Dataset for CDS BCL2A1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

77 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

K7G130_BCL2A1-01        --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      atgggtcacatcctgctcagcgccactgctggcagtctcgatctgcgcga
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
G1T1L8_BCL2A1-01        ---------atgttcgcctcccagggcttcggaagcttccagaagaagca
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------

K7G130_BCL2A1-01        -------------------------------atggaaagttctgagttcc
Q9W6F2_BCL2A1-01        -------------------------------atggaaactgctgagttct
G1N8C5_BCL2A1-01        -------------------------------atggaaactgctgagttct
U3JTB2_BCL2A1-01        -------------------------------atggaaactgctgagttct
H0ZCL9_BCL2A1-01        -------------------------------atggaaactgctgagttct
F6S8G3_BCL2A1-01        -------------------------------atggacgacggtgtattct
F6SFL4_BCL2A1-01        -------------------------------atggatgattacgagttcc
G3WSP8_BCL2A1-01        -------------------------------atggctgattgtgaattcc
A0A286XUI2_BCL2A1-      gccagcagcaggctgctgtctgccgcccaggatgattgacctggagttca
A0A337STN9_BCL2A1-      -------------------------------atggccgacggcgagtttg
A0A337STN9_BCL2A1-      -------------------------------atggccgacggcgagtttg
E2RS00_BCL2A1-01        -------------------------------atgacggactgcgagtttg
M3YVH4_BCL2A1-01        -------------------------------atgacagacagtgagttcg
G1T1L8_BCL2A1-01        gtcaccggctctgctctccgagcagcagaagatgagtgactgcgagtttg
G3V977_BCL2A1-01        -------------------------------atgacagactgtgagttca
Q925A9_BCL2A1-01        -------------------------------atgacagactgtgagttca
O55178_BCL2A1-01        -------------------------------atggctgagtacgagctca
Q0P538_BCL2A1-01        -------------------------------atggctgagtacgagctca
Q07440_BCL2A1-01        -------------------------------atggctgagtctgagctca
O55179_BCL2A1-01        -------------------------------atgtctgagtacgagttca
Q8K164_BCL2A1-01        -------------------------------atggctgagtacgagttca
Q4FK02_BCL2A1-01        -------------------------------atgtctgagtacgagttca
O55177_BCL2A1-02        -------------------------------atggctgagtacgagttca
Q497M6_BCL2A1-01        -------------------------------atggctgagtacgagttca
A0A2K6EKG1_BCL2A1-      -------------------------------atgactgactgtgagtttg
I3MCZ7_BCL2A1-01        -------------------------------atgaatgactgtgagttca
Q3C2I0_BCL2A1-01        -------------------------------atgactgacactgagtttg
W5Q0N6_BCL2A1-01        -------------------------------atgactgacactgagtttg
G3T8E6_BCL2A1-01        -------------------------------atgactgactgtgagtttg
F7CP56_BCL2A1-01        -------------------------------atgaccgactgtgagtttg
C7F841_BCL2A1-02        -------------------------------atgactgacgacgagtttg
C7F841_BCL2A1-01        -------------------------------atgactgacgacgagtttg
H0WZ23_BCL2A1-01        -------------------------------atgactgactgtgagtttg
U3DBA0_BCL2A1-02        -------------------------------atgacagactctgaatttg
U3DBA0_BCL2A1-01        -------------------------------atgacagactctgaatttg
A0A2K6TLM0_BCL2A1-      -------------------------------atgacagaccacgaatttg
A0A2K6TLM0_BCL2A1-      -------------------------------atgacagaccacgaatttg
A0A2K6TLM0_BCL2A1-      -------------------------------atgacagaccacgaatttg
A0A2K5D2I1_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5D2I1_BCL2A1-      -------------------------------atgacagactgtgaatttg
H2NNZ9_BCL2A1-01        -------------------------------atgacagactgtgaatttg
A0A2I3T6T8_BCL2A1-      -------------------------------gtggc-----gcgatcttg
A0A2I3HNF3_BCL2A1-      -------------------------------atgacagactgcgaatttg
A0A2I3HNF3_BCL2A1-      -------------------------------atgacagactgcgaatttg
A0A2I3HNF3_BCL2A1-      -------------------------------atgacagactgcgaatttg
A0A2K5KAB6_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6AD55_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A0D9RRC3_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6LV22_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6PHG5_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5KHH9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A096NMX5_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6DS80_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5KHH9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5TMD8_BCL2A1-      -------------------------------atgacagactgtgaatttg
F7E8V5_BCL2A1-01        -------------------------------atgacagactgtgaatttg
A0A2K5KAB6_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6LV22_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6PHG5_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6AD55_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A096NMX5_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5KHH9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K5TMD8_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2K6DS80_BCL2A1-      -------------------------------atgacagactgtgaatttg
F7E8V5_BCL2A1-02        -------------------------------atgacagactgtgaatttg
B4E1X9_BCL2A1-01        -------------------------------atgacagactgtgaatttg
A0A2R8ZJX9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2I3T6T8_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2R8ZJX9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2I3T6T8_BCL2A1-      -------------------------------atgacagactgtgaatttg
Q16548_BCL2A1-01        -------------------------------atgacagactgtgaatttg
A0A2I2YML2_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2I2YML2_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2R8ZJX9_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2I3T6T8_BCL2A1-      -------------------------------atgacagactgtgaatttg
A0A2I2YML2_BCL2A1-      -------------------------------atgacagactgtgaatttg
Q16548_BCL2A1-02        -------------------------------atgacagactgtgaatttg
                                                        **         *   *  

K7G130_BCL2A1-01        gctatgtttactatttagtccaggattatctgaaatacattcttcaggaa
Q9W6F2_BCL2A1-01        attacgtttattatttagctcaagattatctgcagtatgtgcttcaggaa
G1N8C5_BCL2A1-01        attatgtttattatttagctcaagattatctgcaatatgtccttcaggaa
U3JTB2_BCL2A1-01        attacgtttattacttagcccaggattatctgcagtatgtgctccaggaa
H0ZCL9_BCL2A1-01        attacgtttattacttagcccaggattatctgcagtatgtgctccaggaa
F6S8G3_BCL2A1-01        ggtccgtccgagccctggctctggactatctggatgacgtcctccagacg
F6SFL4_BCL2A1-01        attatgttcacatgttagctcgggactacttgaagcatgttcaacagaca
G3WSP8_BCL2A1-01        attatgttcacatgctagcccaggactacttgaagcatgttcaacaaatg
A0A286XUI2_BCL2A1-      ggtacacgcaggctctggcccaggactacctgctccacgtcctgcaggtg
A0A337STN9_BCL2A1-      ggtacgttctcacgctggcccgggactatacggagcacgttctgcagggg
A0A337STN9_BCL2A1-      ggtacgttctcacgctggcccgggactatacggagcacgttctgcagggg
E2RS00_BCL2A1-01        gctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatc
M3YVH4_BCL2A1-01        ggtacacgctgtcgctggcccaggactacgtgaggcatgtcctgcagatc
G1T1L8_BCL2A1-01        gctatgtgcacacactggctcaggactatctgctgtacatcctgaagacg
G3V977_BCL2A1-01        tgtatatccactccctggctgagaactatcttcagtatgtcctgcaggta
Q925A9_BCL2A1-01        tgtatatccactccctggctgagaactatcttcagtatgtcctgcaggta
O55178_BCL2A1-01        tgcatatccactccctggctgagcactaccttcagtatgtgctacaggta
Q0P538_BCL2A1-01        tgcatatccactccctggctgagcactaccttcagtatgtgctacaggta
Q07440_BCL2A1-01        tgcatatccactccctggctgagcactaccttcagtatgtgctacaggta
O55179_BCL2A1-01        tgtatatccactccctggctgagcactaccttcagtatgtgctacaggta
Q8K164_BCL2A1-01        tgtatatccactccctggctgagcactatcttcagtatgtgctacaggta
Q4FK02_BCL2A1-01        tgtatatccactccctggctgagcactatcttcagtatgtgctacaggta
O55177_BCL2A1-02        tgtatatccactccctggctgagcactatcttcagtatgtgctacaggta
Q497M6_BCL2A1-01        tgtatatccactccctggctgagcactatcttcagtatgtgctacaggta
A0A2K6EKG1_BCL2A1-      gatacacccacaggctggtccaggactacctgcagtacgtcctgcgggtt
I3MCZ7_BCL2A1-01        ggttcatccacacgctggctcaggactacctgcagcacgtcctgcaggta
Q3C2I0_BCL2A1-01        gctacgttcacgggctggctgaggactatctgaaatatgtgttgcagata
W5Q0N6_BCL2A1-01        actacgttcacaagctggctgaggactatctgaaatatgtgttgcagata
G3T8E6_BCL2A1-01        gatacatttacaagctggtccaggactatctgaagtacgtcctgcagata
F7CP56_BCL2A1-01        gatatattcacatgctggcccaggactacctgaagtacgtcctgcagata
C7F841_BCL2A1-02        gatatattcacatgctggcccaggactatctgaagtatgtcctgcagata
C7F841_BCL2A1-01        gatatattcacatgctggcccaggactatctgaagtatgtcctgcagata
H0WZ23_BCL2A1-01        gatacattcacaggctggctcaggactatctgcagtatgtcctgcaaata
U3DBA0_BCL2A1-02        gatatattcacaatctaactcaggactatctgcagtacgtcctgcagata
U3DBA0_BCL2A1-01        gatatattcacaatctaactcaggactatctgcagtacgtcctgcagata
A0A2K6TLM0_BCL2A1-      gatatattcacaatctaactcaggactatctgcggtatgtcctgcagata
A0A2K6TLM0_BCL2A1-      gatatattcacaatctaactcaggactatctgcggtatgtcctgcagata
A0A2K6TLM0_BCL2A1-      gatatattcacaatctaactcaggactatctgcggtatgtcctgcagata
A0A2K5D2I1_BCL2A1-      gatatattcacaatctaactcaggactatctgcggtacgtcctgcagata
A0A2K5D2I1_BCL2A1-      gatatattcacaatctaactcaggactatctgcggtacgtcctgcagata
H2NNZ9_BCL2A1-01        ggtatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2I3T6T8_BCL2A1-      gct---------------------------------------------ca
A0A2I3HNF3_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2I3HNF3_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2I3HNF3_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2K5KAB6_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6AD55_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtatgttctgcagata
A0A0D9RRC3_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6LV22_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6PHG5_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K5KHH9_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A096NMX5_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K6DS80_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K5KHH9_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K5TMD8_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
F7E8V5_BCL2A1-01        gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K5KAB6_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6LV22_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6PHG5_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgtcctgcagata
A0A2K6AD55_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtatgttctgcagata
A0A096NMX5_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K5KHH9_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K5TMD8_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
A0A2K6DS80_BCL2A1-      gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
F7E8V5_BCL2A1-02        gatatatttacaggctagctcaggactatttgcagtacgttctgcagata
B4E1X9_BCL2A1-01        gatatatttacaggctggctcaggactatctgcagtgcgtcctacagata
A0A2R8ZJX9_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
A0A2I3T6T8_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
A0A2R8ZJX9_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
A0A2I3T6T8_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
Q16548_BCL2A1-01        gatatatttacaggctggctcaggactatctgcagtgcgtcctacagata
A0A2I2YML2_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2I2YML2_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
A0A2R8ZJX9_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
A0A2I3T6T8_BCL2A1-      gatatatttacaggctggctcaggactatctgcagtacgtcctacagata
A0A2I2YML2_BCL2A1-      gatatatttacaggctagctcaggactatctgcagtacgtcctacagata
Q16548_BCL2A1-02        gatatatttacaggctggctcaggactatctgcagtgcgtcctacagata

K7G130_BCL2A1-01        cctgagcttggaccagccccaagcagagttgctcatgtcttaagaaattc
Q9W6F2_BCL2A1-01        tcacatctcggaccagcccaaaccagagttgctcatgtcttgcgaaacat
G1N8C5_BCL2A1-01        tcacgtcttggaccagcccaaaccagagttgctcatgtcttgcgaaatat
U3JTB2_BCL2A1-01        tcacacctcggaccagcccagaccagggttgcccatgtcctgcgaaccat
H0ZCL9_BCL2A1-01        tcacacctcggaccagcccagacccgggttgctcatgtcctgagaaccat
F6S8G3_BCL2A1-01        ccgcgacttgggacggtcccaagcagaacttctcgggcgctgcaaaacgt
F6SFL4_BCL2A1-01        ccaccactgggatcatgtctaaataagacatctcaaatactacaaaaggt
G3WSP8_BCL2A1-01        ccacgactgggatcatgtctacataggacatctcaaatacttcaaaaagt
A0A286XUI2_BCL2A1-      cctcagtgcgagaccagccccagcaaggcatccaaggtgctgcaggacat
A0A337STN9_BCL2A1-      ccccagcccgggtcccacccaagcagagtatcccaagtgctacaagacgt
A0A337STN9_BCL2A1-      ccccagcccgggtcccacccaagcagagtatcccaagtgctacaagacgt
E2RS00_BCL2A1-01        ccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgt
M3YVH4_BCL2A1-01        ccgcagcccagcccggccgccagcagagtgtcccgggtcctgcgggacgt
G1T1L8_BCL2A1-01        ccacagcctggactgggaccgagcaaaacgtccagggtgctgcagaacgt
G3V977_BCL2A1-01        cctgcctttgaatcggctccaagcaaaacgtccagagtgctacagagagt
Q925A9_BCL2A1-01        cctgcctttgaatcggctccaagcaaaacgtccagagtgctacagagagt
O55178_BCL2A1-01        cccgcctttgagtcggctccaagccaagcattcagagtgctacaaagagt
Q0P538_BCL2A1-01        cccgcctttgagtcggctccaagccaagcattcagagtgctacaaagagt
Q07440_BCL2A1-01        cccgcctttgagtcggctccaagccaagcatgcagagtgctacaaagagt
O55179_BCL2A1-01        cccgcctttgagtcggctccaagccaagcatgcagagtgctacaaagagt
Q8K164_BCL2A1-01        cccgcctttgagtcggctccaagccaagcatgcagagtgctacaaagagt
Q4FK02_BCL2A1-01        cccgcctttgagtcggctccaagcaaagcatgcagagtgctacaaagagt
O55177_BCL2A1-02        cccgcctttgagtcggctccaagccaagcatgcagagtgctacaaagagt
Q497M6_BCL2A1-01        cccgcctttgagtcggctccaagcaaagcatgcagagtgctacaaagagt
A0A2K6EKG1_BCL2A1-      ccgcagcccgggtccggtccgagcaagacgtccagagtgctgcaaaacat
I3MCZ7_BCL2A1-01        ccgcaacgtgggtcaagccccagcaaaacgtccaaagtgttacaaaacgt
Q3C2I0_BCL2A1-01        cagcaacctggatccaagccaagcaaaacatccagggtgttacaagatgt
W5Q0N6_BCL2A1-01        cagcaacctggatccaagccaagcaaaacatccagggtgttacaagacgt
G3T8E6_BCL2A1-01        ccacaacctgcagctggttcaagcaaaacgtccagagtgttacaaaatgt
F7CP56_BCL2A1-01        ccacaacctggatctggtccaagcaaaacatccagagtgttacaagacat
C7F841_BCL2A1-02        ccacaacctggatctggtccaagcaaaacatctagagtgttacgagacgt
C7F841_BCL2A1-01        ccacaacctggatctggtccaagcaaaacatctagagtgttacgagacgt
H0WZ23_BCL2A1-01        cagcaatgtggatcaggtccaagcaaaacgtccagagtgctgcaaaatgt
U3DBA0_BCL2A1-02        ccacagtctggaatgggtccgagcaaaacgtctagagtgctacaacaggt
U3DBA0_BCL2A1-01        ccacagtctggaatgggtccgagcaaaacgtctagagtgctacaacaggt
A0A2K6TLM0_BCL2A1-      ccacaatctggaacgggtccaagcaaaacgtccagagtactacaaaaggt
A0A2K6TLM0_BCL2A1-      ccacaatctggaacgggtccaagcaaaacgtccagagtactacaaaaggt
A0A2K6TLM0_BCL2A1-      ccacaatctggaacgggtccaagcaaaacgtccagagtactacaaaaggt
A0A2K5D2I1_BCL2A1-      ccacaatctggaacgggtccaagcaaaacgtccagggtgctacaaaaggt
A0A2K5D2I1_BCL2A1-      ccacaatctggaacgggtccaagcaaaacgtccagggtgctacaaaaggt
H2NNZ9_BCL2A1-01        ccacaacctggatcaggtccaagcaaagcgtccagagtactacaaaaggt
A0A2I3T6T8_BCL2A1-      ctgcagcctcg---------------------------------------
A0A2I3HNF3_BCL2A1-      ccacagcctggatcaggtccaagcaaaacgtccagagtgctacaaaacgt
A0A2I3HNF3_BCL2A1-      ccacagcctggatcaggtccaagcaaaacgtccagagtgctacaaaacgt
A0A2I3HNF3_BCL2A1-      ccacagcctggatcaggtccaagcaaaacgtccagagtgctacaaaacgt
A0A2K5KAB6_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6AD55_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A0D9RRC3_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6LV22_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6PHG5_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5KHH9_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A096NMX5_BCL2A1-      ccacaacctggattgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6DS80_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5KHH9_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5TMD8_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
F7E8V5_BCL2A1-01        ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5KAB6_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6LV22_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6PHG5_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6AD55_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A096NMX5_BCL2A1-      ccacaacctggattgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5KHH9_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K5TMD8_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2K6DS80_BCL2A1-      ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
F7E8V5_BCL2A1-02        ccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaaggt
B4E1X9_BCL2A1-01        ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt
A0A2R8ZJX9_BCL2A1-      ccacaacctggatcaggtccaagccaaacgtccagagtgctacaaaatgt
A0A2I3T6T8_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt
A0A2R8ZJX9_BCL2A1-      ccacaacctggatcaggtccaagccaaacgtccagagtgctacaaaatgt
A0A2I3T6T8_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt
Q16548_BCL2A1-01        ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt
A0A2I2YML2_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2I2YML2_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaaggt
A0A2R8ZJX9_BCL2A1-      ccacaacctggatcaggtccaagccaaacgtccagagtgctacaaaatgt
A0A2I3T6T8_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt
A0A2I2YML2_BCL2A1-      ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaaggt
Q16548_BCL2A1-02        ccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgt

K7G130_BCL2A1-01        tgcatcttttcttcaaaaagaaaacgaagagatactgaaaccatgtttgg
Q9W6F2_BCL2A1-01        tgcatcttcactccaagatcagacagaggaggctctcagacccttcttgg
G1N8C5_BCL2A1-01        tgcatcctcactccaagatcagacagaggaggcactcagacccttcttgg
U3JTB2_BCL2A1-01        ggcatcttccctgcaagaccaaaccgaggaggctctcaggccactcctgg
H0ZCL9_BCL2A1-01        ggcatcctctctgcaagaccaaacggaggaggctgtcaggccgctcctgg
F6S8G3_BCL2A1-01        catgttctcggtccagggggacgtggagaaggctctgaagccgtgcttcg
F6SFL4_BCL2A1-01        tgctttctctgtccaacaagaagtagaaaaggatatggaaacatgcttga
G3WSP8_BCL2A1-01        tgctttctctgtccaagaagaagttgaaaaggatatggaaacattcttga
A0A286XUI2_BCL2A1-      ggccctttccgtccaggaagaggtggagaggcggctgaaaccgtggctgg
A0A337STN9_BCL2A1-      ggccttctcggtccagggggaggtcgagaagaagttgaagccgtgcctgg
A0A337STN9_BCL2A1-      ggccttctcggtccagggggaggtcgagaagaagttgaagccgtgcctgg
E2RS00_BCL2A1-01        ggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgcttgg
M3YVH4_BCL2A1-01        ggcctcctccgtgcagggggaggtggaacagaacttgagaccatgcttgg
G1T1L8_BCL2A1-01        caccttctccatccagcaagaagtggaagaggctctgcaaccgtacctgc
G3V977_BCL2A1-01        tgctttctctgtacaaaaggaagttgaaaagaatctgaagccatacttgg
Q925A9_BCL2A1-01        tgctttctctgtacaaaaggaagttgaaaagaatctgaagccatacttgg
O55178_BCL2A1-01        tgctttctccgttcagaaggaagttggaaagaacctaaagtcatacttgg
Q0P538_BCL2A1-01        tgctttctccgttcagaaggaagttggaaagaacctaaagtcatacttgg
Q07440_BCL2A1-01        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
O55179_BCL2A1-01        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
Q8K164_BCL2A1-01        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
Q4FK02_BCL2A1-01        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
O55177_BCL2A1-02        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
Q497M6_BCL2A1-01        tgctttctccgttcagaaggaagttgaaaagaatctgaagtcatacttgg
A0A2K6EKG1_BCL2A1-      tgccttctccgtccaaaacgaagtcgaaaagaatctgaaagcatgcttgg
I3MCZ7_BCL2A1-01        ggctttctcagtccaaaaagaagttgaaaagaatctgaaaccattcttgg
Q3C2I0_BCL2A1-01        ggcttcctctgtccaggacgaagtggaaaggactctgaagcagtgcttgg
W5Q0N6_BCL2A1-01        ggcttcctctgtccaggacgaagtggaaaggactctgaagcagtgcttgg
G3T8E6_BCL2A1-01        ggctttctcagttcaaaaagaagttgaaaagaatttgaaaccctgcttgg
F7CP56_BCL2A1-01        tgctttctcagttcaaaatgaagtagagaagaatttgaaaccatgcttgg
C7F841_BCL2A1-02        ggctttctccgtccaaaacgaagttgaaaagaatttgaaaccatgcttgg
C7F841_BCL2A1-01        ggctttctccgtccaaaacgaagttgaaaagaatttgaaaccatgcttgg
H0WZ23_BCL2A1-01        tgcattttcagtccaagaagaggttgaaaagagtctgaaaccatgcttag
U3DBA0_BCL2A1-02        tgcattctcagtccaaaaagaagtggaaaagagtctgaagtcatgcttgg
U3DBA0_BCL2A1-01        tgcattctcagtccaaaaagaagtggaaaagagtctgaagtcatgcttgg
A0A2K6TLM0_BCL2A1-      tgcattctcagtccaaaaggaagtggaagagagtctgaagccatgcttgg
A0A2K6TLM0_BCL2A1-      tgcattctcagtccaaaaggaagtggaagagagtctgaagccatgcttgg
A0A2K6TLM0_BCL2A1-      tgcattctcagtccaaaaggaagtggaagagagtctgaagccatgcttgg
A0A2K5D2I1_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagagtctgaagccatgcttgg
A0A2K5D2I1_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagagtctgaagccatgcttgg
H2NNZ9_BCL2A1-01        tgcgttctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagccgtgcttgg
A0A2I3HNF3_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagccgtgcttgg
A0A2I3HNF3_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagccgtgcttgg
A0A2K5KAB6_BCL2A1-      tgcattctcagtccaggaagaagtggaaaagaatctgaagccgtgcttgg
A0A2K6AD55_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A0D9RRC3_BCL2A1-      tgcatcctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6LV22_BCL2A1-      tgcattctcagtccagaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6PHG5_BCL2A1-      tgcattctcagtccagaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5KHH9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A096NMX5_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6DS80_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5KHH9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5TMD8_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
F7E8V5_BCL2A1-01        tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5KAB6_BCL2A1-      tgcattctcagtccaggaagaagtggaaaagaatctgaagccgtgcttgg
A0A2K6LV22_BCL2A1-      tgcattctcagtccagaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6PHG5_BCL2A1-      tgcattctcagtccagaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6AD55_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A096NMX5_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5KHH9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K5TMD8_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
A0A2K6DS80_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
F7E8V5_BCL2A1-02        tgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgcttgg
B4E1X9_BCL2A1-01        tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2R8ZJX9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I3T6T8_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2R8ZJX9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I3T6T8_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
Q16548_BCL2A1-01        tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I2YML2_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I2YML2_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2R8ZJX9_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I3T6T8_BCL2A1-      tgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
A0A2I2YML2_BCL2A1-      tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg
Q16548_BCL2A1-02        tgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttgg

K7G130_BCL2A1-01        acacacttgatattacctctgtagatgctgccagaagaattttcattcaa
Q9W6F2_BCL2A1-01        acaggatcgatattacctccgtagatgttgccaagagaattttcaatgga
G1N8C5_BCL2A1-01        acaggatcgatatcacctctgtagatgttgccaagagaattttcaatgga
U3JTB2_BCL2A1-01        acaggattgacatcacctcagtagctgttgccaagagaattttcaatgga
H0ZCL9_BCL2A1-01        acaggattgacatcacctctgtagcggctgccaagagaattttcaatgga
F6S8G3_BCL2A1-01        acagtctcgacgttggctcggtaggggcagccagaagaatcttcggccaa
F6SFL4_BCL2A1-01        gcactttggacatcgtttctgtagagtctgccagaagaattttcaatagt
G3WSP8_BCL2A1-01        gcactttggacattacttctgtagattgtgccagaagaattttcaacagt
A0A286XUI2_BCL2A1-      acagaattgacgtggagtccatcgacactgcgaagtcgatattcaaccaa
A0A337STN9_BCL2A1-      acaagttccatgtggtgtcggtagacacggccaggacgatattccaccaa
A0A337STN9_BCL2A1-      acaagttccatgtggtgtcggtagacacggccaggacgatattccaccaa
E2RS00_BCL2A1-01        acagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcag
M3YVH4_BCL2A1-01        acagctttgatgtggggtccatcgacactgccagaaccatcttcaatcaa
G1T1L8_BCL2A1-01        acaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaa
G3V977_BCL2A1-01        atgactttcacgtggaatccatagatactgccagaataatattcaaccaa
Q925A9_BCL2A1-01        atgactttcacgtggaatccatagatactgccagaataatattcaaccaa
O55178_BCL2A1-01        atgactttcacgtggaatccatagataccaccagaataatattcaaccaa
Q0P538_BCL2A1-01        atgactttcacgtggaatccatagataccaccagaataatattcaaccaa
Q07440_BCL2A1-01        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
O55179_BCL2A1-01        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
Q8K164_BCL2A1-01        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
Q4FK02_BCL2A1-01        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
O55177_BCL2A1-02        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
Q497M6_BCL2A1-01        atgactttcacgtggaatccatagataccgccagaataatattcaaccaa
A0A2K6EKG1_BCL2A1-      acaatgttaatgtggcgtccatagatgccgccagaacgatattcaatcaa
I3MCZ7_BCL2A1-01        acaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaa
Q3C2I0_BCL2A1-01        ataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaa
W5Q0N6_BCL2A1-01        ataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaa
G3T8E6_BCL2A1-01        acaattttgttgtcatctccattgataccgcccaaacaatattcaagcaa
F7CP56_BCL2A1-01        acaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaa
C7F841_BCL2A1-02        acaattttgatgttgtgtccatagacactgccagaataatattcaatcaa
C7F841_BCL2A1-01        acaattttgatgttgtgtccatagacactgccagaataatattcaatcaa
H0WZ23_BCL2A1-01        acaattttaatgttgtatccatagatactgccagaacaatattcaatcaa
U3DBA0_BCL2A1-02        acaatgttgatattgcgtccatagataatgccagaacgatattcagtcaa
U3DBA0_BCL2A1-01        acaatgttgatattgcgtccatagataatgccagaacgatattcagtcaa
A0A2K6TLM0_BCL2A1-      acaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaa
A0A2K6TLM0_BCL2A1-      acaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaa
A0A2K6TLM0_BCL2A1-      acaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaa
A0A2K5D2I1_BCL2A1-      acaatgttaatattgtgtccatagataatgccagaatgatattcagtcaa
A0A2K5D2I1_BCL2A1-      acaatgttaatattgtgtccatagataatgccagaatgatattcagtcaa
H2NNZ9_BCL2A1-01        acaacgttaatgttgtgtccgtagacactgccagaacactattcaaccaa
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactattcaaccaa
A0A2I3HNF3_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactattcaaccaa
A0A2I3HNF3_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactattcaaccaa
A0A2K5KAB6_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacaatattcaatcaa
A0A2K6AD55_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A0D9RRC3_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6LV22_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6PHG5_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5KHH9_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A096NMX5_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6DS80_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5KHH9_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5TMD8_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
F7E8V5_BCL2A1-01        acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5KAB6_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacaatattcaatcaa
A0A2K6LV22_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6PHG5_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6AD55_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A096NMX5_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5KHH9_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K5TMD8_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
A0A2K6DS80_BCL2A1-      acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
F7E8V5_BCL2A1-02        acaatgttaatgttgcatccatagacactgccagaacactattcaatcaa
B4E1X9_BCL2A1-01        acaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaa
A0A2R8ZJX9_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
A0A2I3T6T8_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
A0A2R8ZJX9_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
A0A2I3T6T8_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
Q16548_BCL2A1-01        acaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaa
A0A2I2YML2_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaa
A0A2I2YML2_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaa
A0A2R8ZJX9_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
A0A2I3T6T8_BCL2A1-      acaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaa
A0A2I2YML2_BCL2A1-      acaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaa
Q16548_BCL2A1-02        acaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaa

K7G130_BCL2A1-01        gtcatggataaagaatttgatgatggaaacactaactgggggcggatttt
Q9W6F2_BCL2A1-01        gtcatggaagaaaaatttgctgatggaaatactaactggggacgaattat
G1N8C5_BCL2A1-01        gtcatggaagaaaaatttgctgacggaaatactaactggggacgaattat
U3JTB2_BCL2A1-01        gtcatggatgaaaagtttgctgatggaaatactaactggggacgaattat
H0ZCL9_BCL2A1-01        gtcatggatgaaaagtttgctgatggaaatactaactggggacgaatcat
F6S8G3_BCL2A1-01        attgtggaaaaggagttcgaggacggcatcgtcaactgggggcggattgt
F6SFL4_BCL2A1-01        gttatgaagaaggaatttgaggatggcgtcattaactggggacggattgt
G3WSP8_BCL2A1-01        gttatggaaaaggaatttgaggatggcatcatcaactggggacggattgt
A0A286XUI2_BCL2A1-      gtgatggagaaggagttcgaggatggcatcattaactggggacggattgt
A0A337STN9_BCL2A1-      gtgatggaaaaggaatttgaagacggcatcattaactggggcaggattgt
A0A337STN9_BCL2A1-      gtgatggaaaaggaatttgaagacggcatcattaactggggcaggattgt
E2RS00_BCL2A1-01        gtgatggagaaggaatttgaagacggcgtcattaactggggaaggatcgt
M3YVH4_BCL2A1-01        gtcatggaaaaggaatttgaagacggcatcattaactgggggaggattgt
G1T1L8_BCL2A1-01        gtgatggagaaagagtttgaggatggtgtgatcaactggggcaggattgt
G3V977_BCL2A1-01        gtgatggaaaaagaatttgaagatggcatcattaactggggaaggattgt
Q925A9_BCL2A1-01        gtgatggaaaaagaatttgaagatggcatcattaactggggaaggattgt
O55178_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaattggggaaggattgt
Q0P538_BCL2A1-01        gtgatggaaaaagagtttgaaaatggcatcattaattggggaaggattgt
Q07440_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
O55179_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
Q8K164_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
Q4FK02_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
O55177_BCL2A1-02        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
Q497M6_BCL2A1-01        gtgatggaaaaagagtttgaagatggcatcattaactggggaaggattgt
A0A2K6EKG1_BCL2A1-      gtgatggaaaaggaatttgaagatggcatcgttaactggggaaggattgt
I3MCZ7_BCL2A1-01        gtgatggaaaaggaatttgaagatggcatcatgaactggggaaggattgt
Q3C2I0_BCL2A1-01        gtgatggaaaaggaatttgaagatggcattgttaactggggcaggattgt
W5Q0N6_BCL2A1-01        gtgatggaaaaggaatttgaagatggcattgttaactggggcaggattgt
G3T8E6_BCL2A1-01        gtgatggaaaaggaatttgaagatggcatcattaactggggaagaattgt
F7CP56_BCL2A1-01        gtgatggaaaagcaatttgaagatggcatcattaactggggaagaattat
C7F841_BCL2A1-02        gtgatggaaaaggaatttgaagatggcatcattaactggggaaggattgt
C7F841_BCL2A1-01        gtgatggaaaaggaatttgaagatggcatcattaactggggaaggattgt
H0WZ23_BCL2A1-01        gtgatggaaaaggaatttgaagatggcatcattaactggggcaggattgt
U3DBA0_BCL2A1-02        gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
U3DBA0_BCL2A1-01        gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
A0A2K6TLM0_BCL2A1-      gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
A0A2K6TLM0_BCL2A1-      gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
A0A2K6TLM0_BCL2A1-      gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
A0A2K5D2I1_BCL2A1-      gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
A0A2K5D2I1_BCL2A1-      gtgatggaaaaggaatttgaagatggcattattaactggggaagaattgt
H2NNZ9_BCL2A1-01        gtaatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3HNF3_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3HNF3_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K5KAB6_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6AD55_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A0D9RRC3_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6LV22_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6PHG5_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K5KHH9_BCL2A1-      gtgatggaaaaggaatttgaagatggcatcattaactggggaagaattgt
A0A096NMX5_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6DS80_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K5KHH9_BCL2A1-      gtgatggaaaaggaatttgaagatggcatcattaactggggaagaattgt
A0A2K5TMD8_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
F7E8V5_BCL2A1-01        gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K5KAB6_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6LV22_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6PHG5_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6AD55_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A096NMX5_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K5KHH9_BCL2A1-      gtgatggaaaaggaatttgaagatggcatcattaactggggaagaattgt
A0A2K5TMD8_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2K6DS80_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
F7E8V5_BCL2A1-02        gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
B4E1X9_BCL2A1-01        gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt
A0A2R8ZJX9_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3T6T8_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2R8ZJX9_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3T6T8_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
Q16548_BCL2A1-01        gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt
A0A2I2YML2_BCL2A1-      gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt
A0A2I2YML2_BCL2A1-      gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt
A0A2R8ZJX9_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I3T6T8_BCL2A1-      gtgatggaaaaggagtttgaagatggcatcattaactggggaagaattgt
A0A2I2YML2_BCL2A1-      gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt
Q16548_BCL2A1-02        gtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgt

K7G130_BCL2A1-01        gacaatatttatgtttggaggaattctttct-aagaggcttcaagaacac
Q9W6F2_BCL2A1-01        gaccatatttacttttggaggtcttctcacc-aagaagcttcaagagcac
G1N8C5_BCL2A1-01        gaccatatttacttttggaggtcttctcacc-aagaagcttcaagagcag
U3JTB2_BCL2A1-01        gaccatatttacatttggaggtcttctcacc-aagaagcttcaagagcat
H0ZCL9_BCL2A1-01        gaccatctttacatttggaggtcttctcacc-aagaagcttcaagagcat
F6S8G3_BCL2A1-01        gacgatatttgtcttggggggcattctcacc-aagaagctcc-aaaggag
F6SFL4_BCL2A1-01        caccatatttgcttttgggggaattctcatc-aagaagcttctgagacat
G3WSP8_BCL2A1-01        caccatatttgcttttgggggaattctcatt-aagaaacttctgagacac
A0A286XUI2_BCL2A1-      gactatctttgcttttgggggggtcatcctc-aagaaactcccacgagag
A0A337STN9_BCL2A1-      gactatatttgcgtttgagggcatcctcatc-aagaagcttctccaggag
A0A337STN9_BCL2A1-      gactatatttgcgtttgagggcatcctcatc-aagaagcttctccaggag
E2RS00_BCL2A1-01        gaccgtttttgcctttgaaggaattctcacc-aagaaactcctcgagcag
M3YVH4_BCL2A1-01        gaccgtgtttgcctttgaaggcattctctcc-aagaagctcctccgggag
G1T1L8_BCL2A1-01        gaccatatttgcattcgaaggggtcctggcc-aagaagctcctccaggag
G3V977_BCL2A1-01        gactatatttgcctttgggggtgttctcctg-aaaaagcttccacaagag
Q925A9_BCL2A1-01        gactatatttgcctttgggggtgttctcctg-aaaaagcttccacaagag
O55178_BCL2A1-01        gactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagag
Q0P538_BCL2A1-01        gactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagag
Q07440_BCL2A1-01        gactatatttgcctttgggggtgttctcctc-aaaaaacttccacaagag
O55179_BCL2A1-01        gactatatttgcctttgggggtgttctcctc-aaaaaacttccacaagag
Q8K164_BCL2A1-01        gactatatttgcctttgggggtgttctcctc-aaaaaacttccgcaagag
Q4FK02_BCL2A1-01        gactatatttgcctttgggggtgttctcctc-aaaaaacttccgcaagag
O55177_BCL2A1-02        gactatatttgcctttgggggtgttctcctc-aaaaaacttccgcaagag
Q497M6_BCL2A1-01        gactatatttgcctttgggggtgttctcctc-aaaaaacttccgcaagag
A0A2K6EKG1_BCL2A1-      gaccgtgtttgcattcggaggtattctcatc-aagaaacttctacgagag
I3MCZ7_BCL2A1-01        gaccatatttgccttcggaggagttctggtc-aagaaacttctgcgagag
Q3C2I0_BCL2A1-01        aaccatattcgcctttgaaggtattcttacc-aagaaacttctgggcaag
W5Q0N6_BCL2A1-01        aaccatattcgcctttgaaggtattcttacc-aagaaacttctgagcaag
G3T8E6_BCL2A1-01        gaccatatttgcatttggaggtattctcatc-aagaaacttctaagggag
F7CP56_BCL2A1-01        gaccatatttgcatttgaaggtattctcatc-aagaaacttctaccagag
C7F841_BCL2A1-02        gaccatatttgcatttgaaggtattctcatg-aagaaacttctgcgaaag
C7F841_BCL2A1-01        gaccatatttgcatttgaaggtattctcatg-aagaaacttctgcgaaag
H0WZ23_BCL2A1-01        gacaatatttgcctttggaggtattctcctc-aagaaacttctccaacag
U3DBA0_BCL2A1-02        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
U3DBA0_BCL2A1-01        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
A0A2K6TLM0_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
A0A2K6TLM0_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
A0A2K6TLM0_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
A0A2K5D2I1_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
A0A2K5D2I1_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgagag
H2NNZ9_BCL2A1-01        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I3T6T8_BCL2A1-      -------------------------------------acctccac-----
A0A2I3HNF3_BCL2A1-      aaccatatttgcatttgaaggtattctcgtc-aagaaacttctacgacag
A0A2I3HNF3_BCL2A1-      aaccatatttgcatttgaaggtattctcgtc-aagaaacttctacgacag
A0A2I3HNF3_BCL2A1-      aaccatatttgcatttgaaggtattctcgtc-aagaaacttctacgacag
A0A2K5KAB6_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6AD55_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A0D9RRC3_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6LV22_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6PHG5_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5KHH9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A096NMX5_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6DS80_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5KHH9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5TMD8_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
F7E8V5_BCL2A1-01        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5KAB6_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6LV22_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6PHG5_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6AD55_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A096NMX5_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5KHH9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K5TMD8_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2K6DS80_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
F7E8V5_BCL2A1-02        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
B4E1X9_BCL2A1-01        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2R8ZJX9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I3T6T8_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2R8ZJX9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I3T6T8_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
Q16548_BCL2A1-01        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I2YML2_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I2YML2_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2R8ZJX9_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I3T6T8_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
A0A2I2YML2_BCL2A1-      aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
Q16548_BCL2A1-02        aaccatatttgcatttgaaggtattctcatc-aagaaacttctacgacag
                                                              *  *        

K7G130_BCL2A1-01        aaagttcagcttacagga-gataataaagagcagatttcttatttcatca
Q9W6F2_BCL2A1-01        ggagttcagctcactgga-gaggagaaggagaagatttcttatttcatca
G1N8C5_BCL2A1-01        ggagttcagctcactgga-gaggagaaggagcagatttcttatttcatca
U3JTB2_BCL2A1-01        ggggttcagctgactgca-gaggagaaggaggagatctcttatttcatca
H0ZCL9_BCL2A1-01        ggggttcagctgactgca-gaggagaaggagcagatttcttatttcatca
F6S8G3_BCL2A1-01        cggagtcccgctgacgagagagactcgggaggagatttcttgtttcatcg
F6SFL4_BCL2A1-01        agagctccactgactatg-ggcactcaggaagaaatttctcattttattg
G3WSP8_BCL2A1-01        agagctccactgactatg-gacactcatgaagaaatttctcattttattg
A0A286XUI2_BCL2A1-      ccaatcgccccagatgtg-gacacttacaaggagatttcctacttcgtgg
A0A337STN9_BCL2A1-      cggatcgtcccagacgcg-gatgcgtttaagg---tttcctactttgtcg
A0A337STN9_BCL2A1-      cggatcgtcccagacgcg-gatgcgtttaagg---tttcctactttgtcg
E2RS00_BCL2A1-01        cgaatttcctcggatgtg-gatgccgagaagg---tttcctacttcgtgg
M3YVH4_BCL2A1-01        cgaatttccccggacgtg-gatgcttccaggg---tttcttactttgtgg
G1T1L8_BCL2A1-01        caggctgttccggatgtg-gacacgttcaagtccatcccttattttgtgg
G3V977_BCL2A1-01        cagattgccctggatgtg-gatacttacaagcaagtttccagttttgtgg
Q925A9_BCL2A1-01        cagattggcctggatgtg-gatacttacaagcaagtttccagttttgtgg
O55178_BCL2A1-01        cagattgccctggatgta-cgtgcttacaaacaagtttccagttttgggg
Q0P538_BCL2A1-01        cagattgccctggatgta-cgtgcttacaaacaagtttccagttttgggg
Q07440_BCL2A1-01        cagattgccctggatgta-tgtgcttacaaacaagtttccagttttgtgg
O55179_BCL2A1-01        cagattgccctggatgta-ggtgcttacaaacaagtttccagttttgtgg
Q8K164_BCL2A1-01        cagattgccctggatgta-ggtgcttacaaacaagtttccagttttgtgg
Q4FK02_BCL2A1-01        cagattgccctggatgta-ggtgcttacaaacaagtttccagttttgtgg
O55177_BCL2A1-02        cagattgccctggatgta-ggtgcttacaaacaagtttccagttttgtgg
Q497M6_BCL2A1-01        cagattgccctggatgta-ggtgcttacaaacaagtttccagttttgtgg
A0A2K6EKG1_BCL2A1-      cagattgccctggatgtg-gatacttacaaggagatttcttattttattg
I3MCZ7_BCL2A1-01        cggattgcccctgctgtg-gattccgatgaggagatctcttactttgtgg
Q3C2I0_BCL2A1-01        tgtattgcctcagacatg-gacatgtgcaaggacatttctttctttgtgg
W5Q0N6_BCL2A1-01        cgtattgcctcagacatg-gacatgtgcaaggacatttcttatttcgtgg
G3T8E6_BCL2A1-01        cgaattgccccagatgtg-gatacttacaagaagatttcttcttttgttg
F7CP56_BCL2A1-01        cgaattgccccagatgtg-gatacttacaaggagatttcttactttgttg
C7F841_BCL2A1-02        cgaattgccccagatgtg-gacacgtacaaggagatttcttactttgtcg
C7F841_BCL2A1-01        cgaattgccccagatgtg-gacacgtacaaggagatttcttactttgtcg
H0WZ23_BCL2A1-01        cgaattgccctggatgtg-gatacttataaggagatttcttattttgttg
U3DBA0_BCL2A1-02        cgaattgccccggatgtg-gatacttacaaggagatctcacattttgttg
U3DBA0_BCL2A1-01        cgaattgccccggatgtg-gatacttacaaggagatctcacattttgttg
A0A2K6TLM0_BCL2A1-      cgaattgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2K6TLM0_BCL2A1-      cgaattgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2K6TLM0_BCL2A1-      cgaattgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2K5D2I1_BCL2A1-      cgaattgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2K5D2I1_BCL2A1-      cgaattgccccggatgtg-gatacttacaaggagatttcgtattttgttg
H2NNZ9_BCL2A1-01        caaattgccccggatgtg-gatacttacaaggagatttcatattttgttg
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      cgaactgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2I3HNF3_BCL2A1-      cgaactgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2I3HNF3_BCL2A1-      cgaactgccccggatgtg-gatacttacaaggagatttcgtattttgttg
A0A2K5KAB6_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6AD55_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A0D9RRC3_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6LV22_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6PHG5_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K5KHH9_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A096NMX5_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2K6DS80_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K5KHH9_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K5TMD8_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
F7E8V5_BCL2A1-01        cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K5KAB6_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6LV22_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6PHG5_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6AD55_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A096NMX5_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2K5KHH9_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K5TMD8_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
A0A2K6DS80_BCL2A1-      cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
F7E8V5_BCL2A1-02        cgaattgccccggatgtg-gatacttataaggagatttcgtattttgttg
B4E1X9_BCL2A1-01        caaattgccccggatgtg-gatacctataaggagatttcatattttgttg
A0A2R8ZJX9_BCL2A1-      cagattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2I3T6T8_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2R8ZJX9_BCL2A1-      cagattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2I3T6T8_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
Q16548_BCL2A1-01        caaattgccccggatgtg-gatacctataaggagatttcatattttgttg
A0A2I2YML2_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2I2YML2_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2R8ZJX9_BCL2A1-      cagattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2I3T6T8_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
A0A2I2YML2_BCL2A1-      caaattgccccggatgtg-gatacttataaggagatttcatattttgttg
Q16548_BCL2A1-02        caaattgccccggatgtg-gatacctataaggagatttcatattttgttg

K7G130_BCL2A1-01        cggagtacattataaacaccaaggctgaatggatagatgcaaatggaggc
Q9W6F2_BCL2A1-01        cagagtacatcataaataacaaagccgcatggatagatgcaaacggtggc
G1N8C5_BCL2A1-01        cagagtacatcataaataacaaagccgcatggatagatgcaaacggtggc
U3JTB2_BCL2A1-01        cagagtacatcatcaacaacaaatccgaatggattgatgcaaatggtggc
H0ZCL9_BCL2A1-01        cggagtacatcatcaacaacaaagccgaatggattgatgcgaatggtggc
F6S8G3_BCL2A1-01        cggagttcaccacccaccacgccggagagtggataaggcagaacggaggc
F6SFL4_BCL2A1-01        ccgagttcataatgaacaatatagcagagtggataagacaaaatggagga
G3WSP8_BCL2A1-01        ctgagttcataatgaacaacatagcagaatggataagacaaaatggagga
A0A286XUI2_BCL2A1-      ctgagttcataatgagccgcatgggaggctggatacggcagaacggaggc
A0A337STN9_BCL2A1-      ccgagttcatcacgaaacacacgggagaatggatccggcaaaacggaggc
A0A337STN9_BCL2A1-      ccgagttcatcacgaaacacacgggagaatggatccggcaaaacggaggc
E2RS00_BCL2A1-01        cagagttcatcacgagaaacatgagagactggataagacaaaacggaggc
M3YVH4_BCL2A1-01        cagagttcatcacgacaaacatgagggagtggataagacagaacggaggc
G1T1L8_BCL2A1-01        ctgagttcataacgaggaggatgggagaatggataaggcaaaacggaggc
G3V977_BCL2A1-01        cggaattcataatgaataacacaggagaatggatacagcagaatggaggc
Q925A9_BCL2A1-01        cggaattcataatgaataacacaggagaatggatacagcagaatggaggc
O55178_BCL2A1-01        cagaattcataatgaataa-------------------------------
Q0P538_BCL2A1-01        cagaattcatcatgaataa-------------------------------
Q07440_BCL2A1-01        cagaattcataatgaataacacaggagaatggatacggcagaatggaggt
O55179_BCL2A1-01        cagaattcataatgaataacacaggagaatggatacggcggaatggaggt
Q8K164_BCL2A1-01        cagaattcataatcaataacacaggagaatggatacggcggaatggaggt
Q4FK02_BCL2A1-01        cagaattcataatcaataacacaggagaatggatacggcggaatggaggt
O55177_BCL2A1-02        cagaattcataatcaataacacaggagaatggatacggcggaatggaggt
Q497M6_BCL2A1-01        cagaattcataatcaataacacaggagaatggatacggcggaatggaggt
A0A2K6EKG1_BCL2A1-      ctgagttcataacgaataacgcaggagagtggatacggcagaacggaggc
I3MCZ7_BCL2A1-01        ctgagttcattatgaataatgcaggagaatggataaggcaaaatggaggc
Q3C2I0_BCL2A1-01        cggagttcatcaccgaaaatacaggagagtggataaagcaaaatggaggc
W5Q0N6_BCL2A1-01        cggagttcatcaccaaaaacacaggagagtggataaggcaaaacggaggc
G3T8E6_BCL2A1-01        ctgagttcatagtggataacacagcagagtggataaggcaaaacggaggc
F7CP56_BCL2A1-01        ctgagttcataacgaaaaacacaggagaatggataaggcaaaatggaggc
C7F841_BCL2A1-02        ccgagttcatcaccaaaaacacaggacagtggataaggcaaaacggaggc
C7F841_BCL2A1-01        ccgagttcatcaccaaaaacacaggacagtggataaggcaaaacggaggc
H0WZ23_BCL2A1-01        ctgagttcataatgaattacacaggagaatggataaggcaaaatggaggc
U3DBA0_BCL2A1-02        ctgagttcataatgaataacacaggagaatggataagacaaaacggaggc
U3DBA0_BCL2A1-01        ctgagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2K6TLM0_BCL2A1-      ctgagttcataatgaataacacaggagaatggataagacgaaacggaggc
A0A2K6TLM0_BCL2A1-      ctgagttcataatgaataacacaggagaatggataagacgaaacggaggc
A0A2K6TLM0_BCL2A1-      ctgagttcataatgaataacacaggagaatggataagacgaaacggaggc
A0A2K5D2I1_BCL2A1-      ctgagttcataatgaataacacaggagaatggataagtcaaaacggaggc
A0A2K5D2I1_BCL2A1-      ctgagttcataatgaataacacaggagaatggataagtcaaaacggaggc
H2NNZ9_BCL2A1-01        cggagttcgtcatgaataacacaggaggatggataaagcaaaacggaggc
A0A2I3T6T8_BCL2A1-      -----------------------------------------------ggc
A0A2I3HNF3_BCL2A1-      cagagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2I3HNF3_BCL2A1-      cagagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2I3HNF3_BCL2A1-      cagagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5KAB6_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6AD55_BCL2A1-      ctgagttcataatgaataacactggagaatggataaggcaaaacggaggc
A0A0D9RRC3_BCL2A1-      ctgagttcataacgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6LV22_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6PHG5_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5KHH9_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A096NMX5_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6DS80_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5KHH9_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5TMD8_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
F7E8V5_BCL2A1-01        ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5KAB6_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6LV22_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6PHG5_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6AD55_BCL2A1-      ctgagttcataatgaataacactggagaatggataaggcaaaacggaggc
A0A096NMX5_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5KHH9_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K5TMD8_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2K6DS80_BCL2A1-      ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
F7E8V5_BCL2A1-02        ctgagttcataatgaataacacaggagaatggataaggcaaaacggaggc
B4E1X9_BCL2A1-01        cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2R8ZJX9_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2I3T6T8_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2R8ZJX9_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2I3T6T8_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
Q16548_BCL2A1-01        cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2I2YML2_BCL2A1-      cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2I2YML2_BCL2A1-      cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc
A0A2R8ZJX9_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2I3T6T8_BCL2A1-      cggagttcataatgaataacacaggagaatggataagacaaaacggaggc
A0A2I2YML2_BCL2A1-      cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc
Q16548_BCL2A1-02        cggagttcataatgaataacacaggagaatggataaggcaaaacggaggc

K7G130_BCL2A1-01        t-gggaaaacggcttcctacctatgtttgaagaaa---------aacaat
Q9W6F2_BCL2A1-01        t-gggaaaacggtttcctaacgaagtttgaaagaa------------gat
G1N8C5_BCL2A1-01        t-gggaaaatggtttcctaacaaagtttgaaagaa------------gat
U3JTB2_BCL2A1-01        t-gggaaaatggcttcctaacaaagtttgaaagaa------------gat
H0ZCL9_BCL2A1-01        t-gggaaaatggcttcctaactaagtttgaaagaa------------gat
F6S8G3_BCL2A1-01        t-gggaaaatggatttttaaataagtttgaacaaa---------agaccg
F6SFL4_BCL2A1-01        t-gggaaaatggctttgtaaagaactttgaaccta---------atacag
G3WSP8_BCL2A1-01        t-gggaaaatggcttcataaagaactttgaaccca---------atatgg
A0A286XUI2_BCL2A1-      t-gggacaacggcttcgtgcggaagtttgagccca---------aatctg
A0A337STN9_BCL2A1-      t-gggaaaacggctttgtaaggaagttcgaaccca---------agtctg
A0A337STN9_BCL2A1-      t-ggca------ctcagta--------------ca---------agttta
E2RS00_BCL2A1-01        t-gggaaaacggctttgtgaagaagttcgaaccca---------agtctg
M3YVH4_BCL2A1-01        t-gggaggatggctttgtaaagaagttcgagccca---------agtccg
G1T1L8_BCL2A1-01        t-gggaaaatggatttgtaaagaagtttgaacata---------attctg
G3V977_BCL2A1-01        t-gggaagatggcttcacaaagaagtttgaaccta---------aatctg
Q925A9_BCL2A1-01        t-gggaagatggcttcacaaagaagtttgaaccta---------aatctg
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
O55179_BCL2A1-01        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
Q8K164_BCL2A1-01        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
Q4FK02_BCL2A1-01        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
O55177_BCL2A1-02        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
Q497M6_BCL2A1-01        t-gggaagatggcttcataaagaagtttgaaccca---------aatctg
A0A2K6EKG1_BCL2A1-      t-gggaacacggcttcgtaaagaagtttgaaccta---------gacctg
I3MCZ7_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
Q3C2I0_BCL2A1-01        t-gggaaaatgggtttgtaaagaagtttgaaacca---------aatctg
W5Q0N6_BCL2A1-01        t-gggaaaatggttttgtaaagaagtttgaaacca---------aatctg
G3T8E6_BCL2A1-01        t-gggaaaatggctttgtgaagaagtttgaaccta---------ggtctg
F7CP56_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccca---------aatctg
C7F841_BCL2A1-02        t-gggaaaatggctttgtaaagaagtttgaaccca---------aatctg
C7F841_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccca---------aatctg
H0WZ23_BCL2A1-01        t-gggaacatggctttgtaaagaagtttgaacctaactctggctactctg
U3DBA0_BCL2A1-02        tgggggaaatggc--------acagtctcatgctt---------atgcta
U3DBA0_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K6TLM0_BCL2A1-      tggg-ggaa-------atggaacagtctcatgctt---------atgcta
A0A2K6TLM0_BCL2A1-      tggg-ac-------------------------------------------
A0A2K6TLM0_BCL2A1-      tggg-aaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5D2I1_BCL2A1-      tgggcgaaatggc--------acagtctcctgctt---------gtgctg
A0A2K5D2I1_BCL2A1-      tggg-aaaatggctttgtaaagaagtttgaaccta---------aatctg
H2NNZ9_BCL2A1-01        t-gggaaaatggctttgtaaagaagcttgagccta---------aatctg
A0A2I3T6T8_BCL2A1-      tcaagaaaatggctttgtaaagaagtttgaacata---------aatctg
A0A2I3HNF3_BCL2A1-      tgggggaaatggc-------ataatcacatgccta---------tg-ctg
A0A2I3HNF3_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2I3HNF3_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5KAB6_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K6AD55_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A0D9RRC3_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K6LV22_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K6PHG5_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5KHH9_BCL2A1-      t-gggaaaatggctttgtaaagaagcttgagccta---------aatctg
A0A096NMX5_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K6DS80_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5KHH9_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5TMD8_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
F7E8V5_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2K5KAB6_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K6LV22_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K6PHG5_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K6AD55_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A096NMX5_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K5KHH9_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K5TMD8_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
A0A2K6DS80_BCL2A1-      tgggggaaatggc-------acaatcacatgccta---------tg-cta
F7E8V5_BCL2A1-02        tgggggaaatggc-------acaatcacatgccta---------tg-cta
B4E1X9_BCL2A1-01        t-gggtatgtgtgatggaaaaattcttcattgttc---------tttcct
A0A2R8ZJX9_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaacata---------aatctg
A0A2I3T6T8_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaacata---------aatctg
A0A2R8ZJX9_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaacata---------aatctg
A0A2I3T6T8_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaacata---------aatctg
Q16548_BCL2A1-01        t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2I2YML2_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2I2YML2_BCL2A1-      t-gggaaaatggctttgtaaagaagtttgaaccta---------aatctg
A0A2R8ZJX9_BCL2A1-      tgggggaaatggc-------acaatcacacgccta---------tg-ctg
A0A2I3T6T8_BCL2A1-      tgggggaaatggc-------acaatcacacgccta---------tg-ctg
A0A2I2YML2_BCL2A1-      tgggggaaatggc-------acaatcacacgccta---------tg-ctg
Q16548_BCL2A1-02        tgggggaaatggc-------acaatcacacaccta---------tg-ctg

K7G130_BCL2A1-01        cgtggctgtcattattcaacattaaagcaaaaatc---------------
Q9W6F2_BCL2A1-01        cacccctatctttctctacaattacagacatattt---------------
G1N8C5_BCL2A1-01        caccactatctttctctacaattacagacatattt---------------
U3JTB2_BCL2A1-01        cactactgtccttctccaaaattacagccctgttc---------------
H0ZCL9_BCL2A1-01        cactactgtccttctccaaaattacagccctgttc---------------
F6S8G3_BCL2A1-01        tctggtcggtgttagcggatatttcgatgaagatc---------------
F6SFL4_BCL2A1-01        tgtggccgaacttcacagatatttcaacaaagatc---------------
G3WSP8_BCL2A1-01        tatggccaaacttcacagatatttcaacaaagatc---------------
A0A286XUI2_BCL2A1-      gctggctgacttttgtgggagttatgggacagctc---------------
A0A337STN9_BCL2A1-      gctggctgacctttctggaagttacaggaaagatc---------------
A0A337STN9_BCL2A1-      g-------------------------------------------------
E2RS00_BCL2A1-01        gatggctgacttttctggaagttctgggaacagtg---------------
M3YVH4_BCL2A1-01        gctggctgacctttctggaagttataggaaagatc---------------
G1T1L8_BCL2A1-01        gttggaagatttttctggaagttgcaaaacagatc---------------
G3V977_BCL2A1-01        gctggctgacttttctgcagatgacagggaagatc---------------
Q925A9_BCL2A1-01        gctggctgacttttctgcagatgacagggaagatc---------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        gctggctgacttttctgcagatgacaggacagatc---------------
O55179_BCL2A1-01        gctggctgacttttctgcagatgacaggacagatc---------------
Q8K164_BCL2A1-01        gctggctgacttttctgcagatgacaggacagatc---------------
Q4FK02_BCL2A1-01        gctggctgacttttctgcagatgacaggacagttc---------------
O55177_BCL2A1-02        gctggctgacttttctgcagatgacaggacagttc---------------
Q497M6_BCL2A1-01        gctggctgacttttctgcagatgacaggacagttc---------------
A0A2K6EKG1_BCL2A1-      cctggctgacttttctggaagttacggggaagatc---------------
I3MCZ7_BCL2A1-01        gctggttgacttttctgggagttacagggcagatc---------------
Q3C2I0_BCL2A1-01        gctggctgacttttctggaagttacaggaaagatc---------------
W5Q0N6_BCL2A1-01        gctggctgacttttctggaagttacaggaaagatc---------------
G3T8E6_BCL2A1-01        gctggctgacttttctggaagttacaggaaagatt---------------
F7CP56_BCL2A1-01        gctggctgacttttctggaagttactggaaagatg---------------
C7F841_BCL2A1-02        gctggctgacctttgtggaagttacaggaaagatc---------------
C7F841_BCL2A1-01        gctggctgacctttgtggaagttacaggaaagatc---------------
H0WZ23_BCL2A1-01        gctggctgacttttctggaagttacaagaaagatc---------------
U3DBA0_BCL2A1-02        gt---atcagtggcccagaagaagaggaaaatggc---------------
U3DBA0_BCL2A1-01        gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K6TLM0_BCL2A1-      g--------------tggagtcagcgcagaagaag---------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K5D2I1_BCL2A1-      gtggagtcagtggcccagaaggagaggaaaatggc---------------
A0A2K5D2I1_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
H2NNZ9_BCL2A1-01        gctggatgactttt---gaagttacaggaaagatc---------------
A0A2I3T6T8_BCL2A1-      gctggatgacttttctagaagttacaggaaagatctcaatactgttgacc
A0A2I3HNF3_BCL2A1-      gtagagtcagtggcccacaag-aagagga---------------------
A0A2I3HNF3_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2I3HNF3_BCL2A1-      gctggatgacttttctagaagttacaggaaagatctcaatactgttgact
A0A2K5KAB6_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K6AD55_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A0D9RRC3_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K6LV22_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K6PHG5_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K5KHH9_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A096NMX5_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K6DS80_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K5KHH9_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K5TMD8_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
F7E8V5_BCL2A1-01        gctggatgacttttctagaagttacaggaaagatc---------------
A0A2K5KAB6_BCL2A1-      gtagagtcagtggcccacaagaagaagaaaatggc---------------
A0A2K6LV22_BCL2A1-      gtagagtcagtggcccataggaagaagaaaatggc---------------
A0A2K6PHG5_BCL2A1-      gtagagtcagtggcccacaagaagaagaaaatggc---------------
A0A2K6AD55_BCL2A1-      gtagagtcagtggcccacaggaagaagaaaatggc---------------
A0A096NMX5_BCL2A1-      gtagagtcagtggcccacaagaagaagaaaatggc---------------
A0A2K5KHH9_BCL2A1-      gtagagtcagtggcccacaggaagaagaaaatggc---------------
A0A2K5TMD8_BCL2A1-      gtagagtcagtggcccac---aagaagaaaatggc---------------
A0A2K6DS80_BCL2A1-      gtagagtcagtggcccacaagaagaagaaaatggc---------------
F7E8V5_BCL2A1-02        gtagagtcagtggcccac--------------------------------
B4E1X9_BCL2A1-01        gtgaaat------------agaaattgagaatttc---------------
A0A2R8ZJX9_BCL2A1-      gctggatgacttttctagaagttacaggaaagatctcaatactgttgacc
A0A2I3T6T8_BCL2A1-      gctggatgacttttctagaagttacaggaaagatctcaatactgttgacc
A0A2R8ZJX9_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
A0A2I3T6T8_BCL2A1-      gctggatgacttttctagaagttacaggaaagatc---------------
Q16548_BCL2A1-01        gctggatgacttttctagaagttacaggaaagatc---------------
A0A2I2YML2_BCL2A1-      gctggatgacttttctagaagttacgggaaagatc---------------
A0A2I2YML2_BCL2A1-      gctggatgacttttctagaagttacgggaaagatctcaatactgttgacc
A0A2R8ZJX9_BCL2A1-      gtagagtcagtggcccacaagaagaggaaaatggc---------------
A0A2I3T6T8_BCL2A1-      gtagagtcagtggcccacaagaagaggaaaatggc---------------
A0A2I2YML2_BCL2A1-      gtagagtcagtggcccacaagaagaggaaaatggc---------------
Q16548_BCL2A1-02        gtagagtcagtggcccacaagaagaggaaaatggc---------------

K7G130_BCL2A1-01        ------------------atggatgc---tttttccttctt---------
Q9W6F2_BCL2A1-01        ------------------gcagctgt---tctttccttgtt---------
G1N8C5_BCL2A1-01        ------------------gcagctgt---tttttccttgtt---------
U3JTB2_BCL2A1-01        ------------------atagctgt---tgtttccttgtt---------
H0ZCL9_BCL2A1-01        ------------------atagctct---tgtgtccttgtt---------
F6S8G3_BCL2A1-01        ------------------ttgggcgt---actctcccacct---------
F6SFL4_BCL2A1-01        ------------------tggggcat---attttcctttct---------
G3WSP8_BCL2A1-01        ------------------tggaatgt---attttcctttct---------
A0A286XUI2_BCL2A1-      ------------------tgtgagat---gctctctctcct---------
A0A337STN9_BCL2A1-      ------------------tgtaaggt---attgtctctcct---------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        ------------------tgtgaaat---gtggtcacacct---------
M3YVH4_BCL2A1-01        ------------------tgtgaaat---gttctctctcct---------
G1T1L8_BCL2A1-01        ------------------tgtgtgat---actgtcgttgct---------
G3V977_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
Q925A9_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
O55179_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
Q8K164_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
Q4FK02_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
O55177_BCL2A1-02        ------------------tgggaaat---gctctttctcct---------
Q497M6_BCL2A1-01        ------------------tgggaaat---gctctttctcct---------
A0A2K6EKG1_BCL2A1-      ------------------tgtgacat---gctgtccctcct---------
I3MCZ7_BCL2A1-01        ------------------tgtgagat---gctgtctctcct---------
Q3C2I0_BCL2A1-01        ------------------tgtgaaac---attatgtcgcct---------
W5Q0N6_BCL2A1-01        ------------------tgtgaaac---attatgtcgtct---------
G3T8E6_BCL2A1-01        ------------------tgtgaaat---gttatttctcct---------
F7CP56_BCL2A1-01        ------------------tgtgaaat---act---tttcct---------
C7F841_BCL2A1-02        ------------------tgtgaaat---gttatgtctcct---------
C7F841_BCL2A1-01        ------------------tgtgaaat---gttatgtctcct---------
H0WZ23_BCL2A1-01        ------------------tgtgaaat---gctgcctctcctg--------
U3DBA0_BCL2A1-02        ------------------tttgtaa-------------------------
U3DBA0_BCL2A1-01        ------------------tgcgaaat---gctatctctctt---------
A0A2K6TLM0_BCL2A1-      ------------------aagaaaat---ggcttt---------------
A0A2K6TLM0_BCL2A1-      ------------------------------ctatc---------------
A0A2K6TLM0_BCL2A1-      ------------------tgtgaaat---gctatctctctt---------
A0A2K5D2I1_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K5D2I1_BCL2A1-      ------------------tgcgaaat---gctatctctctt---------
H2NNZ9_BCL2A1-01        ------------------tgtgaaat---gctctctcttct---------
A0A2I3T6T8_BCL2A1-      agaaaggacactccatattgtgaaaccggcctaatttttctgactgttat
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      ------------------tgtgaaat---gctctctttcctg--------
A0A2I3HNF3_BCL2A1-      agaaaggacactccatattgtgaaaccggcctaatttttctgactcttat
A0A2K5KAB6_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K6AD55_BCL2A1-      ------------------tgtgaaat---gctctctctcct---------
A0A0D9RRC3_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K6LV22_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K6PHG5_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K5KHH9_BCL2A1-      ------------------tgtgaaat---gctctctcttct---------
A0A096NMX5_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K6DS80_BCL2A1-      ------------------tgtgaaat---gctctctcttct---------
A0A2K5KHH9_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2K5TMD8_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
F7E8V5_BCL2A1-01        ------------------tgtgaaat---gctatctctcct---------
A0A2K5KAB6_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K6LV22_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K6PHG5_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K6AD55_BCL2A1-      ------------------tttgtaa-------------------------
A0A096NMX5_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K5KHH9_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K5TMD8_BCL2A1-      ------------------tttgtaa-------------------------
A0A2K6DS80_BCL2A1-      ------------------tttgtaa-------------------------
F7E8V5_BCL2A1-02        ----------------------tag-------------------------
B4E1X9_BCL2A1-01        ------------------cttgcta-------------------------
A0A2R8ZJX9_BCL2A1-      agaaaggacactccatattgtgaaaccggcctaatttttctgactgttat
A0A2I3T6T8_BCL2A1-      agaaaggacactccatattgtgaaaccggcctaatttttctgactgttat
A0A2R8ZJX9_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2I3T6T8_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
Q16548_BCL2A1-01        ------------------tgtgaaat---gctatctctcct---------
A0A2I2YML2_BCL2A1-      ------------------tgtgaaat---gctatctctcct---------
A0A2I2YML2_BCL2A1-      agaaaggacactccatattgtgaaaccggcctaatttttctgactgttat
A0A2R8ZJX9_BCL2A1-      ------------------tttgtaa-------------------------
A0A2I3T6T8_BCL2A1-      ------------------tttgtaa-------------------------
A0A2I2YML2_BCL2A1-      ------------------tttgtaa-------------------------
Q16548_BCL2A1-02        ------------------tttgtaa-------------------------

K7G130_BCL2A1-01        -cagtcag-----------------tatta--------------------
Q9W6F2_BCL2A1-01        -cagagag-----------------tacca--------------------
G1N8C5_BCL2A1-01        -cagagac-----------------tacta--------------------
U3JTB2_BCL2A1-01        -cagagag-----------------tacta--------------------
H0ZCL9_BCL2A1-01        -cagagag-----------------tacta--------------------
F6S8G3_BCL2A1-01        -gaagcaa-----------------tttta--------------------
F6SFL4_BCL2A1-01        -gaagtaa------------------------------------------
G3WSP8_BCL2A1-01        -gaagtaa------------------------------------------
A0A286XUI2_BCL2A1-      -gaagcaa-----------------ttcta--------------------
A0A337STN9_BCL2A1-      -gaagaac-----------------tacta--------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
E2RS00_BCL2A1-01        -aaagcaa-----------------tacta--------------------
M3YVH4_BCL2A1-01        -gaagcaa-----------------tacta--------------------
G1T1L8_BCL2A1-01        -gaagaag-----------------tactg--------------------
G3V977_BCL2A1-01        -caagcaa-----------------cacta--------------------
Q925A9_BCL2A1-01        -caagcaa-----------------cacta--------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -caagtaa------------------------------------------
O55179_BCL2A1-01        -caagtaa------------------------------------------
Q8K164_BCL2A1-01        -caagtaa------------------------------------------
Q4FK02_BCL2A1-01        -caagtag------------------------------------------
O55177_BCL2A1-02        -caagtaa------------------------------------------
Q497M6_BCL2A1-01        -caagtaa------------------------------------------
A0A2K6EKG1_BCL2A1-      ------------------------ctactc--------------------
I3MCZ7_BCL2A1-01        -gaagcaa-----------------tacta--------------------
Q3C2I0_BCL2A1-01        -gaagcaa-----------------tacta--------------------
W5Q0N6_BCL2A1-01        -gaagcaa-----------------tacta--------------------
G3T8E6_BCL2A1-01        -gaagcaa-----------------tacta--------------------
F7CP56_BCL2A1-01        -gaagcaa-----------------tacta--------------------
C7F841_BCL2A1-02        -gaagcaa-----------------tacta--------------------
C7F841_BCL2A1-01        -gaagcaa-----------------tacta--------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        -gaagcaa-----------------tactg--------------------
A0A2K6TLM0_BCL2A1-      ----gtaa------------------------------------------
A0A2K6TLM0_BCL2A1-      ----gcaa-----------------tag----------------------
A0A2K6TLM0_BCL2A1-      -gaagcaa-----------------tacta--------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -gaagcaa-----------------tacta--------------------
H2NNZ9_BCL2A1-01        -gaagcaa-----------------tactgt-------------------
A0A2I3T6T8_BCL2A1-      ggaaacgattgccaacacatacttctactt--------------------
A0A2I3HNF3_BCL2A1-      ------------------------------------aaatggctttg---
A0A2I3HNF3_BCL2A1-      ------------------------------------aagcaatactg---
A0A2I3HNF3_BCL2A1-      ggaaacaattgccaacacatacttctactttaaaataaacaactttgatg
A0A2K5KAB6_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K6AD55_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A0D9RRC3_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K6LV22_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K6PHG5_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K5KHH9_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A096NMX5_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K6DS80_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K5KHH9_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2K5TMD8_BCL2A1-      -gaagcaa-----------------tactg--------------------
F7E8V5_BCL2A1-01        -gaagcaa-----------------tactg--------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
B4E1X9_BCL2A1-01        -----------------------------g--------------------
A0A2R8ZJX9_BCL2A1-      ggaaacgattgccaacacatacttctactt--------------------
A0A2I3T6T8_BCL2A1-      ggaaacgattgccaacacatacttctactt--------------------
A0A2R8ZJX9_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2I3T6T8_BCL2A1-      -gaagcaa-----------------tactg--------------------
Q16548_BCL2A1-01        -gaagcaa-----------------tactg--------------------
A0A2I2YML2_BCL2A1-      -gaagcaa-----------------tactg--------------------
A0A2I2YML2_BCL2A1-      ggaaacgattgccaacacatacttctactt--------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------

K7G130_BCL2A1-01        -------ttga
Q9W6F2_BCL2A1-01        -------ctga
G1N8C5_BCL2A1-01        -------ctga
U3JTB2_BCL2A1-01        -------ctga
H0ZCL9_BCL2A1-01        -------ctga
F6S8G3_BCL2A1-01        -------ctga
F6SFL4_BCL2A1-01        -----------
G3WSP8_BCL2A1-01        -----------
A0A286XUI2_BCL2A1-      -------ctga
A0A337STN9_BCL2A1-      -------ctga
A0A337STN9_BCL2A1-      -----------
E2RS00_BCL2A1-01        -------ctga
M3YVH4_BCL2A1-01        -------ctga
G1T1L8_BCL2A1-01        -------ctga
G3V977_BCL2A1-01        -------ctga
Q925A9_BCL2A1-01        -------ctga
O55178_BCL2A1-01        -----------
Q0P538_BCL2A1-01        -----------
Q07440_BCL2A1-01        -----------
O55179_BCL2A1-01        -----------
Q8K164_BCL2A1-01        -----------
Q4FK02_BCL2A1-01        -----------
O55177_BCL2A1-02        -----------
Q497M6_BCL2A1-01        -----------
A0A2K6EKG1_BCL2A1-      -------ctga
I3MCZ7_BCL2A1-01        -------ttga
Q3C2I0_BCL2A1-01        -------ttga
W5Q0N6_BCL2A1-01        -------ttga
G3T8E6_BCL2A1-01        -------ttga
F7CP56_BCL2A1-01        -------ctga
C7F841_BCL2A1-02        -------ttga
C7F841_BCL2A1-01        -------ttga
H0WZ23_BCL2A1-01        -----------
U3DBA0_BCL2A1-02        -----------
U3DBA0_BCL2A1-01        -------ttga
A0A2K6TLM0_BCL2A1-      -----------
A0A2K6TLM0_BCL2A1-      -----------
A0A2K6TLM0_BCL2A1-      -------ctga
A0A2K5D2I1_BCL2A1-      -----------
A0A2K5D2I1_BCL2A1-      -------ttga
H2NNZ9_BCL2A1-01        -----------
A0A2I3T6T8_BCL2A1-      -------ttaa
A0A2I3HNF3_BCL2A1-      --------taa
A0A2I3HNF3_BCL2A1-      -------ttga
A0A2I3HNF3_BCL2A1-      atgtaacttga
A0A2K5KAB6_BCL2A1-      -------ttga
A0A2K6AD55_BCL2A1-      -------ttga
A0A0D9RRC3_BCL2A1-      -------ttga
A0A2K6LV22_BCL2A1-      -------ttga
A0A2K6PHG5_BCL2A1-      -------ttga
A0A2K5KHH9_BCL2A1-      -------ttga
A0A096NMX5_BCL2A1-      -------ttga
A0A2K6DS80_BCL2A1-      -------ttga
A0A2K5KHH9_BCL2A1-      -------ttga
A0A2K5TMD8_BCL2A1-      -------ttga
F7E8V5_BCL2A1-01        -------ttga
A0A2K5KAB6_BCL2A1-      -----------
A0A2K6LV22_BCL2A1-      -----------
A0A2K6PHG5_BCL2A1-      -----------
A0A2K6AD55_BCL2A1-      -----------
A0A096NMX5_BCL2A1-      -----------
A0A2K5KHH9_BCL2A1-      -----------
A0A2K5TMD8_BCL2A1-      -----------
A0A2K6DS80_BCL2A1-      -----------
F7E8V5_BCL2A1-02        -----------
B4E1X9_BCL2A1-01        -------ttaa
A0A2R8ZJX9_BCL2A1-      -------ttaa
A0A2I3T6T8_BCL2A1-      -------ttaa
A0A2R8ZJX9_BCL2A1-      -------ttga
A0A2I3T6T8_BCL2A1-      -------ttga
Q16548_BCL2A1-01        -------ttga
A0A2I2YML2_BCL2A1-      -------ttga
A0A2I2YML2_BCL2A1-      -------ttaa
A0A2R8ZJX9_BCL2A1-      -----------
A0A2I3T6T8_BCL2A1-      -----------
A0A2I2YML2_BCL2A1-      -----------
Q16548_BCL2A1-02        -----------

© 1998-2019