_BCL2L1-03        acagcagcagtttggatgcgcgggag---gtaatcc--------------
P53563_BCL2L1-01        acagcagcagtttggatgcgcgggag---gtaatcc--------------
O35843_BCL2L1-01        acagcagcagtttggatgcgcgggag---gtgattc--------------
Q64373_BCL2L1-09        acagcagcagtttggatgcgcgggag---gtgattc--------------
Q64373_BCL2L1-01        acagcagcagtttggatgcgcgggag---gtgattc--------------
Q64373_BCL2L1-03        acagcagcagtttggatgcgcgggag---gtgattc--------------
Q64373_BCL2L1-04        acagcagcagtttggatgcgcgggag---gtgattc--------------
B2Z3Z4_BCL2L1-01        acagcagcagtttggatgcacgggag---gtgatcc--------------
A0A1U7QU73_BCL2L1-      acagcagcagtttggatgcacgggag---gtgatcc--------------
Q9MYW4_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A1S3EPX7_BCL2L1-      acagcagcagttcggaagcccgggaa---gtgattc--------------
O77737_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
A0A286Y5D6_BCL2L1-      acagcagtagtttggatgcccgggag---gtgatcc--------------
G1P9D2_BCL2L1-01        acagcagtagcttggatgcccgggag---gtgattc--------------
Q05KJ0_BCL2L1-01        acagcagaagctcggatgcccgggaa---gtgatcc--------------
Q9MZS7_BCL2L1-01        acagcagaagcttggatgcccgggaa---gtgatcc--------------
A0A1S2ZQT6_BCL2L1-      acagcagcagcctggatgcccgggag---gtgatcc--------------
A0A1L5BWY3_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A287CZ07_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
I3MUP5_BCL2L1-03        acagcagcagtttggatgcccgggag---gtgatcc--------------
I3MUP5_BCL2L1-02        acagcagcagtttggatgcccgggag---gtgatcc--------------
I3MUP5_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
F6WQI0_BCL2L1-01        acagcagcagcttggatgcccgggaa---gtgatcc--------------
E2IV76_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
G1RER8_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2J8VIH3_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
Q07817_BCL2L1-03        acagcagcagtttggatgcccgggag---gtgatcc--------------
Q07817_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
Q07817_BCL2L1-02        acagcagcagtttggatgcccgggag---gtgatcc--------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5H963_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5M8B1_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5VPG2_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
F6UKR4_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A0D9RJZ8_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K6QFA2_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K6QFA2_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K5YR37_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K6UWY8_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
E2IV77_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        acagcagcagtttggatgcccgggag---gtgatcc--------------
F7IT34_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      acagcagcagtttggatgcccgggag---gtgatcc--------------
E2IV75_BCL2L1-01        acagcagcagtttggatgcccgggag---gtgatcc--------------
M3Z2H9_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
M3XA94_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
Q76LT7_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
Q8SQ42_BCL2L1-01        acagcagcagcttggatgcccgggag---gtgatcc--------------
A0A087YBW4_BCL2L1-      cc---ggctccccagggaagtcccgggaccctcccac----------cg-
M4A558_BCL2L1-01        cc---gggcccccggggaagcccaggggcccaatggc----------cg-
A0A0F7L1T6_BCL2L1-      acaggggt------ggagcgtctccatccgcaggtgc----------tg-
H2U5I3_BCL2L1-01        acaggggt------ggagcgtctccatccgcaggtgc----------tg-
H2U5I3_BCL2L1-02        acaggggt------ggagcgtctccatccgcaggtgc----------tg-
G3P7B4_BCL2L1-01        gcgccggccagccggggatgtcgtcgcca-ccgccgccaccgtccggtg-
E6ZFR0_BCL2L1-01        caagtggccagccggggacgtcttcgtcctcaggcgc----------tg-
A0A0B4KJI5_BCL2L1-      acgggggc-------ggacagc--------caggtgc----------tg-
D2ITA2_BCL2L1-02        acggcaatggccagttggcgc------catcacctactccacaag-----
C1BLI0_BCL2L1-01        gcataggcagtctggggatat---------cttcatctccacaggggg--
A0A286MU87_BCL2L1-      gcagaagcaatttggcgaagc---------cctcatctccacaggggg--
C0HAD8_BCL2L1-01        gcagaagcaatttggcgaagc---------cctcatctccacaggggg--
Q90Z98_BCL2L1-01        atagaacgaacgctagttcca---------ctgggaccccaccacaatcc
Q90Z98_BCL2L1-02        atagaacgaacgctagttcca---------ctgggaccccaccacaatcc
H2SNZ8_BCL2L1-02        atggtgcaagccctggaacac------ccccagca-----acaagtctgg
H2SNZ8_BCL2L1-01        atggtgcaagccctggaacac------ccccagca-----acaagtctgg
H3CH49_BCL2L1-01        atggggcaagtcctggaaccc------ccccagcaccctcccagcaccag
A0A059PJI5_BCL2L1-      acgggaccggatcggcaggca---------------ctccaccgcgatcg
B5XAY3_BCL2L1-01        -------gagtcccgggactc---------------caccaccacggcag
W5MG74_BCL2L1-01        atggcggggg----ggggcccgtgtcgcgccagccccccca---------
A0A087X9B7_BCL2L1-      acgggacaagtccaggatccc------c---------------gaggcgg
A0A2U9BY16_BCL2L1-      acggcgtgaatcccgggaccc------ccccagagtccccactgcggctg
A0A0D6DR75_BCL2L1-      acggaagaagtcctggaaccc------ccccagcatccccgctcaggcaa
I3IZK7_BCL2L1-01        atggcacgagtcccgggaccc------ctccggcatccccgcagcggcag
A0A219P0Y3_BCL2L1-      atggcatgagtcccgggaccc------cgccagcatccccgctgcggcag
G3NJY1_BCL2L1-01        acggcacgagtcccgggaccc------cgccggcgtccccgctgctccag
C3VIT1_BCL2L1-01        ccgggaccagtcccgggaccc------cgccggtgtcccctctgaggcag

R4JQR8_BCL2L1-01        --------------------------------------------------
Q6GLI5_BCL2L1-01        ------------------------------------------------ga
Q2TAP5_BCL2L1-01        ------------------------------------------------ga
Q91828_BCL2L1-01        ------------------------------------------------ga
H3ANS8_BCL2L1-01        ----------------------------------------ggcccgaagc
H9GHK7_BCL2L1-01        ----------------------------------------cgagggtgga
U3IS71_BCL2L1-01        ----------------------------------------aatcggccgc
K7F655_BCL2L1-01        ----------------------------------------cggcagccga
G1N5N5_BCL2L1-01        ----------------------------------------gagcatctga
Q07816_BCL2L1-03        ----------------------------------------gagcatccga
Q07816_BCL2L1-01        ----------------------------------------gagcatccga
Q07816_BCL2L1-02        ----------------------------------------gagcatccga
U3JSL7_BCL2L1-01        ----------------------------------------gagcagccga
Q4U2V6_BCL2L1-01        ----------------------------------------gagcagccga
H0Z8G3_BCL2L1-01        ----------------------------------------gagcagctga
F6WA14_BCL2L1-01        ----------------------------------------cagtggctgc
G3WKX6_BCL2L1-01        ----------------------------------------ctgtagctgc
W5PSA5_BCL2L1-01        ----------------------------------------ccatggcagt
G3SPN0_BCL2L1-01        ----------------------------------------ccatggcagc
H0X6V2_BCL2L1-01        ----------------------------------------ccatggcagc
P53563_BCL2L1-04        ----------------------------------------ccatggcagc
P53563_BCL2L1-02        ----------------------------------------ccatggcagc
P53563_BCL2L1-03        ----------------------------------------ccatggcagc
P53563_BCL2L1-01        ----------------------------------------ccatggcagc
O35843_BCL2L1-01        ----------------------------------------ccatggcagc
Q64373_BCL2L1-09        ----------------------------------------ccatggcagc
Q64373_BCL2L1-01        ----------------------------------------ccatggcagc
Q64373_BCL2L1-03        ----------------------------------------ccatggcagc
Q64373_BCL2L1-04        ----------------------------------------ccatggcagc
B2Z3Z4_BCL2L1-01        ----------------------------------------ccatggcagc
A0A1U7QU73_BCL2L1-      ----------------------------------------ccatggcagc
Q9MYW4_BCL2L1-01        ----------------------------------------ccatgacagc
A0A1S3EPX7_BCL2L1-      ----------------------------------------ccatggcagc
O77737_BCL2L1-01        ----------------------------------------ccatggctgc
A0A286Y5D6_BCL2L1-      ----------------------------------------ccatggcagc
G1P9D2_BCL2L1-01        ----------------------------------------ccatggcagc
Q05KJ0_BCL2L1-01        ----------------------------------------ccatggcagc
Q9MZS7_BCL2L1-01        ----------------------------------------ccatggcagc
A0A1S2ZQT6_BCL2L1-      ----------------------------------------ccatggcagc
A0A1L5BWY3_BCL2L1-      ----------------------------------------ccatgacagc
A0A287CZ07_BCL2L1-      ----------------------------------------ccatggcagc
I3MUP5_BCL2L1-03        ----------------------------------------ccatggcagc
I3MUP5_BCL2L1-02        ----------------------------------------ccatggcagc
I3MUP5_BCL2L1-01        ----------------------------------------ccatggcagc
F6WQI0_BCL2L1-01        ----------------------------------------ccatggcagc
E2IV76_BCL2L1-01        ----------------------------------------ctatggcagc
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ----------------------------------------ccatggcagc
G1RER8_BCL2L1-01        ----------------------------------------ccatggcagc
A0A2J8VIH3_BCL2L1-      ----------------------------------------ccatggcagc
Q07817_BCL2L1-03        ----------------------------------------ccatggcagc
Q07817_BCL2L1-01        ----------------------------------------ccatggcagc
Q07817_BCL2L1-02        ----------------------------------------ccatggcagc
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ----------------------------------------ccatggcagc
A0A2K5H963_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        ----------------------------------------ccatggcagc
A0A2K5M8B1_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K5VPG2_BCL2L1-      ----------------------------------------ccatggcagc
F6UKR4_BCL2L1-01        ----------------------------------------ccatggcagc
A0A0D9RJZ8_BCL2L1-      ----------------------------------------ccatggcagc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K6QFA2_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K6QFA2_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K5YR37_BCL2L1-      ----------------------------------------ccatggcagc
A0A2K6UWY8_BCL2L1-      ----------------------------------------ccatggcagc
E2IV77_BCL2L1-01        ----------------------------------------ccatggcagc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        ----------------------------------------ccatggcagc
F7IT34_BCL2L1-01        ----------------------------------------ccatggcagc
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ----------------------------------------ccatggcagc
E2IV75_BCL2L1-01        ----------------------------------------ccatggcagc
M3Z2H9_BCL2L1-01        ----------------------------------------ccatggcagc
M3XA94_BCL2L1-01        ----------------------------------------ccatggcagc
Q76LT7_BCL2L1-01        ----------------------------------------ccatggcagc
Q8SQ42_BCL2L1-01        ----------------------------------------ccatggcagc
A0A087YBW4_BCL2L1-      ----------------------------------------gcgtcaaggt
M4A558_BCL2L1-01        ----------------------------------------gtgttgaggt
A0A0F7L1T6_BCL2L1-      ----------------------------------------gcattgaggc
H2U5I3_BCL2L1-01        ----------------------------------------gcatagaggc
H2U5I3_BCL2L1-02        ----------------------------------------gcatagaggc
G3P7B4_BCL2L1-01        ----------------------------------------acaccgaggc
E6ZFR0_BCL2L1-01        ----------------------------------------acatagaggc
A0A0B4KJI5_BCL2L1-      ----------------------------------------acatagaggc
D2ITA2_BCL2L1-02        ----------------------------------------gcacggaggc
C1BLI0_BCL2L1-01        ----------------------------------------gtatagaggc
A0A286MU87_BCL2L1-      ----------------------------------------gcatggagcc
C0HAD8_BCL2L1-01        ----------------------------------------gcatggagcc
Q90Z98_BCL2L1-01        cctgcttcatccccccagcgtcaaacaaatgggtctgggggtctagacgc
Q90Z98_BCL2L1-02        cctgcttcatccccccagcgtcaaacaaatgggtctgggggtctagacgc
H2SNZ8_BCL2L1-02        ca-------------------------acaa---------gtctggatac
H2SNZ8_BCL2L1-01        ca-------------------------acaa---------gtctggatac
H3CH49_BCL2L1-01        cagtc------------------attgacaa---------gtctggacgc
A0A059PJI5_BCL2L1-      ccgactttgtcccctcagaggcaggtgaatggcagcgcaagcctggaggc
B5XAY3_BCL2L1-01        tcgcccccctcctcccctcggcggacagcgg---------gcctggacgc
W5MG74_BCL2L1-01        -----------------------------gg---------ggatcgaggc
A0A087X9B7_BCL2L1-      caacaggcggcgtc---------ggcggcaa---------cgatggacgc
A0A2U9BY16_BCL2L1-      caacggttgccttc---------atcgccga---------gcctggatgc
A0A0D6DR75_BCL2L1-      caacggttgccatc---------accgacga---------gcctggatgc
I3IZK7_BCL2L1-01        cagcagccgccatc---------aacgacgg---------acctcgacgc
A0A219P0Y3_BCL2L1-      caacagttgccatc---------aacaacga---------gcctggacgc
G3NJY1_BCL2L1-01        caacggtcgccgtc---------gacggcga---------gcctggatgc
C3VIT1_BCL2L1-01        caaccgttgccgtc---------gacgacgacgacgacgcgcctggacgc

R4JQR8_BCL2L1-01        --taaattacgttcacttgga-------gatgaattccaagaaagatttc
Q6GLI5_BCL2L1-01        agtccttcaggcgctgctggacgcgtcggaggagtttgagttgagatacc
Q2TAP5_BCL2L1-01        agtccttcaagcccttttggaagcaacggaggagtttgagttgagatatc
Q91828_BCL2L1-01        agtccttcaagcccttttggaagcaacggaggagtttgagttgagatatc
H3ANS8_BCL2L1-01        cgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtata
H9GHK7_BCL2L1-01        tgtcagccagacacttagggaggctggcgatgagtttgaactaaggtacc
U3IS71_BCL2L1-01        cgtccggcaggctctgcgcgaagccggggatgaattcgagctgaggtacc
K7F655_BCL2L1-01        agtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatc
G1N5N5_BCL2L1-01        cgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtacc
Q07816_BCL2L1-03        cgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtacc
Q07816_BCL2L1-01        cgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtacc
Q07816_BCL2L1-02        cgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtacc
U3JSL7_BCL2L1-01        cgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtacc
Q4U2V6_BCL2L1-01        tgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtacc
H0Z8G3_BCL2L1-01        tgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtacc
F6WA14_BCL2L1-01        tgtgaagcaagctttgagggaggcaggagatgaatttgaacttcggtaca
G3WKX6_BCL2L1-01        tgtgaagcaagctttgagggaggcaggagatgaatttgaactccggtacc
W5PSA5_BCL2L1-01        ggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtacc
G3SPN0_BCL2L1-01        agtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtacc
H0X6V2_BCL2L1-01        agtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtacc
P53563_BCL2L1-04        agtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtacc
P53563_BCL2L1-02        agtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtacc
P53563_BCL2L1-03        agtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtacc
P53563_BCL2L1-01        agtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtacc
O35843_BCL2L1-01        agtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtacc
Q64373_BCL2L1-09        agtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtacc
Q64373_BCL2L1-01        agtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtacc
Q64373_BCL2L1-03        agtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtacc
Q64373_BCL2L1-04        agtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtacc
B2Z3Z4_BCL2L1-01        cgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtacc
A0A1U7QU73_BCL2L1-      cgtgaagcaagcgctgagagaggccggcgatgagtttgaactgcggtacc
Q9MYW4_BCL2L1-01        agtgaagcaggctctgagggaggcaggcgacgagtttgaactgcggtacc
A0A1S3EPX7_BCL2L1-      tgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtatc
O77737_BCL2L1-01        agtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtacc
A0A286Y5D6_BCL2L1-      agtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtacc
G1P9D2_BCL2L1-01        ggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtacc
Q05KJ0_BCL2L1-01        ggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtacc
Q9MZS7_BCL2L1-01        ggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtacc
A0A1S2ZQT6_BCL2L1-      cgtgaagcaagcgctgagggaggcgggtgatgagtttgaactaaggtatc
A0A1L5BWY3_BCL2L1-      agtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtacc
A0A287CZ07_BCL2L1-      agtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtact
I3MUP5_BCL2L1-03        agtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtacc
I3MUP5_BCL2L1-02        agtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtacc
I3MUP5_BCL2L1-01        agtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtacc
F6WQI0_BCL2L1-01        agtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtacc
E2IV76_BCL2L1-01        agtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtacc
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      agtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggtacc
G1RER8_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2J8VIH3_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
Q07817_BCL2L1-03        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
Q07817_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
Q07817_BCL2L1-02        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5H963_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5M8B1_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5VPG2_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
F6UKR4_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A0D9RJZ8_BCL2L1-      agtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtacc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K6QFA2_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K6QFA2_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K5YR37_BCL2L1-      agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K6UWY8_BCL2L1-      aataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtacc
E2IV77_BCL2L1-01        aataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtacc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        agtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtacc
F7IT34_BCL2L1-01        agtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtacc
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      agtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtacc
E2IV75_BCL2L1-01        agtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtacc
M3Z2H9_BCL2L1-01        ggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtacc
M3XA94_BCL2L1-01        ggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtacc
Q76LT7_BCL2L1-01        ggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtacc
Q8SQ42_BCL2L1-01        ggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtacc
A0A087YBW4_BCL2L1-      tgtcaaattggttctgaaggacgcggcagaggagtttgaacgcctctaca
M4A558_BCL2L1-01        cgtcaaatcagttctgaaggacgcggcggaggagtttgagcgcctctaca
A0A0F7L1T6_BCL2L1-      tgtgaacgcagctcttcgggactcggcagaagagtttgagaagctctttg
H2U5I3_BCL2L1-01        tgtgaacgcagctcttcgggactcggcagaagagtttgagaagctctttg
H2U5I3_BCL2L1-02        tgtgaacgcagctcttcgggactcggcagaagagtttgagaagctctttg
G3P7B4_BCL2L1-01        cgtaaaggcagctcttcaggactctgcgaatgagtttgagctgctcttca
E6ZFR0_BCL2L1-01        tgtaaaggcagctcttcgggactcggcagatgagtttgaactgctcttca
A0A0B4KJI5_BCL2L1-      tgttaaagcagctcttcgggactcatctgaagagtttgaactgctcttca
D2ITA2_BCL2L1-02        tgtgagggcagcgcttctagaatcggtggaagagtttgagttgcgctaca
C1BLI0_BCL2L1-01        ggttaaagcagctcttagagactctgcagatgagtttgaattgcgttaca
A0A286MU87_BCL2L1-      agtgaaagcagcactacgggactcagtggatgagtttgagctacgctaca
C0HAD8_BCL2L1-01        agtgaaagcagcactacgggactcagtggatgagtttgagctgcgctaca
Q90Z98_BCL2L1-01        agtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctatt
Q90Z98_BCL2L1-02        agtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctatt
H2SNZ8_BCL2L1-02        agtaaaggaagccctccgggacacaggcaatgaatttgagctgcgataca
H2SNZ8_BCL2L1-01        agtaaaggaagccctccgggacacaggcaatgaatttgagctgcgataca
H3CH49_BCL2L1-01        agtcaaggaagccctccgggacaccggcaatgaatttgagctgcggtaca
A0A059PJI5_BCL2L1-      agtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctatt
B5XAY3_BCL2L1-01        agtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatg
W5MG74_BCL2L1-01        ggtgcagggggcgctgcgcgactccgccaacgagtttgagctccgctacg
A0A087X9B7_BCL2L1-      ggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctact
A0A2U9BY16_BCL2L1-      agtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacg
A0A0D6DR75_BCL2L1-      ggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatg
I3IZK7_BCL2L1-01        agtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacg
A0A219P0Y3_BCL2L1-      ggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacg
G3NJY1_BCL2L1-01        ggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacg
C3VIT1_BCL2L1-01        ggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacg

R4JQR8_BCL2L1-01        agactcagtttgacgatatggtcaatcagttacacataactgaggctact
Q6GLI5_BCL2L1-01        agcgtgccttcagcgacctgaccgcccagctgcacctcacccaggacact
Q2TAP5_BCL2L1-01        agcgtgccttcagtgacctgacctcacagctgcacatcacccaggacacg
Q91828_BCL2L1-01        agcgtgccttcagtgacctgacctcacagctgcacatcacccaggacacg
H3ANS8_BCL2L1-01        gccgagcattcagtgacctctcttcccagctccacatcacccccggcaca
H9GHK7_BCL2L1-01        ggcgggcttttagtgacctgacctcccagctccacatcaccttgggcacg
U3IS71_BCL2L1-01        gccgggctttcagcgacctcacctcccagctccacatcacccccggcacg
K7F655_BCL2L1-01        ggagggctttcagtgacctcacttcccagctccacatcaccctgggcacg
G1N5N5_BCL2L1-01        ggagggctttcagcgatctcacctcccagctccacatcacccctggcacg
Q07816_BCL2L1-03        ggagggctttcagcgacctcacctcccagctccacatcacccctggcacg
Q07816_BCL2L1-01        ggagggctttcagcgacctcacctcccagctccacatcacccctggcacg
Q07816_BCL2L1-02        ggagggctttcagcgacctcacctcccagctccacatcacccctggcacg
U3JSL7_BCL2L1-01        ggcgggcgttcagcgacctcacttcccagctccacatcactcccagcaca
Q4U2V6_BCL2L1-01        ggcgggcgttcagcgacctcacttcccagctccacatcactcccagcaca
H0Z8G3_BCL2L1-01        ggcgggcgttcagcgacctcacttcccagctccacatcactcccagcaca
F6WA14_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcacgccaggaaca
G3WKX6_BCL2L1-01        ggcgggcattcagtgatctgacatcccagctccacatcactccagggacg
W5PSA5_BCL2L1-01        aacagacattcagcgacctgacgtcccagctccacatcaccccagggaaa
G3SPN0_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
H0X6V2_BCL2L1-01        ggcgggcattcagtgacctgacatctcagctgcacatcaccccagggaca
P53563_BCL2L1-04        ggagagcattcagtgatctaacatcccagcttcatataaccccagggaca
P53563_BCL2L1-02        ggagagcattcagtgatctaacatcccagcttcatataaccccagggaca
P53563_BCL2L1-03        ggagagcattcagtgatctaacatcccagcttcatataaccccagggaca
P53563_BCL2L1-01        ggagagcattcagtgatctaacatcccagcttcatataaccccagggaca
O35843_BCL2L1-01        ggagagcgttcagtgatctaacatcccagcttcacataaccccagggacc
Q64373_BCL2L1-09        ggagagcgttcagtgatctaacatcccagcttcacataaccccagggacc
Q64373_BCL2L1-01        ggagagcgttcagtgatctaacatcccagcttcacataaccccagggacc
Q64373_BCL2L1-03        ggagagcgttcagtgatctaacatcccagcttcacataaccccagggacc
Q64373_BCL2L1-04        ggagagcgttcagtgatctaacatcccagcttcacataaccccagggacc
B2Z3Z4_BCL2L1-01        ggcgggcgttcagtgatctaacatcccagcttcatataaccccagggact
A0A1U7QU73_BCL2L1-      ggcgggcattcagtgatctgacatcccagcttcatataaccccgggaact
Q9MYW4_BCL2L1-01        ggcgggcattcagcgacctgacatcccagctccacatcaccccagggaca
A0A1S3EPX7_BCL2L1-      gacgggcattcagtgacctgacatcccagctccatattaccccggggaca
O77737_BCL2L1-01        ggagggcattcagtgacctgacgtcccagctccacatcaccccagggaca
A0A286Y5D6_BCL2L1-      ggcgagcattcagcgacttaacatctcagctccacatcaccccggggaca
G1P9D2_BCL2L1-01        ggcgggcgttcagcgacctgacatcccagctccacatcaccccagggaca
Q05KJ0_BCL2L1-01        gacgggcattcagcgacctgacgtcccagctccacatcaccccagggaca
Q9MZS7_BCL2L1-01        gacgggcattcagcgacctgacgtcccagctccacatcaccccagggaca
A0A1S2ZQT6_BCL2L1-      ggcgggcattcagtgacctgacttcccagctccacatcaccccagcaaca
A0A1L5BWY3_BCL2L1-      ggcgggcattcagtgacctgacatcccagctccacataaccccggggaca
A0A287CZ07_BCL2L1-      ggcgggcattcagtgacctgacgtcccagctccacatcaccctggggaca
I3MUP5_BCL2L1-03        ggcgggcattcagtgacctgacgtcccagctccacatcaccccggggaca
I3MUP5_BCL2L1-02        ggcgggcattcagtgacctgacgtcccagctccacatcaccccggggaca
I3MUP5_BCL2L1-01        ggcgggcattcagtgacctgacgtcccagctccacatcaccccggggaca
F6WQI0_BCL2L1-01        ggcgggcattcagcgacctgacatcccagctccacatcaccccagggaca
E2IV76_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcaccctagggaca
A0A2K6G3C5_BCL2L1-      --------------------------------------------gggaca
A0A2K6G3C5_BCL2L1-      ggcgggcattcagtgacctgacatcccagctccacatcaccctagggaca
G1RER8_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
A0A2J8VIH3_BCL2L1-      ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
Q07817_BCL2L1-03        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
Q07817_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
Q07817_BCL2L1-02        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
G3RY91_BCL2L1-02        --------------------------------------------gggaca
G3RY91_BCL2L1-01        ggcgggcattcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5H963_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5H963_BCL2L1-      --------------------------------------------gggaca
Q2PFS6_BCL2L1-01        ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5M8B1_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5M8B1_BCL2L1-      --------------------------------------------gggaca
A0A2K6LPM4_BCL2L1-      ----------------------------------------------gaca
A0A2K6QFA2_BCL2L1-      ----------------------------------------------gaca
A0A2K5VPG2_BCL2L1-      ----------------------------------------------gaca
F6UKR4_BCL2L1-02        ----------------------------------------------gaca
A0A2K5YR37_BCL2L1-      ----------------------------------------------gaca
A0A2K5YR37_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5VPG2_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
F6UKR4_BCL2L1-01        ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A0D9RJZ8_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
I7GKS6_BCL2L1-01        -------------------------------------caccccagggaca
A0A2K6LPM4_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K6QFA2_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K6QFA2_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K5YR37_BCL2L1-      ggcgggcgttcagtgacctgacatcccagctccacatcaccccagggaca
A0A2K6UWY8_BCL2L1-      ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
E2IV77_BCL2L1-01        ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
A0A2K6UWY8_BCL2L1-      ----------------------------gctccacatcacccccgggaca
F7IT34_BCL2L1-02        ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
F7IT34_BCL2L1-01        ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ----------------------------gctccacatcacccccgggaca
A0A2K5EBP4_BCL2L1-      ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
E2IV75_BCL2L1-01        ggcgggcatttagtgacctgacatcccagctccacatcacccccgggaca
M3Z2H9_BCL2L1-01        ggcgggcattcagcgacctgacatctcagcttcacatcaccccagggaca
M3XA94_BCL2L1-01        ggcgggcattcagcgacctgacatcccagcttcacatcaccccagggaca
Q76LT7_BCL2L1-01        ggcgggcattcagtgacctgacatcccagcttcacatcaccccagggaca
Q8SQ42_BCL2L1-01        ggcgggcattcagtgacctgacatcccagcttcacatcaccccagggaca
A0A087YBW4_BCL2L1-      cccaaagctttaaacacctttccttgcagctggacatcacccccgacacg
M4A558_BCL2L1-01        cccaaagctttaaacacctctccttgcagctggacatcacccccgacacg
A0A0F7L1T6_BCL2L1-      ctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacg
H2U5I3_BCL2L1-01        ctcaagcattcagcgacctctcctcacagctcgacatcactcctgacaca
H2U5I3_BCL2L1-02        ctcaagcattcagcgacctctcctcacagctcgacatcactcctgacaca
G3P7B4_BCL2L1-01        cgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacg
E6ZFR0_BCL2L1-01        cgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacg
A0A0B4KJI5_BCL2L1-      cacaagcgtttagtgacctctccacgcagctcgacatcactcctgacaca
D2ITA2_BCL2L1-02        cgctggccttcagcgacctgtcgtcccagctgcccatcacccccgccacg
C1BLI0_BCL2L1-01        ccagagccttcaatgatccctcttctcaactgcatatcacccctgctaca
A0A286MU87_BCL2L1-      cccgtgccttcagtgacctctcctcccagctccacatcacccctgccaca
C0HAD8_BCL2L1-01        cccgcgccttcagtgacctctcctcccagctccacatcacccctgccaca
Q90Z98_BCL2L1-01        ccagagcattcaacgatctttcctcacagctccacatcacacccgccaca
Q90Z98_BCL2L1-02        ccagagcattcaacgatctttcctcacagctccacatcacacccgccaca
H2SNZ8_BCL2L1-02        cttgtgctttcagtgacctgcacaaccagctacacatcaccccagctact
H2SNZ8_BCL2L1-01        cttgtgctttcagtgacctgcacaaccagctacacatcaccccagctact
H3CH49_BCL2L1-01        cctgcgcgttcagtgacctgcacaaccagctccacatcacgccagccacg
A0A059PJI5_BCL2L1-      cacgcgcctttagcgacctgtcatcacagttgcatataactccagtcacg
B5XAY3_BCL2L1-01        ccagagcgttcagtgacctgtcctcccagctacacatcacgccgtccaca
W5MG74_BCL2L1-01        gccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccacc
A0A087X9B7_BCL2L1-      cccgcgccttcaacgaccttcacagcacgctgcacatcacaccggccacc
A0A2U9BY16_BCL2L1-      cgcgcgccttcagcgatctgcacaaccagctgcacatcacgccggccacg
A0A0D6DR75_BCL2L1-      cccgcgccttcagcgatctgcacaaccagctgcatatcacgcccgccacg
I3IZK7_BCL2L1-01        ctcgtgccttcagcgaccttcacagccagctgcacatcacgccggccacg
A0A219P0Y3_BCL2L1-      ctcgcgccttcagcgatctgcaccaccagctgcacatcacgccggccaca
G3NJY1_BCL2L1-01        ctcgggccttcagcgatctgcacaaccagctgcacatcacgccggccacg
C3VIT1_BCL2L1-01        cccgcgccttcagcgacctccacagccagctgcacatcacgccggccacg

R4JQR8_BCL2L1-01        gcatatccaacgtttcaaagagttgttcaggaattatttattgatggaaa
Q6GLI5_BCL2L1-01        gcccagcaaagcttccagcaggtggtgggggagttgttcagggacggc--
Q2TAP5_BCL2L1-01        gcccagcagagcttccagcaagttatgggagagttgttcagggatggg--
Q91828_BCL2L1-01        gcccagcagagcttccagcaagttatgggagagttgttcagggatggg--
H3ANS8_BCL2L1-01        gcctaccagagctttgaacaggtggtgaacgaactcttccgggacgga--
H9GHK7_BCL2L1-01        gcataccagagcttcgagcaggtggtgaatgaactcttccacgatggg--
U3IS71_BCL2L1-01        gcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggg--
K7F655_BCL2L1-01        gcttaccagagcttcgagcaggtggtgaatgaactcttccgggacgga--
G1N5N5_BCL2L1-01        gcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggt--
Q07816_BCL2L1-03        gcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggt--
Q07816_BCL2L1-01        gcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggt--
Q07816_BCL2L1-02        gcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggt--
U3JSL7_BCL2L1-01        gcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgga--
Q4U2V6_BCL2L1-01        gcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgga--
H0Z8G3_BCL2L1-01        gcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatgga--
F6WA14_BCL2L1-01        gcttatcagagctttgagcaggtagtgaatgaactcttccgggatggg--
G3WKX6_BCL2L1-01        gcttatcagagttttgagcaggtagtgaatgaactcttccgggatggg--
W5PSA5_BCL2L1-01        gcatatcagagctttgaacaggtaataaatgaactcttccaggatggg--
G3SPN0_BCL2L1-01        gcatatcagagctttgagcaggtagtgaacgaactcttccgggatggg--
H0X6V2_BCL2L1-01        gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
P53563_BCL2L1-04        gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggg--
P53563_BCL2L1-02        gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggg--
P53563_BCL2L1-03        gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggg--
P53563_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggg--
O35843_BCL2L1-01        gcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgga--
Q64373_BCL2L1-09        gcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgga--
Q64373_BCL2L1-01        gcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgga--
Q64373_BCL2L1-03        gcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgga--
Q64373_BCL2L1-04        gcgtatcagagctttgagcaggtagtgaatgaactctttcgggatgga--
B2Z3Z4_BCL2L1-01        gcatatcaaagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A1U7QU73_BCL2L1-      gcatatcaaagctttgagcaggtagtgaatgaactcttccgggatggg--
Q9MYW4_BCL2L1-01        gcatatcagagctttgaacaagtagtgaacgaactcttccgggatggg--
A0A1S3EPX7_BCL2L1-      gcatatcagagctttgagcaggtagtgaacgaactcttccgggatggg--
O77737_BCL2L1-01        gcgtatcagagctttgagcaggtattgaacgaactcttccgggatggg--
A0A286Y5D6_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
G1P9D2_BCL2L1-01        gcatatcagagctttgagcaagtagtgaatgaactcttccgggatggg--
Q05KJ0_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggacggg--
Q9MZS7_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggacggg--
A0A1S2ZQT6_BCL2L1-      gcatatcagagctttgagcaggtagtgaacgaactcttccgggatggg--
A0A1L5BWY3_BCL2L1-      gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
A0A287CZ07_BCL2L1-      gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
I3MUP5_BCL2L1-03        gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
I3MUP5_BCL2L1-02        gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
I3MUP5_BCL2L1-01        gcatatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
F6WQI0_BCL2L1-01        gcatatcagagctttgagcaggtagtgaatgaactcttccgggatggg--
E2IV76_BCL2L1-01        gcatatcaaagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6G3C5_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgagatggg--
A0A2K6G3C5_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgagatggg--
G1RER8_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2J8VIH3_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
Q07817_BCL2L1-03        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
Q07817_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
Q07817_BCL2L1-02        gcatatcagagctttgaaca------------------------------
G3RY91_BCL2L1-02        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
G3RY91_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5H963_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5H963_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
Q2PFS6_BCL2L1-01        gcatatcagagctttgaacaagtagtgaatgaactcttccgggatggg--
A0A2K5M8B1_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5M8B1_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6LPM4_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6QFA2_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5VPG2_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
F6UKR4_BCL2L1-02        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5YR37_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5YR37_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5VPG2_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
F6UKR4_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A0D9RJZ8_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
I7GKS6_BCL2L1-01        gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6LPM4_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6QFA2_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K6QFA2_BCL2L1-      gcatatcagagctttgaacaggtagtgaatgaactcttccgggatggg--
A0A2K5YR37_BCL2L1-      gcatatcagagctttgaaca------------------------------
A0A2K6UWY8_BCL2L1-      gcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggg--
E2IV77_BCL2L1-01        gcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggg--
A0A2K6UWY8_BCL2L1-      gcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggg--
F7IT34_BCL2L1-02        gcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
F7IT34_BCL2L1-01        gcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
F7IT34_BCL2L1-03        ----------gctttgaacaggtagtgaacgaactcttccgggatggg--
A0A2K5EBP4_BCL2L1-      gcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
A0A2K5EBP4_BCL2L1-      gcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
E2IV75_BCL2L1-01        gcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggg--
M3Z2H9_BCL2L1-01        gcgtatcagagctttgagcaggtggtgaacgaactcttccgggatggg--
M3XA94_BCL2L1-01        gcatatcagagctttgagcaggtagtgaacgaactcttccgggatggg--
Q76LT7_BCL2L1-01        gcatatcagagctttgagcaggtagtgaatgaactcttccgggatggg--
Q8SQ42_BCL2L1-01        gcatatcagagctttgagcaggtagtgaatgaactcttccgggatggg--
A0A087YBW4_BCL2L1-      gcctaccagagcttcaagaccgtgctggatgagttgttcaagggtgag--
M4A558_BCL2L1-01        gcctaccacagcttcaagaccgtgctggacgagttgttcaagggcggg--
A0A0F7L1T6_BCL2L1-      gcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgga--
H2U5I3_BCL2L1-01        gcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgga--
H2U5I3_BCL2L1-02        gcttaccagagctttaagaatgtgatggacgaggtgttcaaggacgga--
G3P7B4_BCL2L1-01        gcctaccacagcttcaagagcgtgatggacgaggtgttcaaggatggc--
E6ZFR0_BCL2L1-01        gcctaccacagctttaaaagcgtgatggacgaggtgttcaaggatgga--
A0A0B4KJI5_BCL2L1-      gcctaccacagctttaagagcgtgatggacgaggtgttcaaggacgga--
D2ITA2_BCL2L1-02        gcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagc--
C1BLI0_BCL2L1-01        gcataccatagctttgaaagtgtaatgaacgaggtgttcagggacggc--
A0A286MU87_BCL2L1-      gcctaccacagctttgagagtgtgatggacgaagtgttcagggacggg--
C0HAD8_BCL2L1-01        gcctaccacagctttgagagtgtgatggacgaagtgttcagggacggg--
Q90Z98_BCL2L1-01        gcgtaccagagcttcgagagcgtgatggatgaggtgtttcgcgacggc--
Q90Z98_BCL2L1-02        gcgtaccagagcttcgagagcgtgatggatgaggtgtttcgcgacggc--
H2SNZ8_BCL2L1-02        gcttaccaaagttttgagaatgttatggatgaggtatttagggatgga--
H2SNZ8_BCL2L1-01        gcttaccaaagttttgagaatgttatggatgaggtatttagggatgga--
H3CH49_BCL2L1-01        gcttaccaaagttttgagaacgttatggatgaggtgtttcgggatgga--
A0A059PJI5_BCL2L1-      gtgtaccagagctttgagagcgtgatggacgaggtgttccgcgacggc--
B5XAY3_BCL2L1-01        gcctaccagagctttgagaacgtgatggacgaggtgttccgggacggt--
W5MG74_BCL2L1-01        gcctaccagagcttcgagcacgtcatggacgaggtcttccgggacggg--
A0A087X9B7_BCL2L1-      gcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggc--
A0A2U9BY16_BCL2L1-      gcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggc--
A0A0D6DR75_BCL2L1-      gcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggc--
I3IZK7_BCL2L1-01        gcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggc--
A0A219P0Y3_BCL2L1-      gcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacgga--
G3NJY1_BCL2L1-01        gcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggc--
C3VIT1_BCL2L1-01        gcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggc--

R4JQR8_BCL2L1-01        tattaactggggaaggattgtggctcttttcggttttggtgggtctttgt
Q6GLI5_BCL2L1-01        -accaactggggcagaatcgtggccttcttctcctttgggcgggccctgt
Q2TAP5_BCL2L1-01        -acaaactgggggagaattgtggctttcttctcatttgggcgggccctat
Q91828_BCL2L1-01        -acaaactgggggagaattgtggctttcttctcatttgggcgggccctat
H3ANS8_BCL2L1-01        -gtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgt
H9GHK7_BCL2L1-01        -gtaaactgggggcggatagtggcattcttctcctttgggggagccctgt
U3IS71_BCL2L1-01        -gtgaactgggggcgcatcgtggccttcttctccttcggaggggcgctgt
K7F655_BCL2L1-01        -gtgaactgggggcgcattgtggcttttttctcctttggaggagccctgt
G1N5N5_BCL2L1-01        -gtgaactgggggcgcatcgtggctttcttctccttcggaggggctttgt
Q07816_BCL2L1-03        -gtgaactgggggcgcatcgtggctttcttctccttcggaggggctttgt
Q07816_BCL2L1-01        -gtgaactgggggcgcatcgtggctttcttctccttcggaggggctttgt
Q07816_BCL2L1-02        -gtgaactgggggcgcatcgtggctttcttctccttcggaggggctttgt
U3JSL7_BCL2L1-01        -gtgaactggggccgcatcgtggctttcttctccttcggaggagccttgt
Q4U2V6_BCL2L1-01        -gtgaactggggccgcatcgtggctttcttctccttcggaggagccttgt
H0Z8G3_BCL2L1-01        -gtgaactggggccgcatcgtggctttcttctccttcggaggagccttgt
F6WA14_BCL2L1-01        -gtgaactggggccgaattgtggcattcttctccttcggaggggcattgt
G3WKX6_BCL2L1-01        -gtgaactggggccgaattgtggcattcttctccttcggaggggcattgt
W5PSA5_BCL2L1-01        -gtgaactggggtcgcaatgtggcctttttctccttcggtggggcactat
G3SPN0_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
H0X6V2_BCL2L1-01        -gtaaactggggtcgaattgtggcctttttctccttcggcggggctctgt
P53563_BCL2L1-04        -gtaaactggggtcgcattgtggccttcttctcctttggcggggcactgt
P53563_BCL2L1-02        -gtaaactggggtcgcattgtggccttcttctcctttggcggggcactgt
P53563_BCL2L1-03        -gtaaactggggtcgcattgtggccttcttctcctttggcggggcactgt
P53563_BCL2L1-01        -gtaaactggggtcgcattgtggccttcttctcctttggcggggcactgt
O35843_BCL2L1-01        -gtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgt
Q64373_BCL2L1-09        -gtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgt
Q64373_BCL2L1-01        -gtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgt
Q64373_BCL2L1-03        -gtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgt
Q64373_BCL2L1-04        -gtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgt
B2Z3Z4_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggtggagccctct
A0A1U7QU73_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggtggagccctct
Q9MYW4_BCL2L1-01        -gtgaactggggccgcattgtggcctttttctccttcggcggggcactgt
A0A1S3EPX7_BCL2L1-      -gtaaactggggtcgaattgtggcctttttctccttcggcggggcactgt
O77737_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
A0A286Y5D6_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcattgt
G1P9D2_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgt
Q05KJ0_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
Q9MZS7_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
A0A1S2ZQT6_BCL2L1-      -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
A0A1L5BWY3_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A287CZ07_BCL2L1-      -gtaaactggggtcacattgtggcctttctctcctttggcggggcactgt
I3MUP5_BCL2L1-03        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
I3MUP5_BCL2L1-02        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
I3MUP5_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F6WQI0_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
E2IV76_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggccctat
A0A2K6G3C5_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggccctct
A0A2K6G3C5_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggccctct
G1RER8_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2J8VIH3_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
Q07817_BCL2L1-03        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
Q07817_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
G3RY91_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5H963_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5H963_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
Q2PFS6_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5M8B1_BCL2L1-      -gtgaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5M8B1_BCL2L1-      -gtgaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6LPM4_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6QFA2_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5VPG2_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F6UKR4_BCL2L1-02        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5YR37_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5YR37_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5VPG2_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F6UKR4_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A0D9RJZ8_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
I7GKS6_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6LPM4_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6QFA2_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6QFA2_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      -gtgaactggggtcgcattgtggcctttttctccttcggcggggcactgt
E2IV77_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K6UWY8_BCL2L1-      -gtgaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F7IT34_BCL2L1-02        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F7IT34_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
F7IT34_BCL2L1-03        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5EBP4_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
A0A2K5EBP4_BCL2L1-      -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
E2IV75_BCL2L1-01        -gtaaactggggtcgcattgtggcctttttctccttcggcggggcactgt
M3Z2H9_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggctctgt
M3XA94_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
Q76LT7_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
Q8SQ42_BCL2L1-01        -gtgaactggggtcgcattgtggcctttttctccttcggtggggcactgt
A0A087YBW4_BCL2L1-      -gtcaactggggtcgggtggtggccatgtttacctttgggggaattctgt
M4A558_BCL2L1-01        -gtcaactgggggcgggtggtggccatgtttaccttcggggggattctgt
A0A0F7L1T6_BCL2L1-      -gacaactggggacgagttgtgggactatttgcctttggcggggtactat
H2U5I3_BCL2L1-01        -gtcaactggggacgagttgtgggactatttgcctttggcggggtactat
H2U5I3_BCL2L1-02        -gtcaactggggacgagttgtgggactatttgcctttggcggggtactat
G3P7B4_BCL2L1-01        -gtcaactggggccgcgtggtgggcctgtttgccttcggcggcgtgctct
E6ZFR0_BCL2L1-01        -gtgaactggggacgtatagtgggcctgtttgcctttggcggtgtactgt
A0A0B4KJI5_BCL2L1-      -gtcaactggggacgtgtagtgggcctgtttgcttttggcggtgtgctgt
D2ITA2_BCL2L1-02        -atcaactggggacgcatagtgggcctgtttgccttcgggggggccctct
C1BLI0_BCL2L1-01        -gtcaactggggacgtgtagtaggcctgtttgcttttggtggtgctcttt
A0A286MU87_BCL2L1-      -gtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgt
C0HAD8_BCL2L1-01        -gtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgt
Q90Z98_BCL2L1-01        -gtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgt
Q90Z98_BCL2L1-02        -gtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgt
H2SNZ8_BCL2L1-02        -gtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
H2SNZ8_BCL2L1-01        -gtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
H3CH49_BCL2L1-01        -gtcaactgggggcggatagtgggcctttttgccttcggtggtgccctgt
A0A059PJI5_BCL2L1-      -gtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctct
B5XAY3_BCL2L1-01        -gtcaactggggacgggtggtgggcctgttttccttcggaggggccctct
W5MG74_BCL2L1-01        -gtgaactgggggcgcatcgtggggctcttcgctttcgggggtgcgctgt
A0A087X9B7_BCL2L1-      -gtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgctct
A0A2U9BY16_BCL2L1-      -gtcaactggggccgcatcatagggctttttgcatttggcggggcgctga
A0A0D6DR75_BCL2L1-      -gtcaactggggccgcatcatagggctctttgcatttggtggggcactgt
I3IZK7_BCL2L1-01        -gtcaactggggccgcatcgtagggctttttgcgttcggcggggcactgt
A0A219P0Y3_BCL2L1-      -gtcaactggggccgcatcgtagggcttttcgctttcggcggggcgctgt
G3NJY1_BCL2L1-01        -gtcaactggggccgcatcgtggggctgttcgccttcggcggggcgctgt
C3VIT1_BCL2L1-01        -gtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgt

R4JQR8_BCL2L1-01        cagtgaaatgtgtacaaagaggaatgccacaacttgtggattcaattgtt
Q6GLI5_BCL2L1-01        gcgtggagagtgccaacaaggagatgactgagctgctccccaggatcgtg
Q2TAP5_BCL2L1-01        gtgtggagagtgcaaacaaggagatgactgatctgctacccagaattgtc
Q91828_BCL2L1-01        gtgtggagagtgcaaacaaggagatgactgatctgctacccagaattgtc
H3ANS8_BCL2L1-01        gtgtggagagtatggacaaggagatgtcttcactagtagagcggatcgct
H9GHK7_BCL2L1-01        gcgtggagagcgttgacaaagagatgcaagggttggtggtgaggattgcc
U3IS71_BCL2L1-01        gcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatcgtg
K7F655_BCL2L1-01        gcgtggagagtgtggacaaggagatgcaggtgttggtgggacgcatcgcc
G1N5N5_BCL2L1-01        gcgtggagagcgtggacaaggagatgcgggtactggtgggacgcattgtg
Q07816_BCL2L1-03        gcgtggagagcgtggacaaggagatgcgggtactggtgggacgcattgtg
Q07816_BCL2L1-01        gcgtggagagcgtggacaaggagatgcgggtactggtgggacgcattgtg
Q07816_BCL2L1-02        gcgtggagagcgtggacaaggagatgcgggtactggtgggacgcattgtg
U3JSL7_BCL2L1-01        gcgtggagagcgttgttaaggagatgcgggtattggtgaaacgcatcgtg
Q4U2V6_BCL2L1-01        gcgtggagagcgttgttaaggagatgagggtattggtgaaacgcatcgtg
H0Z8G3_BCL2L1-01        gcgtggagagcgttgttaaggagatgagggtattggtgaaacgcatcgtc
F6WA14_BCL2L1-01        gtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatcacc
G3WKX6_BCL2L1-01        gtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatcacc
W5PSA5_BCL2L1-01        gcatgaaaagcatagtcaaggagatgcaggtattggtaagtcaggtcacg
G3SPN0_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
H0X6V2_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
P53563_BCL2L1-04        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
P53563_BCL2L1-02        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
P53563_BCL2L1-03        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
P53563_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
O35843_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
Q64373_BCL2L1-09        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
Q64373_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
Q64373_BCL2L1-03        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
Q64373_BCL2L1-04        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
B2Z3Z4_BCL2L1-01        gtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A1U7QU73_BCL2L1-      gtgtggaaagcgtagacaaggagatgcaggtgttggtgagtcggattgca
Q9MYW4_BCL2L1-01        gcgtggaaagcgtggacaaggagatggaggtattggtgagtcggatcgcg
A0A1S3EPX7_BCL2L1-      gtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
O77737_BCL2L1-01        gcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A286Y5D6_BCL2L1-      gcgtggagagcgtagacaaggagatgcaggtattggtgaggcggatcgca
G1P9D2_BCL2L1-01        gcgtggaaagtgtggacaaggagatgcaggtattggtgagtcggattgca
Q05KJ0_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q9MZS7_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A1S2ZQT6_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A1L5BWY3_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A287CZ07_BCL2L1-      gcatggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
I3MUP5_BCL2L1-03        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
I3MUP5_BCL2L1-02        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
I3MUP5_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
F6WQI0_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
E2IV76_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6G3C5_BCL2L1-      gcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6G3C5_BCL2L1-      gcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
G1RER8_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
A0A2J8VIH3_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgca
Q07817_BCL2L1-03        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q07817_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
G3RY91_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5H963_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5H963_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q2PFS6_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5M8B1_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5M8B1_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6LPM4_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6QFA2_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5VPG2_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
F6UKR4_BCL2L1-02        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5YR37_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5YR37_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5VPG2_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
F6UKR4_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A0D9RJZ8_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
I7GKS6_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6LPM4_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6QFA2_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K6QFA2_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
E2IV77_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
A0A2K6UWY8_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
F7IT34_BCL2L1-02        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
F7IT34_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
F7IT34_BCL2L1-03        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5EBP4_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A2K5EBP4_BCL2L1-      gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
E2IV75_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
M3Z2H9_BCL2L1-01        gtgtggagagcgtagacaaggagatgcaggcattggtgagtcggatcgca
M3XA94_BCL2L1-01        gcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q76LT7_BCL2L1-01        gcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgca
Q8SQ42_BCL2L1-01        gcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgca
A0A087YBW4_BCL2L1-      gtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgcc
M4A558_BCL2L1-01        gtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgcc
A0A0F7L1T6_BCL2L1-      gtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgca
H2U5I3_BCL2L1-01        gtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgca
H2U5I3_BCL2L1-02        gtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgca
G3P7B4_BCL2L1-01        gcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcg
E6ZFR0_BCL2L1-01        gtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgca
A0A0B4KJI5_BCL2L1-      gtgtggaatgcgttgagaaggatacgagcgagctggtctcccgcatcgca
D2ITA2_BCL2L1-02        gcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggca
C1BLI0_BCL2L1-01        gtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgca
A0A286MU87_BCL2L1-      gtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgca
C0HAD8_BCL2L1-01        gtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgca
Q90Z98_BCL2L1-01        gcgtcgagtgtgtggagaaggagatgagtccgcttgtgggacgcatcgca
Q90Z98_BCL2L1-02        gcgtcgagtgtgtggagaaggagatgagtccgcttgtgggacgcatcgca
H2SNZ8_BCL2L1-02        gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattata
H2SNZ8_BCL2L1-01        gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattata
H3CH49_BCL2L1-01        gtgtggagtgtgtggagaaggagatgaatcctctggttggccggatcata
A0A059PJI5_BCL2L1-      gtgtcgagtgtgtggaaaaggagatgagtccgctggtggcacgtatcgcc
B5XAY3_BCL2L1-01        gtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
W5MG74_BCL2L1-01        gcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagcc
A0A087X9B7_BCL2L1-      gcgtggaatgcgttgagaaggagatgagccacctggtagccaggattgta
A0A2U9BY16_BCL2L1-      gtgtggagtgtgtggagaaggagatgagttcgctggtgggcaggatcgtt
A0A0D6DR75_BCL2L1-      gtgttgagtgtgtggagaaggagatgagtcagctggtggtcaggatcgta
I3IZK7_BCL2L1-01        gtgttgagtgcgtcgagaaggagatgagccccttggtgggcaggatcgta
A0A219P0Y3_BCL2L1-      gcgtggagtgcgttgagaaggagatgagtccgttggtgggcaggatcata
G3NJY1_BCL2L1-01        gcgtggagtgcgtggacaaggagatgagtccgctggtgggcaggatcgtc
C3VIT1_BCL2L1-01        gcgtggagtgcgtggagagggagatgagccccttggtgggcaggatcgtg

R4JQR8_BCL2L1-01        gactgggtatctacctatttgtgtaatagtttagagcaatggattacaga
Q6GLI5_BCL2L1-01        caatggatggtgcagtacctggagcatacgctgcagccctggatgctgga
Q2TAP5_BCL2L1-01        cagtggatggtgaattatctagagcacacactgcagccctggatgcagga
Q91828_BCL2L1-01        cagtggatggtgaattatctagagcacacactgcagccctggatgcagga
H3ANS8_BCL2L1-01        gagtggatgacgacttacctagatgataacttaaacccttggattcagga
H9GHK7_BCL2L1-01        agctggatgaccacgtacctgactgaacacctggacccctggatccaaga
U3IS71_BCL2L1-01        gcctggatgaccacctaccggagggcagagctggagaaagcattttctga
K7F655_BCL2L1-01        tcttggatgaccacttacctgactgaccaccttgatccctggatccaaga
G1N5N5_BCL2L1-01        tcttggatgaccacgtacttgaccgaccatctagacccctggatccagga
Q07816_BCL2L1-03        tcttggatgaccacgtacttgaccgaccatctagatccctggatccagga
Q07816_BCL2L1-01        tcttggatgaccacgtacttgaccgaccatctagatccctggatccagga
Q07816_BCL2L1-02        tcttggatgaccacgtacttgaccgaccatctagatccctggatccagga
U3JSL7_BCL2L1-01        tcttggatgaccacgtacttgaccgaccacttagatccctggatccagga
Q4U2V6_BCL2L1-01        tcttggatgaccacgtacttgaccgaccacttagatccctggatccagga
H0Z8G3_BCL2L1-01        tcttggatgaccacgtacttgaccgaccacttagatccctggatccagga
F6WA14_BCL2L1-01        tcctggatggccacttacttggatgaccacctagacccttggatccaaga
G3WKX6_BCL2L1-01        tcctggatggccacttacttggatgagcacctagacccatggatccaaga
W5PSA5_BCL2L1-01        acttggatggccacttacctaaatgaccacctagagccttggatccagga
G3SPN0_BCL2L1-01        acttggatggctacttacctgaatgaccacctagagccttggatccagga
H0X6V2_BCL2L1-01        gcttggatggccacttacttgaatgaccacctagagccttggatccagga
P53563_BCL2L1-04        agttggatggccacctacctgaatgaccacctagagccttggatccagga
P53563_BCL2L1-02        agttggatggccacctacctgaatgaccacctagagccttggatccagga
P53563_BCL2L1-03        agttggatggccacctacctgaatgaccacctagagccttggatccagga
P53563_BCL2L1-01        agttggatggccacctacctgaatgaccacctagagccttggatccagga
O35843_BCL2L1-01        agttggatggccacctatctgaatgaccacctagagccttggatccagga
Q64373_BCL2L1-09        agttggatggccacctatctgaatgaccacctagagccttggatccagga
Q64373_BCL2L1-01        agttggatggccacctatctgaatgaccacctagagccttggatccagga
Q64373_BCL2L1-03        agttggatggccacctatctgaatgaccacctagagccttggatccagga
Q64373_BCL2L1-04        agttggatggccacctatctgaatgaccacctagagccttggatccagga
B2Z3Z4_BCL2L1-01        agttggatggccacctacctgaatgaccacctagagccttggatccagga
A0A1U7QU73_BCL2L1-      agttggatggccacctacctgaatgaccacctagagccttggatccagga
Q9MYW4_BCL2L1-01        gcgtggatggccacttacctgaatgaccacctggagccctggatccagga
A0A1S3EPX7_BCL2L1-      agttggatggccacttacctgaatgaccacctagagccttggatccagga
O77737_BCL2L1-01        acttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A286Y5D6_BCL2L1-      agctggatggctacttacctgaatgaccacctagaaccttggatccagga
G1P9D2_BCL2L1-01        acgtggatggccacttacctgaatgaccacctagagccttggatccagga
Q05KJ0_BCL2L1-01        acttggatggccacttacctgaatgaccacctagagccttggatccagga
Q9MZS7_BCL2L1-01        acttggatggctacttacctgaatgaccacctagagccttggatccagga
A0A1S2ZQT6_BCL2L1-      acttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A1L5BWY3_BCL2L1-      agttggatggctacttacctgaatgaccacctagaaccttggatccagga
A0A287CZ07_BCL2L1-      agttggat---------------------------gccttggatccaaga
I3MUP5_BCL2L1-03        agttggatggccacttacctgaatgaccacctagagccttggatccagga
I3MUP5_BCL2L1-02        agttggatggccacttacctgaatgaccacctagagccttggatccagga
I3MUP5_BCL2L1-01        agttggatggccacttacctgaatgaccacctagagccttggatccagga
F6WQI0_BCL2L1-01        acctggatggccacttacctgaatgaccacctagagccttggatccaaga
E2IV76_BCL2L1-01        acttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K6G3C5_BCL2L1-      acttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K6G3C5_BCL2L1-      acttggatggccacttacctgaatgaccacctagagccttggatccagga
G1RER8_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2J8VIH3_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
Q07817_BCL2L1-03        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
Q07817_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
G3RY91_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5H963_BCL2L1-      acttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K5H963_BCL2L1-      acttggatggccacttatctgaatgaccacctagagccttggatccagga
Q2PFS6_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5M8B1_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5M8B1_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K6LPM4_BCL2L1-      gcttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K6QFA2_BCL2L1-      gcttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K5VPG2_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
F6UKR4_BCL2L1-02        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5YR37_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5YR37_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5VPG2_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
F6UKR4_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A0D9RJZ8_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
I7GKS6_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K6LPM4_BCL2L1-      gcttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K6QFA2_BCL2L1-      gcttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K6QFA2_BCL2L1-      gcttggatggccacttatctgaatgaccacctagagccttggatccagga
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
E2IV77_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K6UWY8_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
F7IT34_BCL2L1-02        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
F7IT34_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
F7IT34_BCL2L1-03        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5EBP4_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A2K5EBP4_BCL2L1-      gcttggatggccacttacctgaatgaccacctagagccttggatccagga
E2IV75_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
M3Z2H9_BCL2L1-01        acttggatggccacttacctgaacgaccacctagagccttggatccagga
M3XA94_BCL2L1-01        acttggatggccacttacctgaacgaccacctagagccttggatccagga
Q76LT7_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
Q8SQ42_BCL2L1-01        gcttggatggccacttacctgaatgaccacctagagccttggatccagga
A0A087YBW4_BCL2L1-      gaatggatgaccacttacctggacgagcagctcaatccctggatccaaag
M4A558_BCL2L1-01        gaatggatgaccacttacctggatgagcagctcagtccctggatccagag
A0A0F7L1T6_BCL2L1-      gactggatgaccatttacctggatgagcatattaacccgtggatccagag
H2U5I3_BCL2L1-01        gactggatgaccatttacctggatgagcatattaacccgtggatccagag
H2U5I3_BCL2L1-02        gactggatgaccatttacctggatgagcatattaacccgtggatccagag
G3P7B4_BCL2L1-01        gactggatgaccacgtacctggacgagcacatcagtgcttggatccagag
E6ZFR0_BCL2L1-01        gactggatgaccatgtacctggatgagcacatcagtccgtggatccagag
A0A0B4KJI5_BCL2L1-      gactggatgaccatgtacctggatgagcacatcaatccgtggattgagag
D2ITA2_BCL2L1-02        gagtggatgaccaggtacctggacgaccacattgaccactggatccagag
C1BLI0_BCL2L1-01        gattggatgaccacctacctggacaaccacatccagccatggatacagag
A0A286MU87_BCL2L1-      gattggatgaccacctatctggacaaccatatccagccctggatccagag
C0HAD8_BCL2L1-01        gactggatgaccacctacctggacaaccatatccagccctggatccagag
Q90Z98_BCL2L1-01        gaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
Q90Z98_BCL2L1-02        gaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
H2SNZ8_BCL2L1-02        gagtggatgacagtctatcttgacaaccacattcaaccatggatccagag
H2SNZ8_BCL2L1-01        gagtggatgacagtctatcttgacaaccacattcaaccatggatccagag
H3CH49_BCL2L1-01        gagtggatgacggtctatctggacaaccacatccagccctggatccagag
A0A059PJI5_BCL2L1-      gagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
B5XAY3_BCL2L1-01        gactggatgaccgtctacctggacaaccacatccagccctggatccagag
W5MG74_BCL2L1-01        gagtggatgaccgtctacctggacaacaacattcagccctggatccagag
A0A087X9B7_BCL2L1-      gagtggatgaccgtctacttggatgagcggattgaaccttgggtggagag
A0A2U9BY16_BCL2L1-      gagtggatgacggtgtacctagacaacaacatccagccctggatccaaag
A0A0D6DR75_BCL2L1-      gagtggatgacagtgtacctggacgaccacattcagccctggatccaaag
I3IZK7_BCL2L1-01        gagtggatgaccgtctacctagacaaccacattcagccctggatccagag
A0A219P0Y3_BCL2L1-      gagtggaagacccgctatctggacaaccacattcagccctggatccagag
G3NJY1_BCL2L1-01        gagtggatgacgctctacctggacaaccacattcagccctggatccagaa
C3VIT1_BCL2L1-01        gagtggatgacggtctacctggacaaccacattcagccctggatccagag

R4JQR8_BCL2L1-01        taacggtggttggca-----------------aggatttgtggaa-gcct
Q6GLI5_BCL2L1-01        gaacggaggctggga-----------------agcttttgtcggt-ctgt
Q2TAP5_BCL2L1-01        gaatggaggctggga-----------------agcttttgtcggc-ctgt
Q91828_BCL2L1-01        gaatggaggctggga-----------------agcttttgtcggc-ctgt
H3ANS8_BCL2L1-01        acaaggaggatgggc-----------------aaccataatacac-attg
H9GHK7_BCL2L1-01        aaacggtggctggaa-------------------------------atca
U3IS71_BCL2L1-01        gggaggagggatgga-----------------gcggtttgtggac-ctct
K7F655_BCL2L1-01        gaatggcggttggga-----------------gcgctttgtggat-ctct
G1N5N5_BCL2L1-01        gaatggcggctggga-----------------gcgctttgtggac-ctgt
Q07816_BCL2L1-03        gaatggcggctggg------------------------------------
Q07816_BCL2L1-01        gaatggcggctggga-----------------gcgctttgtggat-ctgt
Q07816_BCL2L1-02        gaatggcggctggga-----------------gcgctttgtggat-ctgt
U3JSL7_BCL2L1-01        gaatggcggatggga-----------------gcgctttgtggac-ctct
Q4U2V6_BCL2L1-01        gaatggcggatggga-----------------gcgctttgtggac-ctct
H0Z8G3_BCL2L1-01        gaatggcggatggga-----------------gcgctttgtgga--ctct
F6WA14_BCL2L1-01        aaatggcggctggga-----------------cacctttgtggaa-cttt
G3WKX6_BCL2L1-01        aaatggcggttggga-----------------caccttcgtggag-cttt
W5PSA5_BCL2L1-01        gaatggcgactggga-----------------catttttgtggaa-ctct
G3SPN0_BCL2L1-01        gaacggcggctgggt------aaggaccacgccccttttgtg----cttc
H0X6V2_BCL2L1-01        gaacggcggctggtg--------gaggtgtcaggcctttccagag-cttc
P53563_BCL2L1-04        gaacggcggctgggt------aagaaccacgccccttgtgtgtccgcccc
P53563_BCL2L1-02        gaacggcggctgggt------aagaaccacgccccttgtgtgtccgcccc
P53563_BCL2L1-03        gaacggcggctgggt------aagaaccacgccccttgtgtgtccgcccc
P53563_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggat-ctct
O35843_BCL2L1-01        gaacggcggctggggtgtgagtggaggtacacccctcagatctgt-cttc
Q64373_BCL2L1-09        gaacggcggctggga-----------------cacttttgtggat-ctct
Q64373_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggat-ctct
Q64373_BCL2L1-03        gaacggcggctggg------------------------------------
Q64373_BCL2L1-04        gaacggcggctggg------------------------------------
B2Z3Z4_BCL2L1-01        caacggcggctggga-----------------cactttcgtggaa-ctct
A0A1U7QU73_BCL2L1-      caacggcggctggga-----------------cactttcgtggaa-ctct
Q9MYW4_BCL2L1-01        gaacggcggctggga-----------------cacgtttgtggaa-ctct
A0A1S3EPX7_BCL2L1-      gcacggcggctggga-----------------cacttttgtggaa-ctct
O77737_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A286Y5D6_BCL2L1-      caacggcggctggga-----------------cacttttgtggaa-ctct
G1P9D2_BCL2L1-01        gaacggaggctggga-----------------cacttttgtggaa-ctct
Q05KJ0_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
Q9MZS7_BCL2L1-01        gaacggcggctggga-----------------cacgtttgtggaa-ctct
A0A1S2ZQT6_BCL2L1-      gaatggcggctggga-----------------cacttttgtggaa-ctct
A0A1L5BWY3_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A287CZ07_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
I3MUP5_BCL2L1-03        gaacggcggctggga-----------------cacttttgtggaa-ctct
I3MUP5_BCL2L1-02        gaacggcggctggga-----------------cacttttgtggaa-ctct
I3MUP5_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
F6WQI0_BCL2L1-01        gaacggcggctggga-----------------cacctttgtggaa-ctct
E2IV76_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6G3C5_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6G3C5_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
G1RER8_BCL2L1-01        gaacggcggctggga-----------------tacttttgtggaa-ctct
A0A2J8VIH3_BCL2L1-      gaacggcggctggga-----------------tacttttgtggaa-ctct
Q07817_BCL2L1-03        gaacggcggctggga-----------------tacttttgtggaa-ctct
Q07817_BCL2L1-01        gaacggcggctggga-----------------tacttttgtggaa-ctct
Q07817_BCL2L1-02        ------------gga-----------------tacttttgtggaa-ctct
G3RY91_BCL2L1-02        gaacggcggctggga-----------------tacttttgtggaa-ctct
G3RY91_BCL2L1-01        gaacggcggctggga-----------------tacttttgtggaa-ctct
A0A2K5H963_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5H963_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
Q2PFS6_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5M8B1_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5M8B1_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6LPM4_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6QFA2_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5VPG2_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
F6UKR4_BCL2L1-02        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5YR37_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5YR37_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5VPG2_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
F6UKR4_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A0D9RJZ8_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
I7GKS6_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6LPM4_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6QFA2_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6QFA2_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5YR37_BCL2L1-      ------------gga-----------------cacttttgtggaa-ctct
A0A2K6UWY8_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
E2IV77_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K6UWY8_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
F7IT34_BCL2L1-02        gaacggcggctggga-----------------cacttttgtggaa-ctct
F7IT34_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
F7IT34_BCL2L1-03        gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5EBP4_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
A0A2K5EBP4_BCL2L1-      gaacggcggctggga-----------------cacttttgtggaa-ctct
E2IV75_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
M3Z2H9_BCL2L1-01        gaacggcggctggga-----------------cactttcgtggaa-ctct
M3XA94_BCL2L1-01        gaacggcggctggga-----------------cacttttgtggaa-ctct
Q76LT7_BCL2L1-01        gaacggcggctggga-----------------tacttttgtggaa-ctct
Q8SQ42_BCL2L1-01        gaacggcggctggga-----------------tacttttgtggaa-ctct
A0A087YBW4_BCL2L1-      ccagggaggatggga-----------------ccgcttcgctaac-ctgt
M4A558_BCL2L1-01        ccagggaggatggga-----------------ccgctttgctaac-ctgt
A0A0F7L1T6_BCL2L1-      tcaaggaggatggga-----------------ttgcttcgcgaag-attt
H2U5I3_BCL2L1-01        tcaaggaggatggga-----------------ttgcttcgcgaag-attt
H2U5I3_BCL2L1-02        tcaaggaggatggga-----------------ttgcttcgcgaag-attt
G3P7B4_BCL2L1-01        ccagggaggatggga-----------------ctgttttgctgac-attt
E6ZFR0_BCL2L1-01        ccaaggaggatggga-----------------ctgctttgctgag-gttt
A0A0B4KJI5_BCL2L1-      ccaaggaggatggga-----------------ctcctttgctgag-gttt
D2ITA2_BCL2L1-02        caacggaggatggaa-----------------acactttgctgcg-gttt
C1BLI0_BCL2L1-01        acagggtggatggga-----------------ccgatttgctgac-attt
A0A286MU87_BCL2L1-      ccaaggcggatgg--------------------------gcagag-atct
C0HAD8_BCL2L1-01        ccaaggaggatggga-----------------ccgttttgcagag-atct
Q90Z98_BCL2L1-01        ccaaggaggatggga-----------------acgctttgcagag-atct
Q90Z98_BCL2L1-02        ccaaggaggatggga-----------------acgctttgcagag-atct
H2SNZ8_BCL2L1-02        tcaaggaggatgggt-----------------ccgttttgctgaa-ctct
H2SNZ8_BCL2L1-01        tcaaggaggatgggt-----------------ccgttttgctgaa-ctct
H3CH49_BCL2L1-01        tcaaggaggatggga-----------------acgttttgctgaa-ctct
A0A059PJI5_BCL2L1-      gcaaggaggatggga-----------------acggtttgcagag-atct
B5XAY3_BCL2L1-01        ccaaggaggatggga-----------------ccggtttgcagag-atct
W5MG74_BCL2L1-01        tcagggaggatggga-----------------caggtttgcggag-atct
A0A087X9B7_BCL2L1-      ccaaggaggatggga-----------------ccgtttcgctgag-atct
A0A2U9BY16_BCL2L1-      tcaaggaggatggga-----------------gcactttgctgaa-atct
A0A0D6DR75_BCL2L1-      tcaaggaggatggga-----------------gcactttgctgaa-atct
I3IZK7_BCL2L1-01        ccaaggaggatggga-----------------gcgcttcgctgaa-atct
A0A219P0Y3_BCL2L1-      ccaaagaggatggga-----------------gcgcttcgccgaa-atct
G3NJY1_BCL2L1-01        ccagggaggctgg-------------------------------------
C3VIT1_BCL2L1-01        ccagggaggatggga-----------------acgcttcgctgag-atct

R4JQR8_BCL2L1-01        ataaccaaggacagaatcataatgacagtccgtgggatgtgaaaggactt
Q6GLI5_BCL2L1-01        ac-----ggaaagggagc--tgccgcccagagcagggaagggccggagcg
Q2TAP5_BCL2L1-01        at-----ggaaagaatgc--cgcagcccagagcagagaaagccaggaacg
Q91828_BCL2L1-01        at-----ggaaagaatgc--cgcagcccagagcagagaaagccaggaacg
H3ANS8_BCL2L1-01        ac-----ggggttgacgctatgcagc------gctcaaacaccaggagtg
H9GHK7_BCL2L1-01        aa-----ggg----------------------------gggaca-aatca
U3IS71_BCL2L1-01        ac-----gggaacgatgc--tgctgcggagatgaggaagggccaggaaac
K7F655_BCL2L1-01        ac-----gggaacgatgc--tgctgccaagagcaggaaaggccaggagca
G1N5N5_BCL2L1-01        at-----gggaataatgc--tgctgccgagctgaggaagggccaggagac
Q07816_BCL2L1-03        -t-----aagaactgctc--tcccatag----------------------
Q07816_BCL2L1-01        at-----gggaacaacgc--tgctgccgagctgaggaagggccaggagac
Q07816_BCL2L1-02        at-----gggaacaacgc--tgctgccgagctgaggaagggccaggagac
U3JSL7_BCL2L1-01        at-----gggaacgatgc--tgctgccgaggtgagaaaaggccaggagac
Q4U2V6_BCL2L1-01        at-----gggaacgatgc--tgctgccgagatgagaaaaggccaggagac
H0Z8G3_BCL2L1-01        at-------gaacgatgc--tgctgccgagatgagaaaaggccaggag--
F6WA14_BCL2L1-01        at-----gggaatgatgc--agctgcagagagccggaagggccaggaacg
G3WKX6_BCL2L1-01        at-----gggaatgatgc--agcagcagagagccggaagggccaggaacg
W5PSA5_BCL2L1-01        ac-----gaaaacaatac--agcaaccgagagccaaaagggccaagagca
G3SPN0_BCL2L1-01        ag-----tacctcagtga--aggaagacatagcctatgtgttcattcagg
H0X6V2_BCL2L1-01        tc-----tctcccaaatc--aaattccatttatttcaaagtttgcatgtg
P53563_BCL2L1-04        tt-----gtgtgtctctc--ctctgtggagatccctaactgc--------
P53563_BCL2L1-02        tt-----gtgtgtctctc--ctctgtggagatccctaactgc--------
P53563_BCL2L1-03        tt-----gtgtgtctctc--ctctgtggagatccctaactgc--------
P53563_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaaaggccaggagcg
O35843_BCL2L1-01        ag-----aaggcttgttc--aagtgccaggagtggcggagca--------
Q64373_BCL2L1-09        ac-----gggaacaatgc--agcagccgagagccggaaaggccaggagcg
Q64373_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaaaggccaggagcg
Q64373_BCL2L1-03        -t-----aagaaccacgc--------------------------------
Q64373_BCL2L1-04        -t-----aagaaccacgc--------------------------------
B2Z3Z4_BCL2L1-01        ac-----ggaaacaatgc--agcagctgagagccggaaaggccaggagcg
A0A1U7QU73_BCL2L1-      at-----gggaacaatgc--agcagctgagagccggaaaggccaggagcg
Q9MYW4_BCL2L1-01        ac-----ggcaacaacgc--agcagccgagagccgcaagggccaggagcg
A0A1S3EPX7_BCL2L1-      ac-----gggaacaatgc--agcagctgagagtcggaagggccaggagcg
O77737_BCL2L1-01        ac-----ggaaacaatgc--agcagctgagagccggaagggccaggaacg
A0A286Y5D6_BCL2L1-      ac-----gggaacaatgc--agcagccgagagccggaagggccaggagcg
G1P9D2_BCL2L1-01        ac-----gggaacaacgc--agcagccgagagccggaagggccaggaacg
Q05KJ0_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaagggccaggagcg
Q9MZS7_BCL2L1-01        ac-----gggaacaacgc--agcagccgagagccggaagggccaggagcg
A0A1S2ZQT6_BCL2L1-      at-----gggaacaatgc--agcagctgagagccgaaagggacaggagcg
A0A1L5BWY3_BCL2L1-      at-----ggaaacaatgc--agcagctgagagccggaagggccaggagcg
A0A287CZ07_BCL2L1-      ac-----aggaataatgc--ggcagcagagagccggaagggccaggagcg
I3MUP5_BCL2L1-03        ac-----gggaataatgc--agcagcagagagccggaagggccaggagcg
I3MUP5_BCL2L1-02        ac-----gggaataatgc--agcagcagagagccggaagggccaggagcg
I3MUP5_BCL2L1-01        ac-----gggaataatgc--agcagcagagagccggaagggccaggagcg
F6WQI0_BCL2L1-01        ac-----gggaacaacgc--ggcagccgaaagccggaagggccaggagcg
E2IV76_BCL2L1-01        ac-----gggaacaatgc--agcagctgagagccggaagggccaggaacg
A0A2K6G3C5_BCL2L1-      ac-----ggaaacaatgc--agcagctgagagccggaagggccaggaacg
A0A2K6G3C5_BCL2L1-      ac-----ggaaacaatgc--agcagctgagagccggaagggccaggaacg
G1RER8_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
A0A2J8VIH3_BCL2L1-      at-----gggaacaatgc--agcagctgagagccgaaagggccaggaacg
Q07817_BCL2L1-03        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
Q07817_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
Q07817_BCL2L1-02        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
G3RY91_BCL2L1-02        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
G3RY91_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggaacg
A0A2K5H963_BCL2L1-      at-----gggaacaatgc--agcagctgagagccgaaagggccaggagcg
A0A2K5H963_BCL2L1-      at-----gggaacaatgc--agcagctgagagccgaaagggccaggagcg
Q2PFS6_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5M8B1_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5M8B1_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6LPM4_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6QFA2_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5VPG2_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
F6UKR4_BCL2L1-02        at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5YR37_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5YR37_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5VPG2_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
F6UKR4_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A0D9RJZ8_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
I7GKS6_BCL2L1-01        at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6LPM4_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6QFA2_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6QFA2_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K5YR37_BCL2L1-      at-----gggaacaatgc--agcagccgagagccgaaagggccaggagcg
A0A2K6UWY8_BCL2L1-      at-----ggaaacaatgc--agcagccgagagcagaaagggccaggagcg
E2IV77_BCL2L1-01        at-----ggaaacaatgc--agcagccgagagcagaaagggccaggagcg
A0A2K6UWY8_BCL2L1-      at-----ggaaacaatgc--agcagccgagagcagaaagggccaggagcg
F7IT34_BCL2L1-02        at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
F7IT34_BCL2L1-01        at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
F7IT34_BCL2L1-03        at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
A0A2K5EBP4_BCL2L1-      at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
A0A2K5EBP4_BCL2L1-      at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
E2IV75_BCL2L1-01        at-----ggaaacaatgc--ggcagccgagagccgaaagggccaggagcg
M3Z2H9_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaagggccaggagcg
M3XA94_BCL2L1-01        ac-----gggaacaatgc--agcggccgagagccggaagggccaggagcg
Q76LT7_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaagggccaggagcg
Q8SQ42_BCL2L1-01        ac-----gggaacaatgc--agcagccgagagccggaagggccaggagcg
A0A087YBW4_BCL2L1-      ac-----ggccaggatgc--cgctgcagagggccggaggtttcgggagac
M4A558_BCL2L1-01        ac-----ggccaggacgc--cgctgcagagggccggaggtttcgggagac
A0A0F7L1T6_BCL2L1-      tt-----ggggacgacgc--cgcggcagaggggaggagagctcgcgagaa
H2U5I3_BCL2L1-01        tt-----ggggacgacgc--cgcggcagaggggaggagagctcgcgagaa
H2U5I3_BCL2L1-02        tt-----ggggacgacgc--cgcggcagaggggaggagagctcgcgagaa
G3P7B4_BCL2L1-01        tc-----gggcgggacgg--cgcggcagcggcgaggagatctcaggagac
E6ZFR0_BCL2L1-01        tt-----gggcgagacgc--cgccgcagaagcgaggagatctcgggagac
A0A0B4KJI5_BCL2L1-      tt-----gggcgagacgc--agctgcagaagcgaggagatctcgggagac
D2ITA2_BCL2L1-02        tt-----ggaagcgacgc--ggcagcgggagcgaggcgtacccgggacag
C1BLI0_BCL2L1-01        tc-----ggcagggatgc--tgctgctgaggttcgacgttcccaggagaa
A0A286MU87_BCL2L1-      tt-----ggcagagatgc--tgctgcagacgttcgacggtctcaggagag
C0HAD8_BCL2L1-01        tt-----ggcagagatgc--tgctgcagacgttcgacggtctcaggagag
Q90Z98_BCL2L1-01        tt-----ggaaaagatgc--agcggcggaaagcaggaaatcgcaagaaag
Q90Z98_BCL2L1-02        tt-----ggaaaagatgc--agcggcggaaagcaggaaatcgcaagaaag
H2SNZ8_BCL2L1-02        tt-----gggcaggatgc--agcagcagaaagcaggagatctcaggagag
H2SNZ8_BCL2L1-01        tt-----gggcaggatgc--agcagcagaaagcaggagatctcaggagag
H3CH49_BCL2L1-01        tc-----gggcaggacgc--ggctgcagaaagccgcaggtcccaggagcg
A0A059PJI5_BCL2L1-      tt-----gggaaagatgc--agcagcagaaggcagaaggtcacaggaaag
B5XAY3_BCL2L1-01        tt-----ggaatggacgc--tgcagccgagagcaggaagtctcaggagag
W5MG74_BCL2L1-01        tt-----ggcaaggatgc--ggctgcggagtaccggagatcacaggagag
A0A087X9B7_BCL2L1-      tc-----gggggcaacgc--ggcggcagagagcagaagatctcaggagag
A0A2U9BY16_BCL2L1-      tc-----gggcaggacgc--ggcggcagggagtcgaaggtctcaggagag
A0A0D6DR75_BCL2L1-      tc-----gggcatgatgc--agctgcagagagcaggaggtctcaggagag
I3IZK7_BCL2L1-01        tc-----gggcaggatgc--ggcggctgaaagccggaggtctcaggagag
A0A219P0Y3_BCL2L1-      tc-----gggcaggacgc--ggcggcagagagcaggaggtctcaggagag
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        tc-----gggcaggacgc--ggcggccgaaagcaggaggtctcaggagag

R4JQR8_BCL2L1-01        gttaaatacggagcaataggtgtaatag------------gcgc-aatgg
Q6GLI5_BCL2L1-01        gtttggccggtggctaa-----tggcca------------tagt-gactg
Q2TAP5_BCL2L1-01        atttggcaggttgc--------tgacta------------tagt-gattc
Q91828_BCL2L1-01        atttggcaggttgc--------tgacta------------tagt-gatgc
H3ANS8_BCL2L1-01        ----aaaaattgggttt-----tgttgg-----------------gtttt
H9GHK7_BCL2L1-01        tttca-------gttat-----ctacac------------gcat-cattc
U3IS71_BCL2L1-01        cttcaacaaatggctcc-----tgaccg------------gggc-cacgg
K7F655_BCL2L1-01        gttcaacagggggctgc-----tgacgg------------gggc-gactg
G1N5N5_BCL2L1-01        cttcaacaaatggctcc-----tgaccg------------gggc-gaccg
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        cttcaacaaatggctcc-----tcaccg------------gggc-gaccg
Q07816_BCL2L1-02        cttcaacaaatggctcc-----tcaccg------------gggc-gaccg
U3JSL7_BCL2L1-01        cttcaacaaatggctcc-----tgaccg------------gggc-gacgg
Q4U2V6_BCL2L1-01        cttcaacaaatggctcc-----tgaccg------------gggc-gacgg
H0Z8G3_BCL2L1-01        -ttcaacaaatggctcc-----tgacgg------------gggc-gacgg
F6WA14_BCL2L1-01        cttcaaccgatggctgc-----tgactg------------gcat-gacag
G3WKX6_BCL2L1-01        cttcaacagatggctgc-----tgactg------------gcat-gacag
W5PSA5_BCL2L1-01        cctcaaccgctggtccc-----tgacgg------------acat-gactg
G3SPN0_BCL2L1-01        tcaaaacctatg----c-----aagtgg------------g----aagtt
H0X6V2_BCL2L1-01        tggcaatttttgctctt-----tggctgcagctgggagatgctt-gacta
P53563_BCL2L1-04        --------------cct-----ttttgg------------tctcctggca
P53563_BCL2L1-02        --------------cct-----ttttgg------------tctcctggca
P53563_BCL2L1-03        --------------cct-----ttttgg------------tctcctggca
P53563_BCL2L1-01        tttcaaccgctggttcc-----tgacgg------------gcat-gactg
O35843_BCL2L1-01        --------------cgt-----ttgtga------------tcccagcctt
Q64373_BCL2L1-09        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q64373_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q64373_BCL2L1-03        --------------ccc-----ttgtgt------------gtcc-gcccc
Q64373_BCL2L1-04        --------------ccc-----ttgtgt------------gtcc-gcccc
B2Z3Z4_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A1U7QU73_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q9MYW4_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gaccg
A0A1S3EPX7_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gaccg
O77737_BCL2L1-01        cttcaaccgatggttcc-----tgacgg------------gcat-gactc
A0A286Y5D6_BCL2L1-      cttcaaccgctggttgc-----tgacgg------------gcgt-gactg
G1P9D2_BCL2L1-01        cttcaatcgctggttcc-----tgacgg------------gcat-gactg
Q05KJ0_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q9MZS7_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A1S2ZQT6_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcgt-gactg
A0A1L5BWY3_BCL2L1-      cttcaaccgctggttcc-----tgacag------------gcat-gactg
A0A287CZ07_BCL2L1-      cttcaaccgttggttcc-----tgacgg------------gcat-gactg
I3MUP5_BCL2L1-03        cttcaaccgttggttcc-----tgacgg------------gcat-gactg
I3MUP5_BCL2L1-02        cttcaaccgttggttcc-----tgacgg------------gcat-gactg
I3MUP5_BCL2L1-01        cttcaaccgttggttcc-----tgacgg------------gcat-gactg
F6WQI0_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
E2IV76_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6G3C5_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6G3C5_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
G1RER8_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gc--------
A0A2J8VIH3_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q07817_BCL2L1-03        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q07817_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q07817_BCL2L1-02        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
G3RY91_BCL2L1-02        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
G3RY91_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5H963_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5H963_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
Q2PFS6_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5M8B1_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5M8B1_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6LPM4_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6QFA2_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5VPG2_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
F6UKR4_BCL2L1-02        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5YR37_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5YR37_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5VPG2_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
F6UKR4_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A0D9RJZ8_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
I7GKS6_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6LPM4_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6QFA2_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6QFA2_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5YR37_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6UWY8_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
E2IV77_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K6UWY8_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
F7IT34_BCL2L1-02        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
F7IT34_BCL2L1-01        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
F7IT34_BCL2L1-03        cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5EBP4_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
A0A2K5EBP4_BCL2L1-      cttcaaccgctggttcc-----tgacgg------------gcat-gactg
E2IV75_BCL2L1-01        cttcaaccgctggttcc-----tgacag------------gcat-gactg
M3Z2H9_BCL2L1-01        cttcaaccgctggttcc-----tgacag------------gcat-gactg
M3XA94_BCL2L1-01        cttcaaccgctggttcc-----tgacag------------gcat-gactg
Q76LT7_BCL2L1-01        cttcaaccgctggttcc-----tgacag------------gcat-gactg
Q8SQ42_BCL2L1-01        ctccaaccgctggttcc-----tgacag------------gcat-gactg
A0A087YBW4_BCL2L1-      cttgaacaaatggctgc-----tagtcg------------gtgt-ggctc
M4A558_BCL2L1-01        cttgaacaaatggctgc-----tagttg------------gtgt-ggctc
A0A0F7L1T6_BCL2L1-      cctgagtagatggatgc-----tgggcg------------gatt-ggcgc
H2U5I3_BCL2L1-01        cctgagtagatggatgc-----tgggcg------------gatt-ggcgc
H2U5I3_BCL2L1-02        cctgagtagatggatgc-----tgggcg------------gatt-ggcgc
G3P7B4_BCL2L1-01        gatgagaaggtggctgc-----tcgtcg------------gggt-ggcgc
E6ZFR0_BCL2L1-01        tctgagtagatggctgc-----taattg------------gggt-ggcgc
A0A0B4KJI5_BCL2L1-      tctgagtcggtggctgc-----tggttg------------gagt-ggcgc
D2ITA2_BCL2L1-02        tcacaggagatggatgc-----tggtgg------------gcgc-ggcgc
C1BLI0_BCL2L1-01        cctaagaagatggctgc-----tagtag------------gggc-gatac
A0A286MU87_BCL2L1-      cataattaaatggctgc-----tagttg------------gggt-gattc
C0HAD8_BCL2L1-01        cataattaaatggctgc-----tagttg------------gggt-gattc
Q90Z98_BCL2L1-01        cttcaagaaatggttgt-----ttgcag------------gaat-gacct
Q90Z98_BCL2L1-02        cttcaagaaatggttgt-----ttgcag------------gaat-gacct
H2SNZ8_BCL2L1-02        attcagaaacggactcc-----tggtgg------------ggat-gagcc
H2SNZ8_BCL2L1-01        attcagaaacggactcc-----tggtgg------------ggat-gagcc
H3CH49_BCL2L1-01        attccgaaacgggctgt-----ttctgg------------gcat-gagtc
A0A059PJI5_BCL2L1-      ctttaagaagtggctgc-----tggcag------------gtgt-gacac
B5XAY3_BCL2L1-01        ctttaagaagtggcttc-----tggcag------------ggat-gaccc
W5MG74_BCL2L1-01        cttcaagaagtggctgc-----tggcgg------------gcat-gactc
A0A087X9B7_BCL2L1-      cttcaaaaactggctgc-----tgctgg------------ggat-gagtg
A0A2U9BY16_BCL2L1-      tttcaagaagtggctgc-----tggcag------------ggat-gaccc
A0A0D6DR75_BCL2L1-      tttcaagaagtggctgc-----tggcgg------------ggat-gacgg
I3IZK7_BCL2L1-01        tttcaagaagtggctgc-----tggtgg------------ggat-gacgg
A0A219P0Y3_BCL2L1-      tttcaaaaagtggctgc-----tggcgg------------ggat-gaccc
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        cttcaagaagtggctgc-----tggtgg------------ggat-gaccg

R4JQR8_BCL2L1-01        cgttaagtgc-----------------------ttttctacatagaac--
Q6GLI5_BCL2L1-01        tgactgctgc-----------------------aaccttat-tggtct--
Q2TAP5_BCL2L1-01        tgactggtgt-----------------------tttcgcat-tggtct--
Q91828_BCL2L1-01        tgactggtgt-----------------------tttcgcat-tggtct--
H3ANS8_BCL2L1-01        ttttttcctt-----------------------tcttctgcgtggggtgg
H9GHK7_BCL2L1-01        cga------------------------------agtctgtc-tgaaca--
U3IS71_BCL2L1-01        tggccggagt-----------------------gctcctgc-tgggat--
K7F655_BCL2L1-01        tggccggcgt-----------------------gctcctcc-tgggct--
G1N5N5_BCL2L1-01        tggccggagt-----------------------gcttctgc-tgggat--
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        tggccggagt-----------------------gcttctgc-tgggat--
Q07816_BCL2L1-02        tggccggagt-----------------------gcttctgc-tgggat--
U3JSL7_BCL2L1-01        tggccggagt-----------------------gcttctgc-tgggat--
Q4U2V6_BCL2L1-01        tggccggagt-----------------------gcttctgc-tgggat--
H0Z8G3_BCL2L1-01        tggccggagt-----------------------gcttctgc-tgggat--
F6WA14_BCL2L1-01        tggccggtgt-----------------------agtcctgc-tggggt--
G3WKX6_BCL2L1-01        tggctggtgt-----------------------agtcctgc-tggggt--
W5PSA5_BCL2L1-01        tggccggtat-----------------------ggctctgc-tgggct--
G3SPN0_BCL2L1-01        agtccagtgt----------------------------------------
H0X6V2_BCL2L1-01        taggagttatg----------------------ggttattc-t-------
P53563_BCL2L1-04        tggttgttgaagatatcgattattcagga----gacattcc-tggc-t--
P53563_BCL2L1-02        tggttgttgaagatatcgattattcagga----gacattcc-tggctt--
P53563_BCL2L1-03        tggttgttgaagatatcgattattcagga----gacattcc-tggctt--
P53563_BCL2L1-01        tggctggtgt-----------------------agttctgc-tgggct--
O35843_BCL2L1-01        tgggaggtggaaacagaaggatcggaagttcaaggccctcc-tcagct--
Q64373_BCL2L1-09        tggctggtgt-----------------------ggttctgc-tgggct--
Q64373_BCL2L1-01        tggctggtgt-----------------------ggttctgc-tgggct--
Q64373_BCL2L1-03        ttgcttgtgt-----------------------ctctcttc-tctgtg--
Q64373_BCL2L1-04        ttgcttgtgt-----------------------ctctcttc-tctgtg--
B2Z3Z4_BCL2L1-01        tggctggtgt-----------------------ggttctgc-tgggct--
A0A1U7QU73_BCL2L1-      tggctggtgt-----------------------ggttctgc-tgggct--
Q9MYW4_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
A0A1S3EPX7_BCL2L1-      tggccggtgt-----------------------ggttctgc-tgggct--
O77737_BCL2L1-01        tagctggggt-----------------------ggttctgc-tgggtt--
A0A286Y5D6_BCL2L1-      tggctggcgt-----------------------ggttctgc-tgggct--
G1P9D2_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
Q05KJ0_BCL2L1-01        tggctggtgt-----------------------ggttctgc-tgggct--
Q9MZS7_BCL2L1-01        tggctggtgt-----------------------ggttctgc-tgggct--
A0A1S2ZQT6_BCL2L1-      tggctggctt-----------------------ggttatgc-tgggct--
A0A1L5BWY3_BCL2L1-      tggctggtgt-----------------------ggttctgc-tgggct--
A0A287CZ07_BCL2L1-      tggccggtgt-----------------------ggttctgc-tgggct--
I3MUP5_BCL2L1-03        tggccggcgt-----------------------ggttctgc-tgggct--
I3MUP5_BCL2L1-02        tggccggcgt-----------------------ggttctgc-tgggct--
I3MUP5_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
F6WQI0_BCL2L1-01        tggctggtgt-----------------------ggttctgc-tgggct--
E2IV76_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
A0A2K6G3C5_BCL2L1-      tggctggcgt-----------------------ggttctgc-tgggct--
A0A2K6G3C5_BCL2L1-      tggctggcgt-----------------------ggttctgc-tgggct--
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
Q07817_BCL2L1-03        tggccggcgt-----------------------ggttctgc-tgggct--
Q07817_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
Q07817_BCL2L1-02        tggccggcgt-----------------------ggttctgc-tgggct--
G3RY91_BCL2L1-02        tggccggcgt-----------------------ggttctgc-tgggct--
G3RY91_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5H963_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5H963_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
Q2PFS6_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5M8B1_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5M8B1_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6LPM4_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6QFA2_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5VPG2_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
F6UKR4_BCL2L1-02        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5YR37_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5YR37_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5VPG2_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
F6UKR4_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
A0A0D9RJZ8_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
I7GKS6_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6LPM4_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6QFA2_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6QFA2_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5YR37_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6UWY8_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
E2IV77_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K6UWY8_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
F7IT34_BCL2L1-02        tggccggcgt-----------------------ggttctgc-tgggct--
F7IT34_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
F7IT34_BCL2L1-03        tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5EBP4_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
A0A2K5EBP4_BCL2L1-      tggccggcgt-----------------------ggttctgc-tgggct--
E2IV75_BCL2L1-01        tggccggcgt-----------------------ggttctgc-tgggct--
M3Z2H9_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
M3XA94_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
Q76LT7_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
Q8SQ42_BCL2L1-01        tggctggcgt-----------------------ggttctgc-tgggct--
A0A087YBW4_BCL2L1-      tgctgaccgg-----------------------agctctgc-tcgtca--
M4A558_BCL2L1-01        tgctgaccgg-----------------------agctctgc-tcgtcg--
A0A0F7L1T6_BCL2L1-      tgctgatggg-----------------------agttttgg-tcggcg--
H2U5I3_BCL2L1-01        tgctgatggg-----------------------agttttgg-tcggcg--
H2U5I3_BCL2L1-02        tgctgatggg-----------------------agttttgg-tcggcg--
G3P7B4_BCL2L1-01        tgctaatggg-----------------------agtgctcg-tcggta--
E6ZFR0_BCL2L1-01        tgctaatggg-----------------------agctgtgg-tcgggg--
A0A0B4KJI5_BCL2L1-      tgctaatggg-----------------------agttgtgc-tcggtg--
D2ITA2_BCL2L1-02        tgctgactgg-----------------------ggtgctgc-tcgggg--
C1BLI0_BCL2L1-01        tgcttgcagg-----------------------agtgttgg-tcggct--
A0A286MU87_BCL2L1-      tgctttcagg-----------------------agtgctgg-tcggca--
C0HAD8_BCL2L1-01        tgctttcagg-----------------------agtgctgg-tcggca--
Q90Z98_BCL2L1-01        tgctcacggg-----------------------tgtcgtcg-ttgggg--
Q90Z98_BCL2L1-02        tgctcacggg-----------------------tgtcgtcg-ttgggg--
H2SNZ8_BCL2L1-02        tggcagcagg-----------------------gatcgcaa-tcgggt--
H2SNZ8_BCL2L1-01        tggcagcagg-----------------------gatcgcaa-tcgggt--
H3CH49_BCL2L1-01        tggcggcagg-----------------------gatcgccc-tcggct--
A0A059PJI5_BCL2L1-      tcttcacggg-----------------------ggtggtgg-tgggct--
B5XAY3_BCL2L1-01        tggtcacagg-----------------------agtcgtcg-tagggt--
W5MG74_BCL2L1-01        tggttacggg-----------------------gctggtgg-tgggct--
A0A087X9B7_BCL2L1-      tggtgacggc-----------------------cttcatag-ccgggt--
A0A2U9BY16_BCL2L1-      tggtgaccgg-----------------------ggtcgtgg-tgggct--
A0A0D6DR75_BCL2L1-      tggtgacggg-----------------------cgttgtgg-ctggtg--
I3IZK7_BCL2L1-01        tggtgacggg-----------------------cgttgtgg-ctggtg--
A0A219P0Y3_BCL2L1-      tggtgaccgg-----------------------agttgtgg-tgggct--
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        tggtgaccgg-----------------------ggtggtgg-tgggct--

R4JQR8_BCL2L1-01        ----------------------------------gtga------------
Q6GLI5_BCL2L1-01        ------------cctacctgaggcgtcg------atag------------
Q2TAP5_BCL2L1-01        ------------gctacatgaggcgccg------atag------------
Q91828_BCL2L1-01        ------------gctacatgaggcgccg------atag------------
H3ANS8_BCL2L1-01        aaagaaacctcaaactctttttgcgcaa------atga------------
H9GHK7_BCL2L1-01        ------------cttacattgattga------------------------
U3IS71_BCL2L1-01        ------------ccctgctgagcc-caa------gt--------------
K7F655_BCL2L1-01        ------------cgctgctgagccgcaa------gtag------------
G1N5N5_BCL2L1-01        ------------ccctgctgagccgcaa------gtga------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        ------------ccctgctgagccgcaa------gtga------------
Q07816_BCL2L1-02        ------------ccctgctgagccgcaa------gtga------------
U3JSL7_BCL2L1-01        ------------cgctgctgagccgcaa------gtga------------
Q4U2V6_BCL2L1-01        ------------ccctgctgagccgcaa------gtga------------
H0Z8G3_BCL2L1-01        ------------ccctgctgagccgcaa------gtga------------
F6WA14_BCL2L1-01        ------------ccctattcagccggaa------gtga------------
G3WKX6_BCL2L1-01        ------------ccctgttcagccggaa------gtga------------
W5PSA5_BCL2L1-01        ------------tgctcttcaactgtaa------g---------------
G3SPN0_BCL2L1-01        --------------ttcctcaccctgac------acaa------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        ------------cactttaa------------------------------
P53563_BCL2L1-02        ------------cactttaataccaggg------gttaactttgggaata
P53563_BCL2L1-03        ------------cactttaataccaggg------gttaactttgggaata
P53563_BCL2L1-01        ------------cactcttcagtcggaa------gtga------------
O35843_BCL2L1-01        ------------atta-------------------tag------------
Q64373_BCL2L1-09        ------------cactcttcagtcggaa------gtga------------
Q64373_BCL2L1-01        ------------cactcttcagtcggaa------gtga------------
Q64373_BCL2L1-03        ------------aacatccc---------------taa------------
Q64373_BCL2L1-04        ------------aacatccc---------------taa------------
B2Z3Z4_BCL2L1-01        ------------ctctcttcagtcggaa------gtga------------
A0A1U7QU73_BCL2L1-      ------------ctctcttcagtcggaa------gtga------------
Q9MYW4_BCL2L1-01        ------------ccctcttcagccggaa------atga------------
A0A1S3EPX7_BCL2L1-      ------------cgctcttcagtcggaa------atga------------
O77737_BCL2L1-01        ------------cgctcttcagtcggaa------atga------------
A0A286Y5D6_BCL2L1-      ------------cgctcttcagtcggaa------atga------------
G1P9D2_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
Q05KJ0_BCL2L1-01        ------------cgctcttcagtcggaa------atga------------
Q9MZS7_BCL2L1-01        ------------cgctcttcagtcggaa------atga------------
A0A1S2ZQT6_BCL2L1-      ------------cactcttcagtcgaaa------atga------------
A0A1L5BWY3_BCL2L1-      ------------cgctcttcagtcggaa------atga------------
A0A287CZ07_BCL2L1-      ------------cacttttcagtcggaa------atga------------
I3MUP5_BCL2L1-03        ------------cgcttttcagtcggaa------atga------------
I3MUP5_BCL2L1-02        ------------cgcttttcagtcggaa------atga------------
I3MUP5_BCL2L1-01        ------------cgcttttcagtcggaa------atga------------
F6WQI0_BCL2L1-01        ------------cactcttcagtcggaa------gtga------------
E2IV76_BCL2L1-01        ------------cgcttttcagtcggaa------atga------------
A0A2K6G3C5_BCL2L1-      ------------cgctcttcagtcggaa------atga------------
A0A2K6G3C5_BCL2L1-      ------------cgctcttcagtcggaa------atga------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      ------------cactcttcagtcggaa------atga------------
Q07817_BCL2L1-03        ------------cactcttcagtcggaa------atga------------
Q07817_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
Q07817_BCL2L1-02        ------------cactcttcagtcggaa------atga------------
G3RY91_BCL2L1-02        ------------cactcttcagtcggaa------atga------------
G3RY91_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
A0A2K5H963_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5H963_BCL2L1-      ------------cactcttcagtcggaa------atga------------
Q2PFS6_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
A0A2K5M8B1_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5M8B1_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K6LPM4_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K6QFA2_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5VPG2_BCL2L1-      ------------cactcttcagtcggaa------atga------------
F6UKR4_BCL2L1-02        ------------cactcttcagtcggaa------atga------------
A0A2K5YR37_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5YR37_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5VPG2_BCL2L1-      ------------cactcttcagtcggaa------atga------------
F6UKR4_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
A0A0D9RJZ8_BCL2L1-      ------------cactcttcagtcggaa------atga------------
I7GKS6_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
A0A2K6LPM4_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K6QFA2_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K6QFA2_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K5YR37_BCL2L1-      ------------cactcttcagtcggaa------atga------------
A0A2K6UWY8_BCL2L1-      ------------cactctttagtcggaa------atga------------
E2IV77_BCL2L1-01        ------------cactctttagtcggaa------atga------------
A0A2K6UWY8_BCL2L1-      ------------cactctttagtcggaa------atga------------
F7IT34_BCL2L1-02        ------------cactctttagtcggaa------atga------------
F7IT34_BCL2L1-01        ------------cactctttagtcggaa------atga------------
F7IT34_BCL2L1-03        ------------cactctttagtcggaa------atga------------
A0A2K5EBP4_BCL2L1-      ------------cactctttagtcggaa------atga------------
A0A2K5EBP4_BCL2L1-      ------------cactctttagtcggaa------atga------------
E2IV75_BCL2L1-01        ------------cactctttagtcggaa------atga------------
M3Z2H9_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
M3XA94_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
Q76LT7_BCL2L1-01        ------------cgctcttcagtcggaa------atga------------
Q8SQ42_BCL2L1-01        ------------cactcttcagtcggaa------atga------------
A0A087YBW4_BCL2L1-      ------------tgttcgtcgctaagaaacg---atga------------
M4A558_BCL2L1-01        ------------tgttcgtcgctaagaaacg---atga------------
A0A0F7L1T6_BCL2L1-      ------------ctttcatcgtcaagaaaca---ttga------------
H2U5I3_BCL2L1-01        ------------ctttcatcgtcaagaaaca---ttga------------
H2U5I3_BCL2L1-02        ------------ctttcatcgtcaagaaaca---ttga------------
G3P7B4_BCL2L1-01        ------------tggtcatggtcaagaagcg---gtga------------
E6ZFR0_BCL2L1-01        ------------ttctcattgctaagaaaca---ttga------------
A0A0B4KJI5_BCL2L1-      ------------tcctcatcgctaagaaaca---gtga------------
D2ITA2_BCL2L1-02        ------------ctctgctcgccaagaaacatgtctag------------
C1BLI0_BCL2L1-01        ------------ctctcattgcaaagaaacatcattga------------
A0A286MU87_BCL2L1-      ------------ctctcatcatgaagaaacgccagtga------------
C0HAD8_BCL2L1-01        ------------ctctcatcatgaagaaacgccagtga------------
Q90Z98_BCL2L1-01        ------------gactcattgcacagaaacgcctgtga------------
Q90Z98_BCL2L1-02        ------------gactcattgcacagaaacgcctgtga------------
H2SNZ8_BCL2L1-02        ------------cgttcatagtgaggaaactcctgtga------------
H2SNZ8_BCL2L1-01        ------------cgttcatagtgaggaaactcctgtga------------
H3CH49_BCL2L1-01        ------------ccttcatcgtcatgagg---------------------
A0A059PJI5_BCL2L1-      ------------ccttcatcgctcagaagcgcctgtaa------------
B5XAY3_BCL2L1-01        ------------cactcttcgctcagaaacgcctgtga------------
W5MG74_BCL2L1-01        ------------cctacatcgccaagaaacgcttatag------------
A0A087X9B7_BCL2L1-      ------------ccatcttcgcccagaagcgcctgtga------------
A0A2U9BY16_BCL2L1-      ------------cactgattgcccagaagcgcctgtga------------
A0A0D6DR75_BCL2L1-      ------------ctcttatcgcgcaaaaacgcctgtga------------
I3IZK7_BCL2L1-01        ------------ctcttatcgcgcaaaaacgcctgtga------------
A0A219P0Y3_BCL2L1-      ------------cactcatcgcccagaaacgcctgtga------------
G3NJY1_BCL2L1-01        -------------------cgttcaga----catttga------------
C3VIT1_BCL2L1-01        ------------cgctgttcgcccagaaacgcctgtga------------

R4JQR8_BCL2L1-01        --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        ttgatgaccctgtttttaaggaacctgtatttttcattctggctaccctt
P53563_BCL2L1-03        ttgatgaccctgtttttaaggaacctgtatttttcattctggctaccctt
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------

R4JQR8_BCL2L1-01        --------------------------------------------------
Q6GLI5_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
U3IS71_BCL2L1-01        --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-04        --------------------------------------------------
P53563_BCL2L1-02        gtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaac
P53563_BCL2L1-03        gtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaac
P53563_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-04        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
H2U5I3_BCL2L1-02        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-02        --------------------------------------------------
H2SNZ8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------

R4JQR8_BCL2L1-01        -------------------------------
Q6GLI5_BCL2L1-01        -------------------------------
Q2TAP5_BCL2L1-01        -------------------------------
Q91828_BCL2L1-01        -------------------------------
H3ANS8_BCL2L1-01        -------------------------------
H9GHK7_BCL2L1-01        -------------------------------
U3IS71_BCL2L1-01        -------------------------------
K7F655_BCL2L1-01        -------------------------------
G1N5N5_BCL2L1-01        -------------------------------
Q07816_BCL2L1-03        -------------------------------
Q07816_BCL2L1-01        -------------------------------
Q07816_BCL2L1-02        -------------------------------
U3JSL7_BCL2L1-01        -------------------------------
Q4U2V6_BCL2L1-01        -------------------------------
H0Z8G3_BCL2L1-01        -------------------------------
F6WA14_BCL2L1-01        -------------------------------
G3WKX6_BCL2L1-01        -------------------------------
W5PSA5_BCL2L1-01        -------------------------------
G3SPN0_BCL2L1-01        ----------------tggttcaccacccaa
H0X6V2_BCL2L1-01        -------------------------------
P53563_BCL2L1-04        -------------------------------
P53563_BCL2L1-02        agcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-03        agcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-01        -------------------------------
O35843_BCL2L1-01        -------------------------------
Q64373_BCL2L1-09        -------------------------------
Q64373_BCL2L1-01        -------------------------------
Q64373_BCL2L1-03        -------------------------------
Q64373_BCL2L1-04        -------------------------------
B2Z3Z4_BCL2L1-01        -------------------------------
A0A1U7QU73_BCL2L1-      -------------------------------
Q9MYW4_BCL2L1-01        -------------------------------
A0A1S3EPX7_BCL2L1-      -------------------------------
O77737_BCL2L1-01        -------------------------------
A0A286Y5D6_BCL2L1-      -------------------------------
G1P9D2_BCL2L1-01        -------------------------------
Q05KJ0_BCL2L1-01        -------------------------------
Q9MZS7_BCL2L1-01        -------------------------------
A0A1S2ZQT6_BCL2L1-      -------------------------------
A0A1L5BWY3_BCL2L1-      -------------------------------
A0A287CZ07_BCL2L1-      -------------------------------
I3MUP5_BCL2L1-03        -------------------------------
I3MUP5_BCL2L1-02        -------------------------------
I3MUP5_BCL2L1-01        -------------------------------
F6WQI0_BCL2L1-01        -------------------------------
E2IV76_BCL2L1-01        -------------------------------
A0A2K6G3C5_BCL2L1-      -------------------------------
A0A2K6G3C5_BCL2L1-      -------------------------------
G1RER8_BCL2L1-01        -------------------------------
A0A2J8VIH3_BCL2L1-      -------------------------------
Q07817_BCL2L1-03        -------------------------------
Q07817_BCL2L1-01        -------------------------------
Q07817_BCL2L1-02        -------------------------------
G3RY91_BCL2L1-02        -------------------------------
G3RY91_BCL2L1-01        -------------------------------
A0A2K5H963_BCL2L1-      -------------------------------
A0A2K5H963_BCL2L1-      -------------------------------
Q2PFS6_BCL2L1-01        -------------------------------
A0A2K5M8B1_BCL2L1-      -------------------------------
A0A2K5M8B1_BCL2L1-      -------------------------------
A0A2K6LPM4_BCL2L1-      -------------------------------
A0A2K6QFA2_BCL2L1-      -------------------------------
A0A2K5VPG2_BCL2L1-      -------------------------------
F6UKR4_BCL2L1-02        -------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------
A0A2K5VPG2_BCL2L1-      -------------------------------
F6UKR4_BCL2L1-01        -------------------------------
A0A0D9RJZ8_BCL2L1-      -------------------------------
I7GKS6_BCL2L1-01        -------------------------------
A0A2K6LPM4_BCL2L1-      -------------------------------
A0A2K6QFA2_BCL2L1-      -------------------------------
A0A2K6QFA2_BCL2L1-      -------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------
A0A2K6UWY8_BCL2L1-      -------------------------------
E2IV77_BCL2L1-01        -------------------------------
A0A2K6UWY8_BCL2L1-      -------------------------------
F7IT34_BCL2L1-02        -------------------------------
F7IT34_BCL2L1-01        -------------------------------
F7IT34_BCL2L1-03        -------------------------------
A0A2K5EBP4_BCL2L1-      -------------------------------
A0A2K5EBP4_BCL2L1-      -------------------------------
E2IV75_BCL2L1-01        -------------------------------
M3Z2H9_BCL2L1-01        -------------------------------
M3XA94_BCL2L1-01        -------------------------------
Q76LT7_BCL2L1-01        -------------------------------
Q8SQ42_BCL2L1-01        -------------------------------
A0A087YBW4_BCL2L1-      -------------------------------
M4A558_BCL2L1-01        -------------------------------
A0A0F7L1T6_BCL2L1-      -------------------------------
H2U5I3_BCL2L1-01        -------------------------------
H2U5I3_BCL2L1-02        -------------------------------
G3P7B4_BCL2L1-01        -------------------------------
E6ZFR0_BCL2L1-01        -------------------------------
A0A0B4KJI5_BCL2L1-      -------------------------------
D2ITA2_BCL2L1-02        -------------------------------
C1BLI0_BCL2L1-01        -------------------------------
A0A286MU87_BCL2L1-      -------------------------------
C0HAD8_BCL2L1-01        -------------------------------
Q90Z98_BCL2L1-01        -------------------------------
Q90Z98_BCL2L1-02        -------------------------------
H2SNZ8_BCL2L1-02        -------------------------------
H2SNZ8_BCL2L1-01        -------------------------------
H3CH49_BCL2L1-01        -------------------------------
A0A059PJI5_BCL2L1-      -------------------------------
B5XAY3_BCL2L1-01        -------------------------------
W5MG74_BCL2L1-01        -------------------------------
A0A087X9B7_BCL2L1-      -------------------------------
A0A2U9BY16_BCL2L1-      -------------------------------
A0A0D6DR75_BCL2L1-      -------------------------------
I3IZK7_BCL2L1-01        -------------------------------
A0A219P0Y3_BCL2L1-      -------------------------------
G3NJY1_BCL2L1-01        -------------------------------
C3VIT1_BCL2L1-01        -------------------------------

© 1998-2019