Dataset for CDS BCL-2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

102 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


X4ZGI8_BCL2-01          ------------------------------------------------at
Q564A4_BCL2-01          ------------------------------------------------at
B9ZYL7_BCL2-01          ------------------------------------------------at
A0A3P8YNB4_BCL2-01      ------------------------------------------------at
A0A3B4A3G8_BCL2-01      ------------------------------------------------at
A0A3Q2XQX2_BCL2-01      ------------------------------------------------at
A0A3Q2XQX2_BCL2-02      ------------------------------------------------at
A0A3P9J8Y9_BCL2-01      ------------------------------------------------at
A0A3Q2PN77_BCL2-01      ------------------------------------------------at
A0A3Q3B0R2_BCL2-01      ------------------------------------------------at
A0A3P8WUE9_BCL2-01      ---------------------atgtacttggtgccaaattctgctggaat
A0A3Q3K1K1_BCL2-01      ------------------------------------------------at
A0A2U9BJ09_BCL2-01      ------------------------------------------------at
A0A3Q3MEY1_BCL2-01      ------------------------------------------------at
A0A3Q3G1D7_BCL2-01      ------------------------------------------------at
A0A3Q1I5N1_BCL2-01      ------------------------------------------------at
A0A3Q0S5Z7_BCL2-01      ------------------------------------------------at
A0A3P8QVM8_BCL2-01      ------------------------------------------------at
A0A3P9DIG5_BCL2-01      ------------------------------------------------at
A0A3Q2UYW8_BCL2-01      ------------------------------------------------at
A0A3B4G3K4_BCL2-01      ------------------------------------------------at
A0A3B4TX71_BCL2-01      ------------------------------------------------at
A0A3B4YAG2_BCL2-01      ------------------------------------------------at
A0A3B5BBQ0_BCL2-01      ------------------------------------------------at
A0A3Q1B8C3_BCL2-01      ------------------------------------------------at
A0A3P8S9L3_BCL2-01      ------------------------------------------------at
A0A3Q1FLK7_BCL2-01      ------------------------------------------------at
A0A1X9JZA1_BCL2-01      ------------------------------------------------at
A0A4D6FTA2_BCL2-01      ------------------------------------------------at
W5N4F7_BCL2-01          ------------------------------------------------at
H9GPE7_BCL2-01          ------------------------------------------------at
F6YNL8_BCL2-01          ---------------------------------------------atgat
G3WZW9_BCL2-01          ------------------------------------------------at
G3WZW9_BCL2-02          ccatttggctgctctccttggtgttcactgctctctcctttgggaataat
H0W1T3_BCL2-01          ------------------------------------------------at
P10417_BCL2-01          ------------------------------------------------at
Q7TSN8_BCL2-01          ------------------------------------------------at
F1LNV0_BCL2-01          ------------------------------------------------at
P49950_BCL2-01          ------------------------------------------------at
Q6R755_BCL2-01          ------------------------------------------------at
Q9JJV8_BCL2-01          ------------------------------------------------at
Q923R6_BCL2-01          ------------------------------------------------at
O02718_BCL2-01          ------------------------------------------------at
A0A4P8GLJ2_BCL2-01      ------------------------------------------------at
F6R2C4_BCL2-01          ------------------------------------------------at
A0A076FU27_BCL2-01      ------------------------------------------------at
A0A076FZV9_BCL2-01      ------------------------------------------------at
A0A452EV13_BCL2-01      ------------------------------------------------at
G3SLZ1_BCL2-02          ------------------------------------------------at
G3SLZ1_BCL2-01          ------------------------------------------------at
G1TW27_BCL2-01          ------------------------------------------------at
G1TW27_BCL2-02          ------------------------------------------------at
A0A250YD83_BCL2-01      ------------------------------------------------at
H0WKI0_BCL2-01          ------------------------------------------------at
A0A2K6G3I7_BCL2-01      ------------------------------------------------at
A0A2K5PP81_BCL2-01      ------------------------------------------------at
A0A2K5EB04_BCL2-01      ------------------------------------------------at
A0A2K6UEL3_BCL2-01      ------------------------------------------------at
A0A2R8MY14_BCL2-01      ------------------------------------------------at
A0A2K6R2I5_BCL2-02      ------------------------------------------------at
A0A2K5HK49_BCL2-01      ------------------------------------------------at
A0A2K6KHG1_BCL2-01      ------------------------------------------------at
A0A2K6R2I5_BCL2-01      ------------------------------------------------at
A0A2K5XRD4_BCL2-01      ------------------------------------------------at
A0A2K5NZS5_BCL2-01      ------------------------------------------------at
A0A0D9S017_BCL2-01      ------------------------------------------------at
A0A2K5UDI5_BCL2-01      ------------------------------------------------at
A0A2K6CIX3_BCL2-01      ------------------------------------------------at
A0A096MPU7_BCL2-01      ------------------------------------------------at
H2NWH5_BCL2-01          ------------------------------------------------at
G3QES9_BCL2-01          ------------------------------------------------at
A0A2I3GZF9_BCL2-01      ------------------------------------------------at
A9QXG9_BCL2-01          ------------------------------------------------at
A0A2R9APW6_BCL2-01      ------------------------------------------------at
H2QEM8_BCL2-01          ------------------------------------------------at
I3MVK9_BCL2-01          ------------------------------------------------at
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          ------------------------------------------------at
E2QWA1_BCL2-02          ------------------------------------------------at
Q75SV7_BCL2-01          ------------------------------------------------at
A0A3Q2HRY3_BCL2-02      ------------------------------------------------at
A0A3Q2HRY3_BCL2-01      ------------------------------------------------at
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          ------------------------------------------------at
A0A452T603_BCL2-01      ------------------------------------------------at
G1LIC9_BCL2-02          ------------------------------------------------at
M3X1R9_BCL2-01          ------------------------------------------------at
Q8I008_BCL2-01          ------------------------------------------------at
Q00709_BCL2-01          ------------------------------------------------at
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      ------------------------------------------------at
H0YUX3_BCL2-01          ------------------------------------------------at
A0A493T1X3_BCL2-01      ------------------------------------------------at
U3KEW4_BCL2-01          ------------------------------------------------at
A0A452I9V7_BCL2-01      ------------------------------------------------at
K7F5Y3_BCL2-01          ------------------------------------------------at
K7F5Y3_BCL2-02          ------------------------------------------------at
A0A3B3TCS4_BCL2-01      ------------------------------------------------at
A0A0U3DHY6_BCL2-01      ------------------------------------------------at
A0A3P9AAB2_BCL2-01      ------------------------------------------------at
                                                                          

X4ZGI8_BCL2-01          g-----------------------------------------gcc-----
Q564A4_BCL2-01          g-----------------------------------------gct-----
B9ZYL7_BCL2-01          g-----------------------------------------gctca---
A0A3P8YNB4_BCL2-01      g-----------------------------------------gca-----
A0A3B4A3G8_BCL2-01      g-----------------------------------------gcg-----
A0A3Q2XQX2_BCL2-01      g-----------------------------------------gcg-----
A0A3Q2XQX2_BCL2-02      g-----------------------------------------gcg-----
A0A3P9J8Y9_BCL2-01      g-----------------------------------------gcg-----
A0A3Q2PN77_BCL2-01      g-----------------------------------------gcg-----
A0A3Q3B0R2_BCL2-01      g-----------------------------------------gag-----
A0A3P8WUE9_BCL2-01      g-----------------------------------------gcg-----
A0A3Q3K1K1_BCL2-01      g-----------------------------------------gcg-----
A0A2U9BJ09_BCL2-01      g-----------------------------------------gcg-----
A0A3Q3MEY1_BCL2-01      g-----------------------------------------gcg-----
A0A3Q3G1D7_BCL2-01      g-----------------------------------------gcg-----
A0A3Q1I5N1_BCL2-01      g-----------------------------------------gcg-----
A0A3Q0S5Z7_BCL2-01      g-----------------------------------------gcg-----
A0A3P8QVM8_BCL2-01      g-----------------------------------------gag-----
A0A3P9DIG5_BCL2-01      g-----------------------------------------gag-----
A0A3Q2UYW8_BCL2-01      g-----------------------------------------gcg-----
A0A3B4G3K4_BCL2-01      g-----------------------------------------gcg-----
A0A3B4TX71_BCL2-01      g-----------------------------------------gcg-----
A0A3B4YAG2_BCL2-01      g-----------------------------------------gcg-----
A0A3B5BBQ0_BCL2-01      g-----------------------------------------gcg-----
A0A3Q1B8C3_BCL2-01      g-----------------------------------------gcg-----
A0A3P8S9L3_BCL2-01      g-----------------------------------------gcg-----
A0A3Q1FLK7_BCL2-01      g-----------------------------------------gcg-----
A0A1X9JZA1_BCL2-01      g-----------------------------------------gcg-----
A0A4D6FTA2_BCL2-01      g-----------------------------------------gcg-----
W5N4F7_BCL2-01          g-----------------------------------------gcaaa---
H9GPE7_BCL2-01          g-----------------------------------------gctca---
F6YNL8_BCL2-01          g-----------------------------------------gctca---
G3WZW9_BCL2-01          g-----------------------------------------gctca---
G3WZW9_BCL2-02          g-----------------------------------------gctca---
H0W1T3_BCL2-01          g-----------------------------------------gctca---
P10417_BCL2-01          g-----------------------------------------gcgca---
Q7TSN8_BCL2-01          g-----------------------------------------gcgca---
F1LNV0_BCL2-01          g-----------------------------------------gcgca---
P49950_BCL2-01          g-----------------------------------------gcgca---
Q6R755_BCL2-01          g-----------------------------------------gcgca---
Q9JJV8_BCL2-01          g-----------------------------------------gctca---
Q923R6_BCL2-01          g-----------------------------------------gctca---
O02718_BCL2-01          g-----------------------------------------gcgca---
A0A4P8GLJ2_BCL2-01      g-----------------------------------------gcgca---
F6R2C4_BCL2-01          g-----------------------------------------gcgca---
A0A076FU27_BCL2-01      g-----------------------------------------gcgca---
A0A076FZV9_BCL2-01      g-----------------------------------------gcgca---
A0A452EV13_BCL2-01      g-----------------------------------------gcgca---
G3SLZ1_BCL2-02          g-----------------------------------------gcgca---
G3SLZ1_BCL2-01          g-----------------------------------------gcgca---
G1TW27_BCL2-01          g-----------------------------------------gcgca---
G1TW27_BCL2-02          g-----------------------------------------gcgca---
A0A250YD83_BCL2-01      g-----------------------------------------gcgca---
H0WKI0_BCL2-01          g-----------------------------------------gcgca---
A0A2K6G3I7_BCL2-01      g-----------------------------------------gcgca---
A0A2K5PP81_BCL2-01      g-----------------------------------------gcgca---
A0A2K5EB04_BCL2-01      g-----------------------------------------gcgca---
A0A2K6UEL3_BCL2-01      g-----------------------------------------gcgca---
A0A2R8MY14_BCL2-01      g-----------------------------------------gcgca---
A0A2K6R2I5_BCL2-02      g-----------------------------------------gcgca---
A0A2K5HK49_BCL2-01      g-----------------------------------------gcgca---
A0A2K6KHG1_BCL2-01      g-----------------------------------------gcgca---
A0A2K6R2I5_BCL2-01      g-----------------------------------------gcgca---
A0A2K5XRD4_BCL2-01      g-----------------------------------------gcgca---
A0A2K5NZS5_BCL2-01      g-----------------------------------------gcgca---
A0A0D9S017_BCL2-01      g-----------------------------------------gcgca---
A0A2K5UDI5_BCL2-01      g-----------------------------------------gcgca---
A0A2K6CIX3_BCL2-01      g-----------------------------------------gcgca---
A0A096MPU7_BCL2-01      g-----------------------------------------gcgca---
H2NWH5_BCL2-01          g-----------------------------------------gcgca---
G3QES9_BCL2-01          g-----------------------------------------gcgca---
A0A2I3GZF9_BCL2-01      g-----------------------------------------gcgca---
A9QXG9_BCL2-01          g-----------------------------------------gcgca---
A0A2R9APW6_BCL2-01      g-----------------------------------------gcgca---
H2QEM8_BCL2-01          g-----------------------------------------gcgca---
I3MVK9_BCL2-01          g-----------------------------------------gctca---
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          g-----------------------------------------gcgca---
E2QWA1_BCL2-02          g-----------------------------------------gcgca---
Q75SV7_BCL2-01          g-----------------------------------------gcgca---
A0A3Q2HRY3_BCL2-02      g-----------------------------------------gcgca---
A0A3Q2HRY3_BCL2-01      g-----------------------------------------gcgca---
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          g-----------------------------------------gcgca---
A0A452T603_BCL2-01      g-----------------------------------------gcgca---
G1LIC9_BCL2-02          g-----------------------------------------gcgca---
M3X1R9_BCL2-01          g-----------------------------------------gcgca---
Q8I008_BCL2-01          g-----------------------------------------gcgca---
Q00709_BCL2-01          g-----------------------------------------gctca---
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      g-----------------------------------------gctca---
H0YUX3_BCL2-01          g-----------------------------------------gctca---
A0A493T1X3_BCL2-01      g-----------------------------------------gctca---
U3KEW4_BCL2-01          g-----------------------------------------gctca---
A0A452I9V7_BCL2-01      gtatttaactgcatgtgtctgtacgttgcactggagggaaaagcacagta
K7F5Y3_BCL2-01          g-----------------------------------------gctca---
K7F5Y3_BCL2-02          g-----------------------------------------gctca---
A0A3B3TCS4_BCL2-01      g-------------------------------------------gca---
A0A0U3DHY6_BCL2-01      g-------------------------------------------gca---
A0A3P9AAB2_BCL2-01      g-------------------------------------------gca---
                                                                          

X4ZGI8_BCL2-01          ----------------------aacgaaattcgctatgacaatcggaata
Q564A4_BCL2-01          ----------------------aacgaaattagctatgacaatcggaata
B9ZYL7_BCL2-01          -tcctagaag------------aggaggc-----tatgatcaccgggaca
A0A3P8YNB4_BCL2-01      ----------------------gacgacg---------ataaccgtttta
A0A3B4A3G8_BCL2-01      ----------------------aacgact---------gcaatcgcaata
A0A3Q2XQX2_BCL2-01      ----------------------aacgagc---------gaaatcgcacca
A0A3Q2XQX2_BCL2-02      ----------------------aacgagc---------gaaatcgcacca
A0A3P9J8Y9_BCL2-01      ----------------------aacgtgt---------ctaatcgcagta
A0A3Q2PN77_BCL2-01      ----------------------aacgact---------gcaatcgcgaca
A0A3Q3B0R2_BCL2-01      ----------------------g-----t---------g-aatcgcttca
A0A3P8WUE9_BCL2-01      ----------------------agcgagt---------gtaaccgctata
A0A3Q3K1K1_BCL2-01      ----------------------aacgagt---------gtaatcgcaacg
A0A2U9BJ09_BCL2-01      ----------------------agcgagt---------gtaatcgcaata
A0A3Q3MEY1_BCL2-01      ----------------------aacgagt---------gtaatcgcaaca
A0A3Q3G1D7_BCL2-01      ----------------------aacgagt---------gtaatcgcaaca
A0A3Q1I5N1_BCL2-01      ----------------------aacgagt---------gtaatcgcaata
A0A3Q0S5Z7_BCL2-01      ----------------------aacgagt---------ataatcgcaata
A0A3P8QVM8_BCL2-01      ----------------------aacgagt---------ataatcgcaata
A0A3P9DIG5_BCL2-01      ----------------------aacgagt---------ataatcgcaata
A0A3Q2UYW8_BCL2-01      ----------------------aacgagt---------ataatcgcaata
A0A3B4G3K4_BCL2-01      ----------------------aacgagt---------ataatcgcaata
A0A3B4TX71_BCL2-01      ----------------------agcgagt---------ataatcgcaata
A0A3B4YAG2_BCL2-01      ----------------------agcgagt---------ataatcgcaata
A0A3B5BBQ0_BCL2-01      ----------------------aacgagt---------gtaatcgcaata
A0A3Q1B8C3_BCL2-01      ----------------------aacgagt---------gtaatcgcaata
A0A3P8S9L3_BCL2-01      ----------------------aacgagt---------gtaatcgcaata
A0A3Q1FLK7_BCL2-01      ----------------------aacgagt---------gtaatcgcaata
A0A1X9JZA1_BCL2-01      ----------------------aacgagt---------gtaatcgcaaca
A0A4D6FTA2_BCL2-01      ----------------------aacgagc---------gtaaccgcaaca
W5N4F7_BCL2-01          -taacga---------------agccccg-----tacgatactcggaata
H9GPE7_BCL2-01          -tcctgggat------------aagaggt-----tacgacaacagggaaa
F6YNL8_BCL2-01          -ccctggaag------------aagagga-----tatgataaccgggaga
G3WZW9_BCL2-01          -ccctggaag------------aagagga-----tatgataaccgggaaa
G3WZW9_BCL2-02          -ccctggaag------------aagagga-----tatgataaccgggaaa
H0W1T3_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaaa
P10417_BCL2-01          -agccgggag------------aacaggg-----tatgataaccgggaga
Q7TSN8_BCL2-01          -agccgggag------------aacaggg-----tatgataaccgggaga
F1LNV0_BCL2-01          -agccgggag------------aacaggg-----tatgataaccgggaga
P49950_BCL2-01          -agccgggag------------aacaggg-----tatgataaccgggaga
Q6R755_BCL2-01          -agccgggag------------aacaggg-----tatgataaccgggaga
Q9JJV8_BCL2-01          -agctgggag------------aacaggg-----tatgataaccgagaga
Q923R6_BCL2-01          -agctgggag------------aacaggg-----tatgataaccgagaga
O02718_BCL2-01          -cgcgggggg------------aacaggc-----tacgataaccgagaga
A0A4P8GLJ2_BCL2-01      -cgcgggggg------------aacaggc-----tacgataaccgagaga
F6R2C4_BCL2-01          -cgcgggggg------------aacaggc-----tacgataaccgagaga
A0A076FU27_BCL2-01      -cgcgggggg------------cacaggc-----tacgataaccgcgaga
A0A076FZV9_BCL2-01      -cgcgggggg------------cacaggc-----tacgataaccgcgaga
A0A452EV13_BCL2-01      -cgcgggggg------------cacaggc-----tacgataaccgcgaga
G3SLZ1_BCL2-02          -cgcagggag------------aacaggt-----tatgacaaccgggaga
G3SLZ1_BCL2-01          -cgcagggag------------aacaggt-----tatgacaaccgggaga
G1TW27_BCL2-01          -cgccgggcg------------aacaggg-----tacgacaaccgggaga
G1TW27_BCL2-02          -cgccgggcg------------aacaggg-----tacgacaaccgggaga
A0A250YD83_BCL2-01      -agctgggag------------aacaggg-----tatgataaccgggaga
H0WKI0_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaga
A0A2K6G3I7_BCL2-01      -cgccgggag------------aacaggg-----tatgataaccgggaga
A0A2K5PP81_BCL2-01      -agctgggag------------aacaggg-----tacgataaccgggaga
A0A2K5EB04_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgagaga
A0A2K6UEL3_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2R8MY14_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K6R2I5_BCL2-02      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K5HK49_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K6KHG1_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K6R2I5_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K5XRD4_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K5NZS5_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A0D9S017_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K5UDI5_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A2K6CIX3_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A0A096MPU7_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
H2NWH5_BCL2-01          -cgctgggac------------aacaggg-----tacgataaccgggaga
G3QES9_BCL2-01          -cgctgggag------------aacaggg-----tacgataaccgagaga
A0A2I3GZF9_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
A9QXG9_BCL2-01          -cgctgggag------------aacgggg-----tacgataaccgggaga
A0A2R9APW6_BCL2-01      -cgctgggag------------aacaggg-----tacgataaccgggaga
H2QEM8_BCL2-01          -cgctgggag------------aacaggg-----tacgataaccgggaga
I3MVK9_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaga
E2QWA1_BCL2-01          -ccctttcag------------tttgggg-----gatg------------
M3YYK3_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaga
E2QWA1_BCL2-02          -cgctgggcg------------aacaggg-----tacgataaccgggaga
Q75SV7_BCL2-01          -cgctgggcg------------aacaggg-----tacgataaccgggaga
A0A3Q2HRY3_BCL2-02      -cgctgggag------------aacaggg-----tatgataaccgggaga
A0A3Q2HRY3_BCL2-01      -cgctgggag------------aacaggg-----tatgataaccgggaga
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          -cgctgggag------------aacaggg-----tatgataaccgggaga
A0A452T603_BCL2-01      -cgctgggag------------aacaggg-----tatgataaccgggaga
G1LIC9_BCL2-02          -cgctgggag------------aacaggg-----tatgataaccgggaga
M3X1R9_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaga
Q8I008_BCL2-01          -cgctgggag------------aacaggg-----tatgataaccgggaga
Q00709_BCL2-01          -ccccgggag------------aagaggc-----tacgacaaccgcgaga
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      -tccggggag------------aagaggc-----tacgataaccgggaga
H0YUX3_BCL2-01          -tccggggag------------aagaggc-----tacgataaccgggaga
A0A493T1X3_BCL2-01      -tcccgggag------------aagaggc-----tacgataaccgggaga
U3KEW4_BCL2-01          -tccggggag------------aagaggc-----tacgataaccgggaga
A0A452I9V7_BCL2-01      cttctgcaagagcttggagtcaaagaggc-----tatgataaccgggaga
K7F5Y3_BCL2-01          -tcctgggag------------aagaggc-----tatgataaccgggaga
K7F5Y3_BCL2-02          -tcctgggag------------aagaggc-----tatgataaccgggaga
A0A3B3TCS4_BCL2-01      ----------------------aacgacgtcccatacgacagccgaaata
A0A0U3DHY6_BCL2-01      ----------------------aacgagaatccttatgacagtcgcttta
A0A3P9AAB2_BCL2-01      ----------------------aacgagaatccatatgacagtcgcgtca
                                                                          

X4ZGI8_BCL2-01          ttgt-ggagaaatacctcaatcacaaactttcaaagaagggatatgagtg
Q564A4_BCL2-01          ttgt-ggagaaatacctcaagcataaactttcaaagcgaggatatgtgtg
B9ZYL7_BCL2-01          tagt-ggtaaaatatatccattataaactatctcagaaggggtatgcatg
A0A3P8YNB4_BCL2-01      tagt-ggaaaagtacatttgtcacaaactcttaaaacggggatatgcatg
A0A3B4A3G8_BCL2-01      ttgt-ggaaaagtacatttgccataaactctccaaacgtggcttcgcgtg
A0A3Q2XQX2_BCL2-01      ttgt-ggagaattatatctgccataaactctccaaacgcggctacgcgtg
A0A3Q2XQX2_BCL2-02      ttgt-ggagaattatatctgccataaactctccaaacgcggctacgcgtg
A0A3P9J8Y9_BCL2-01      ttgt-agaaaagtacatttgccacaaactctccaagaggggctacgtgtg
A0A3Q2PN77_BCL2-01      tcgt-ggaaaactacatcttccataaactctccaagcgggggtacgcgtg
A0A3Q3B0R2_BCL2-01      ttgt-ggaaaactatatttgccacaaactctccaagcgcggctacgcgtg
A0A3P8WUE9_BCL2-01      tagt-ggaaaagtacatctgccataaactcgccaagcgtgggtacgtgtg
A0A3Q3K1K1_BCL2-01      ttgt-ggaaaagtacatctgccataaactctccaaacggggctacgtgtg
A0A2U9BJ09_BCL2-01      ttgt-ggaaaagtacatctgccataaactctccaagcggggctacgtgtg
A0A3Q3MEY1_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacgcggctacgtgtg
A0A3Q3G1D7_BCL2-01      ttgt-ggaaaagtatatctgtcataaactctccaaacggggctacgagtg
A0A3Q1I5N1_BCL2-01      ttgt-agaaaagtatatctgccataaactctccaaacggggctacgcgtg
A0A3Q0S5Z7_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacggggatacgcgtg
A0A3P8QVM8_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaagcgggggttcgtgtg
A0A3P9DIG5_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaagcgggggttcgtgtg
A0A3Q2UYW8_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaagcgggggttcgtgtg
A0A3B4G3K4_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaagcgggggttcgtgtg
A0A3B4TX71_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacaaggatacgtgtg
A0A3B4YAG2_BCL2-01      ttgt-ggaaaagtacatctgccataaactctccaaacggggatacgtgtg
A0A3B5BBQ0_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacggggctacgcgtg
A0A3Q1B8C3_BCL2-01      ttgt-agaaaagtatatctgccataaactctccaaacggggctacgtgtg
A0A3P8S9L3_BCL2-01      ttgt-agaaaagtatatctgccataaactctccaaacggggctacgtgtg
A0A3Q1FLK7_BCL2-01      ttgt-agaaaagtacatctgccataaactctccaaacggggctacgtgtg
A0A1X9JZA1_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacagggctacgagtg
A0A4D6FTA2_BCL2-01      ttgt-ggaaaagtatatctgccataaactctccaaacagggctacgtgtg
W5N4F7_BCL2-01          tcgt-gacaaaatacatccatcacaaactcctgaagaagggctacgtgtg
H9GPE7_BCL2-01          tcgt-gctgaggtacatccattacaagctgtcgcagaaaggatatgactg
F6YNL8_BCL2-01          tagt-gatgaaatacattcattataaactgtcacagagggggtacgagtg
G3WZW9_BCL2-01          tagt-gatgaaatacattcattataagctatcacagagagggtacgagtg
G3WZW9_BCL2-02          tagt-gatgaaatacattcattataagctatcacagagagggtacga---
H0W1T3_BCL2-01          tagt-gatgaagtacatccactataagctgtcccagagaggctacgagtg
P10417_BCL2-01          tcgt-gatgaagtacatacattataagctgtcacagaggggctacgagtg
Q7TSN8_BCL2-01          tcgt-gatgaagtacatacattataagctgtcacagaggggctacgagtg
F1LNV0_BCL2-01          tcgt-gatgaagtacatccattataagctgtcacagaggggctacgagtg
P49950_BCL2-01          tcgt-gatgaagtacatccattataagctgtcacagaggggctacgagtg
Q6R755_BCL2-01          tcgt-gatgaagtacatacattataagctgtcacagaggggctacgagtg
Q9JJV8_BCL2-01          tcgt-gatgaagtacatccattataagctgtcacagaggggctacgagtg
Q923R6_BCL2-01          tcgt-gatgaagtacatccattataagctgtcacagaggggctacgagtg
O02718_BCL2-01          tcgt-gatgaagtacatccactataagctgtcgcagcggggctacgagtg
A0A4P8GLJ2_BCL2-01      tcgt-gatgaagtacatccactataagctgtcgcagcggggctacgagtg
F6R2C4_BCL2-01          tcgt-gatgaagtacatccactataagctgtcgcagcggggctacgagtg
A0A076FU27_BCL2-01      tcgt-gatgaagtacatccactacaagctgtcgcagcgcggctacgagtg
A0A076FZV9_BCL2-01      tcgt-gatgaagtacatccactacaagctgtcgcagcgcggctacgagtg
A0A452EV13_BCL2-01      tcgt-gatgaagtacatccactacaagctgtcgcagcgcggctacgagtg
G3SLZ1_BCL2-02          tagt-gatgaagtatatccactataagctgtcgcagcggggctacgaatg
G3SLZ1_BCL2-01          tagt-gatgaagtatatccactataagctgtcgcagcggggctacgaatg
G1TW27_BCL2-01          tcgt-gatgaagtacatccactataagctgtcccagaggggctacgagtg
G1TW27_BCL2-02          tcgt-gatgaagtacatccactataagctgtcccagaggggctacgagtg
A0A250YD83_BCL2-01      tagt-gatgaaatacatccactataagctgtcacagaggggctacgagtg
H0WKI0_BCL2-01          tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6G3I7_BCL2-01      tagt-gatgaagtacatccattataagctggcgcagaggggctacgagtg
A0A2K5PP81_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K5EB04_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6UEL3_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2R8MY14_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6R2I5_BCL2-02      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K5HK49_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6KHG1_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6R2I5_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K5XRD4_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K5NZS5_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A0D9S017_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K5UDI5_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A2K6CIX3_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A096MPU7_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
H2NWH5_BCL2-01          tagtcgatgaaa-ncatccattataagttgtcgcagaggggctacgagtg
G3QES9_BCL2-01          tagt-gatgaagtacatccattataagctgtcgcagaggggctacgagtg
A0A2I3GZF9_BCL2-01      tagt-gatgaagtacatccattataagctgtcgcagaggggctacgagtg
A9QXG9_BCL2-01          tagt-gatgaagtacatccattataagctgtcgcagaggggctacgagtg
A0A2R9APW6_BCL2-01      tagt-gatgaagtacatccattataagctgtcgcagaggggctacgagtg
H2QEM8_BCL2-01          tagt-gatgaagtacatccattataagctgtcgcagaggggctacgagtg
I3MVK9_BCL2-01          tagt-gatgaagtacatccactataagctgtcacagaggggctacgagtg
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          tagt-gatgaagtacatccactataagctgtcgcagagggg---------
E2QWA1_BCL2-02          tagt-gatgaagtacatccactacaagctgtcgcagaggggctacgagtg
Q75SV7_BCL2-01          tagt-gatgaagtacatccactacaagctgtcgcagaggggctacgagtg
A0A3Q2HRY3_BCL2-02      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A3Q2HRY3_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          tagt-catgaagtacatccactataagctgtcgcagaggggctacgagtg
A0A452T603_BCL2-01      tagt-gatgaagtacatccactataagctgtcgcagaggggctacga---
G1LIC9_BCL2-02          tagt-gatgaagtacatccactataagctgtcgcagaggggctacgagtg
M3X1R9_BCL2-01          tagt-catgaagtacatccactataagctgtcgcagaggggctacgagtg
Q8I008_BCL2-01          tagt-gatgaagtacatccactatgagctgccgcagaggggctacgagtg
Q00709_BCL2-01          tagt-gctgaagtacatccactataaactctcgcagcggggctacgactg
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      tagt-gctgaagtacatccactataaactctctcagaggggatacgactg
H0YUX3_BCL2-01          tagt-gctgaagtacatccactataaactctctcagaggggatacgactg
A0A493T1X3_BCL2-01      tagt-gctgaagtacatccactataaactctcgcagaggggatacgactg
U3KEW4_BCL2-01          tagt-gctgaagtacatccactataaactctcgcagaggggatacgactg
A0A452I9V7_BCL2-01      tagt-gctgaagtacatccattacaaactgtcacagaggggatatgattg
K7F5Y3_BCL2-01          tagt-gttgaagtacatccattacaaactgtcacagagggggtatgattg
K7F5Y3_BCL2-02          tagt-gttgaagtacatccattacaaactgtcacagagggggtatgattg
A0A3B3TCS4_BCL2-01      ttgt-agagatctatatataccataaactgctgaaaacaggctatgtgtg
A0A0U3DHY6_BCL2-01      ttgt-cgaaaaatacatccataacaaactgttgaagaagggatttgtatg
A0A3P9AAB2_BCL2-01      ttgt-cgaaaattacatctatgataaactgttgaagaatggatttgtttg
                                                                          

X4ZGI8_BCL2-01          gaaatttca-----------------------------------------
Q564A4_BCL2-01          gaaatgtca-----------------------------------------
B9ZYL7_BCL2-01          ggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctg
A0A3P8YNB4_BCL2-01      ggatttcga-----------------------------------------
A0A3B4A3G8_BCL2-01      gggttttca-----------------------------------------
A0A3Q2XQX2_BCL2-01      ggggttcgg-----------------------------------------
A0A3Q2XQX2_BCL2-02      ggggttcgg-----------------------------------------
A0A3P9J8Y9_BCL2-01      tgggctgaa-----------------------------------------
A0A3Q2PN77_BCL2-01      gaggttcga-----------------------------------------
A0A3Q3B0R2_BCL2-01      gggctccga-----------------------------------------
A0A3P8WUE9_BCL2-01      ggagcacga-----------------------------------------
A0A3Q3K1K1_BCL2-01      gggatttca-----------------------------------------
A0A2U9BJ09_BCL2-01      ggggtttga-----------------------------------------
A0A3Q3MEY1_BCL2-01      gggatttca-----------------------------------------
A0A3Q3G1D7_BCL2-01      gggattcga-----------------------------------------
A0A3Q1I5N1_BCL2-01      ggggtttca-----------------------------------------
A0A3Q0S5Z7_BCL2-01      gggatttga-----------------------------------------
A0A3P8QVM8_BCL2-01      gggatttcg-----------------------------------------
A0A3P9DIG5_BCL2-01      gggatttcg-----------------------------------------
A0A3Q2UYW8_BCL2-01      gggatttcg-----------------------------------------
A0A3B4G3K4_BCL2-01      gggatttcg-----------------------------------------
A0A3B4TX71_BCL2-01      gggatttga-----------------------------------------
A0A3B4YAG2_BCL2-01      gggatttga-----------------------------------------
A0A3B5BBQ0_BCL2-01      gggctttga-----------------------------------------
A0A3Q1B8C3_BCL2-01      ggggtttga-----------------------------------------
A0A3P8S9L3_BCL2-01      ggggtttga-----------------------------------------
A0A3Q1FLK7_BCL2-01      ggggtttga-----------------------------------------
A0A1X9JZA1_BCL2-01      ggggtttga-----------------------------------------
A0A4D6FTA2_BCL2-01      ggggtttga-----------------------------------------
W5N4F7_BCL2-01          ggaatcccg-----------------------------------------
H9GPE7_BCL2-01          ggttgccag-----------------------------------------
F6YNL8_BCL2-01          ggatgctgg-----------------------------------------
G3WZW9_BCL2-01          ggatgctgg-----------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          ggatgccgg-----------------------------------------
P10417_BCL2-01          ggatgctgg-----------------------------------------
Q7TSN8_BCL2-01          ggatgctgg-----------------------------------------
F1LNV0_BCL2-01          ggatactgg-----------------------------------------
P49950_BCL2-01          ggatactgg-----------------------------------------
Q6R755_BCL2-01          ggatgtggg-----------------------------------------
Q9JJV8_BCL2-01          ggatgtggg-----------------------------------------
Q923R6_BCL2-01          ggatgtggg-----------------------------------------
O02718_BCL2-01          ggatgccgg-----------------------------------------
A0A4P8GLJ2_BCL2-01      ggatgccgg-----------------------------------------
F6R2C4_BCL2-01          ggatgccgg-----------------------------------------
A0A076FU27_BCL2-01      ggatgccag-----------------------------------------
A0A076FZV9_BCL2-01      ggatgccgg-----------------------------------------
A0A452EV13_BCL2-01      ggatgccgg-----------------------------------------
G3SLZ1_BCL2-02          ggaggctgg-----------------------------------------
G3SLZ1_BCL2-01          ggaggctgg-----------------------------------------
G1TW27_BCL2-01          ggacgctgg-----------------------------------------
G1TW27_BCL2-02          ggacgctgg-----------------------------------------
A0A250YD83_BCL2-01      ggatgccgg-----------------------------------------
H0WKI0_BCL2-01          ggatgctgg-----------------------------------------
A0A2K6G3I7_BCL2-01      ggatgccgg-----------------------------------------
A0A2K5PP81_BCL2-01      ggatgccgg-----------------------------------------
A0A2K5EB04_BCL2-01      ggatgccgg-----------------------------------------
A0A2K6UEL3_BCL2-01      ggatgccgg-----------------------------------------
A0A2R8MY14_BCL2-01      ggatgccgg-----------------------------------------
A0A2K6R2I5_BCL2-02      ggatgcggg-----------------------------------------
A0A2K5HK49_BCL2-01      ggatgcggg-----------------------------------------
A0A2K6KHG1_BCL2-01      ggatgcggg-----------------------------------------
A0A2K6R2I5_BCL2-01      ggatgcggg-----------------------------------------
A0A2K5XRD4_BCL2-01      ggatgcggg-----------------------------------------
A0A2K5NZS5_BCL2-01      ggatgcggg-----------------------------------------
A0A0D9S017_BCL2-01      ggatgcggg-----------------------------------------
A0A2K5UDI5_BCL2-01      ggatgcggg-----------------------------------------
A0A2K6CIX3_BCL2-01      ggatgcggg-----------------------------------------
A0A096MPU7_BCL2-01      ggatgcggg-----------------------------------------
H2NWH5_BCL2-01          ggatgcggg-----------------------------------------
G3QES9_BCL2-01          ggatgcggg-----------------------------------------
A0A2I3GZF9_BCL2-01      ggatgcggg-----------------------------------------
A9QXG9_BCL2-01          ggatgcggg-----------------------------------------
A0A2R9APW6_BCL2-01      ggatgcggg-----------------------------------------
H2QEM8_BCL2-01          ggatgcggg-----------------------------------------
I3MVK9_BCL2-01          ggatgctgg-----------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          -aagaccag-----------------------------------------
E2QWA1_BCL2-02          ggacgcggg-----------------------------------------
Q75SV7_BCL2-01          ggacgcggg-----------------------------------------
A0A3Q2HRY3_BCL2-02      ggatgccgg-----------------------------------------
A0A3Q2HRY3_BCL2-01      ggatgccgg-----------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --atgccgg-----------------------------------------
A0A452R110_BCL2-02      --atgccgg-----------------------------------------
M3X1R9_BCL2-02          ggatgccgg-----------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          ggatgccgg-----------------------------------------
M3X1R9_BCL2-01          ggatgccgg-----------------------------------------
Q8I008_BCL2-01          ggatgccgg-----------------------------------------
Q00709_BCL2-01          ggccgccgg-----------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      ggctgccgg-----------------------------------------
H0YUX3_BCL2-01          ggctgccgg-----------------------------------------
A0A493T1X3_BCL2-01      ggctgccgg-----------------------------------------
U3KEW4_BCL2-01          ggctgccgg-----------------------------------------
A0A452I9V7_BCL2-01      ggctgccaa-----------------------------------------
K7F5Y3_BCL2-01          ggctgccaa-----------------------------------------
K7F5Y3_BCL2-02          ggctgccaa-----------------------------------------
A0A3B3TCS4_BCL2-01      ggaattcca-----------------------------------------
A0A0U3DHY6_BCL2-01      ggaatttca-----------------------------------------
A0A3P9AAB2_BCL2-01      ggaatttca-----------------------------------------
                                                                          

X4ZGI8_BCL2-01          -------------atcttccggggaggat------gatgacactatcaat
Q564A4_BCL2-01          -------------gtcctctgctgaggaa------gatgacaccttcaat
B9ZYL7_BCL2-01          ctattagtaattattctgatgatggagaaatgcctgctgcttccgcagat
A0A3P8YNB4_BCL2-01      ----------------agatgcagaggag------gaagatggtgctaat
A0A3B4A3G8_BCL2-01      ----------------cgaggacgcagaggatgaaggagacgtggccaat
A0A3Q2XQX2_BCL2-01      ----------------tgccgaggacgat------gccgccgctgctaat
A0A3Q2XQX2_BCL2-02      ----------------tgccggggaggag------gacg-----------
A0A3P9J8Y9_BCL2-01      ----------------cggcggccagcgc------gagaatgctgccaat
A0A3Q2PN77_BCL2-01      ----------------cggggtccgggacgac---gacgctgccgctaac
A0A3Q3B0R2_BCL2-01      ----------------ccgcccccgccgcgtccgagacgatgctgccaac
A0A3P8WUE9_BCL2-01      ----------------cgaggaccgagat------ggagacgctgctaat
A0A3Q3K1K1_BCL2-01      ----------------tgatgtccaggat------gaagatgctgctaat
A0A2U9BJ09_BCL2-01      ----------------tgatgtccgagat------gaagatgccgctgat
A0A3Q3MEY1_BCL2-01      ----------------taacgtccaggat------gaagatgctgctaat
A0A3Q3G1D7_BCL2-01      ----------------ggatgagcaggat------gaagatgctgctaat
A0A3Q1I5N1_BCL2-01      ----------------tgatgcccaagac------gaagatgctgctaat
A0A3Q0S5Z7_BCL2-01      ----------------cggtgtccaggat------gaagatgctgctaat
A0A3P8QVM8_BCL2-01      ----------------cgttgtccaagaa------gaagatgctgctaat
A0A3P9DIG5_BCL2-01      ----------------cgttgtccaagaa------gaagatgctgctaat
A0A3Q2UYW8_BCL2-01      ----------------cgttgtccaagaa------gaagatgctgctaat
A0A3B4G3K4_BCL2-01      ----------------cgttgtccaagaa------gaagatgctgctaat
A0A3B4TX71_BCL2-01      ----------------tgatgtccgagat------gaagatgctgctaat
A0A3B4YAG2_BCL2-01      ----------------tgatgtccgagat------gaagatgctgctaat
A0A3B5BBQ0_BCL2-01      ----------------tgatgtccgggat------gaagatgctgctaat
A0A3Q1B8C3_BCL2-01      ----------------tgatgtccgggat------gaagatgctgctaat
A0A3P8S9L3_BCL2-01      ----------------tgatgtccgggat------gaagatgctgctaat
A0A3Q1FLK7_BCL2-01      ----------------tgatgtccgggat------gaagatgctgctaat
A0A1X9JZA1_BCL2-01      ----------------cgctgtccggaat------gcagatgccggtaat
A0A4D6FTA2_BCL2-01      ----------------cgatgtccgggat------gaagatgctgctaat
W5N4F7_BCL2-01          ----------------cgtgtccggcgag------accgatccccccaat
H9GPE7_BCL2-01          ----------------tggagacagag-----------------------
F6YNL8_BCL2-01          ----------------agatctgagggca------ccagcctctccaagt
G3WZW9_BCL2-01          ----------------aaatctgaggaca------ccagcctctccaagt
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          -------------------agacgggagc------gc-------------
P10417_BCL2-01          -------------------agatgcggac------gcggcgcccctgggg
Q7TSN8_BCL2-01          -------------------agatgcggac------gcggcgcccctgggg
F1LNV0_BCL2-01          -------------------agatgaagac------tccgcgcccctgagg
P49950_BCL2-01          -------------------agatgaagac------tccgcgcccctgagg
Q6R755_BCL2-01          -------------------agatgtggac------gccgcgcccctgggc
Q9JJV8_BCL2-01          -------------------agatgtggac------gccgcgcccctgggc
Q923R6_BCL2-01          -------------------agatgtggac------gccgcgcccctgggc
O02718_BCL2-01          -------------------agacgcgggc------gccgcgccccccggg
A0A4P8GLJ2_BCL2-01      -------------------agacgcgggc------gccgcgccccccggg
F6R2C4_BCL2-01          -------------------agacgcgggc------gccgcgccccccggg
A0A076FU27_BCL2-01      -------------------agccgcgggc------gccgcgccccccggg
A0A076FZV9_BCL2-01      -------------------agccgcgggc------gccgcgccccccggg
A0A452EV13_BCL2-01      -------------------agccgcgggc------gccgcgccccccggg
G3SLZ1_BCL2-02          -------------------cgaagct------------------------
G3SLZ1_BCL2-01          -------------------cgaagctagc------gccgcgccccccggg
G1TW27_BCL2-01          -------------------ggacgcgggc---------------------
G1TW27_BCL2-02          -------------------ggacgcgggc---------------------
A0A250YD83_BCL2-01      -------------------agacgtgggc------gccgcgcccccggag
H0WKI0_BCL2-01          -------------------agacgtgggc------gttgcaccccccggg
A0A2K6G3I7_BCL2-01      -------------------agacgcgggc------gctgcgcccccgggg
A0A2K5PP81_BCL2-01      -------------------agatgtgggc------gccgcgcccccaggg
A0A2K5EB04_BCL2-01      -------------------agatgtgggc------gccgcacccccaggg
A0A2K6UEL3_BCL2-01      -------------------agatgtgggc------gccgcgcccccaggc
A0A2R8MY14_BCL2-01      -------------------agatgtgggc------gccgcgcccccaggg
A0A2K6R2I5_BCL2-02      -------------------agatgtgggc------gccgcgacccctggg
A0A2K5HK49_BCL2-01      -------------------ggatgtggga------gccgcgacccctggg
A0A2K6KHG1_BCL2-01      -------------------agatgtgggc------gccgcgacccctggg
A0A2K6R2I5_BCL2-01      -------------------agatgtgggc------gccgcgacccctggg
A0A2K5XRD4_BCL2-01      -------------------ggatgtgggc------gcggcgacccctggg
A0A2K5NZS5_BCL2-01      -------------------ggatgtgggc------gcggcgacccctggg
A0A0D9S017_BCL2-01      -------------------ggatgtgggc------gccgcgacccctggg
A0A2K5UDI5_BCL2-01      -------------------ggatgtgggc------gcggcgacccctggg
A0A2K6CIX3_BCL2-01      -------------------ggatgtgggc------gcggcgacccctggg
A0A096MPU7_BCL2-01      -------------------ggat---ggc------gcggcgacccctggg
H2NWH5_BCL2-01          -------------------agatgtgggc------gccgcgcccccgggg
G3QES9_BCL2-01          -------------------agatgtgggc------gccgtgcccccgggg
A0A2I3GZF9_BCL2-01      -------------------agatgtgggc------gccgcgcccccgggg
A9QXG9_BCL2-01          -------------------agatgtgggc------gccgcgcccccgggg
A0A2R9APW6_BCL2-01      -------------------agatgtgggc------gccgcgccc------
H2QEM8_BCL2-01          -------------------agatgtgggc------gccgcgcccccgggg
I3MVK9_BCL2-01          -------------------agacgtgggc------gctgcgtccccagga
E2QWA1_BCL2-01          -------------------------------------------cccagtg
M3YYK3_BCL2-01          -------------------tga--tgaaa------ctcgtgtacttaccc
E2QWA1_BCL2-02          -------------------agaggcgggc------gccgcgcccccgggg
Q75SV7_BCL2-01          -------------------agaggcgggc------gccgcgcccccgggg
A0A3Q2HRY3_BCL2-02      -------------------agacgcgggc------gccgcgcccctgggg
A0A3Q2HRY3_BCL2-01      -------------------agacgcgggc------gccgcgcccctgggg
G1LIC9_BCL2-01          ------------------------------------------cccca---
A0A452R110_BCL2-01      -------------------agacgcgggc------gccgcgcccccgggg
A0A452R110_BCL2-02      -------------------agacgcgggc------gccgcgcccccgggg
M3X1R9_BCL2-02          -------------------ggacgcgggc------gccgcgcccccgggg
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          -------------------agacgcgg-----------------------
M3X1R9_BCL2-01          -------------------ggacgcgggc------gccgcgcccccgggg
Q8I008_BCL2-01          -------------------ggacgcgggc------gccgcgcccccgggg
Q00709_BCL2-01          ----------------cgaggacaggccg------cccgtgcccccggcc
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      ----------------tgaggacagggta------tccctgcctccagat
H0YUX3_BCL2-01          ----------------cgaggacagggca------tccctgcctccagat
A0A493T1X3_BCL2-01      ----------------cgaggacagggcg------cccgcgcctacggct
U3KEW4_BCL2-01          ----------------cgagcacagggca------cccctgcctccaggt
A0A452I9V7_BCL2-01      ----------------tgaaaacagagga------ccagtttcaccaaat
K7F5Y3_BCL2-01          ----------------tgaaaacagagga------ccagtttcttcaagt
K7F5Y3_BCL2-02          ----------------tgaaaacagagga------ccagtttcttcaagt
A0A3B3TCS4_BCL2-01      ----------------ggcggccggagac------accgattctcccaat
A0A0U3DHY6_BCL2-01      ----------------agc------agaa------aacgattctccaaat
A0A3P9AAB2_BCL2-01      ----------------aac------agag------aaccaatctcgaaat
                                                                          

X4ZGI8_BCL2-01          --------acgggagtgga-------------------------------
Q564A4_BCL2-01          --------aaagcagtgga-------------------------------
B9ZYL7_BCL2-01          tcacgtggaccacctcagt-----------------------------ct
A0A3P8YNB4_BCL2-01      --------aatgggtcgat-------------------------------
A0A3B4A3G8_BCL2-01      --------aacggttcgat-------------------------------
A0A3Q2XQX2_BCL2-01      --------aacggcttatt-------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------aacggctcggt-------------------------------
A0A3Q2PN77_BCL2-01      --------ggaggcttg---------------------------------
A0A3Q3B0R2_BCL2-01      --------aacggctcggt-------------------------------
A0A3P8WUE9_BCL2-01      --------aatggctcaat-------------------------------
A0A3Q3K1K1_BCL2-01      --------aatgggtcaat-------------------------------
A0A2U9BJ09_BCL2-01      --------aacgggtcgat-------------------------------
A0A3Q3MEY1_BCL2-01      --------aatggctctgt-------------------------------
A0A3Q3G1D7_BCL2-01      --------aacgggtcatt-------------------------------
A0A3Q1I5N1_BCL2-01      --------aatgggtctgc-------------------------------
A0A3Q0S5Z7_BCL2-01      --------aacgggtcaat-------------------------------
A0A3P8QVM8_BCL2-01      --------aacggatcgat-------------------------------
A0A3P9DIG5_BCL2-01      --------aacggatcgat-------------------------------
A0A3Q2UYW8_BCL2-01      --------aacggatcgat-------------------------------
A0A3B4G3K4_BCL2-01      --------aacggatcgat-------------------------------
A0A3B4TX71_BCL2-01      --------aatggctcaat-------------------------------
A0A3B4YAG2_BCL2-01      --------aatggctcaat-------------------------------
A0A3B5BBQ0_BCL2-01      --------aacgggtcagt-------------------------------
A0A3Q1B8C3_BCL2-01      --------aacgggtcagt-------------------------------
A0A3P8S9L3_BCL2-01      --------aacgggtcagt-------------------------------
A0A3Q1FLK7_BCL2-01      --------aacgggtcagt-------------------------------
A0A1X9JZA1_BCL2-01      --------aatgggtcaat-------------------------------
A0A4D6FTA2_BCL2-01      --------aacgggtcaat-------------------------------
W5N4F7_BCL2-01          --------aacgg-------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------cttcctcctgt---------------------tgttgcttct
G3WZW9_BCL2-01          --------cttcctcctgt---------------------tgttgcttct
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------gctgcccccac-------------------------------
Q7TSN8_BCL2-01          --------gctgcccccac-------------------------------
F1LNV0_BCL2-01          --------gctgcccccac-------------------------------
P49950_BCL2-01          --------gctgcccccac-------------------------------
Q6R755_BCL2-01          --------gccgcccccac-------------------------------
Q9JJV8_BCL2-01          --------gccgcccccac-------------------------------
Q923R6_BCL2-01          --------gccgcccccac-------------------------------
O02718_BCL2-01          --------gccgctcccgc-------------------------------
A0A4P8GLJ2_BCL2-01      --------gccgctcccgc-------------------------------
F6R2C4_BCL2-01          --------gccgctcccgc-------------------------------
A0A076FU27_BCL2-01      --------gccgcccccgc-------------------------------
A0A076FZV9_BCL2-01      --------gccgctcccgc-------------------------------
A0A452EV13_BCL2-01      --------gccgcccccgc-------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------gccgctcccgc-------------------------------
G1TW27_BCL2-01          --------gccgcctccgc-------------------------------
G1TW27_BCL2-02          --------gccgcctccgc-------------------------------
A0A250YD83_BCL2-01      --------gccaccccagc-------------------------------
H0WKI0_BCL2-01          --------gccgccactgc-------------------------------
A0A2K6G3I7_BCL2-01      --------gccgcccccac-------------------------------
A0A2K5PP81_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K5EB04_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K6UEL3_BCL2-01      --------gccgcccccgc-------------------------------
A0A2R8MY14_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K6R2I5_BCL2-02      --------gccgcccccgc-------------------------------
A0A2K5HK49_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K6KHG1_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K6R2I5_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K5XRD4_BCL2-01      --------gtcgcccccgc-------------------------------
A0A2K5NZS5_BCL2-01      --------gtcgcccccgc-------------------------------
A0A0D9S017_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K5UDI5_BCL2-01      --------gccgcccccgc-------------------------------
A0A2K6CIX3_BCL2-01      --------gccgcccccgc-------------------------------
A0A096MPU7_BCL2-01      --------gccgcccccgc-------------------------------
H2NWH5_BCL2-01          --------gccgccaccgc-------------------------------
G3QES9_BCL2-01          --------gccgcccccgc-------------------------------
A0A2I3GZF9_BCL2-01      --------gccgcccccgc-------------------------------
A9QXG9_BCL2-01          --------gccgcccccgc-------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------gccgcccccgc-------------------------------
I3MVK9_BCL2-01          --------gccgcccccgg-------------------------------
E2QWA1_BCL2-01          --------tccttttccgg-------------------------------
M3YYK3_BCL2-01          --------accgccccccc-------------------------------
E2QWA1_BCL2-02          --------gccgcccccgc-------------------------------
Q75SV7_BCL2-01          --------gccgcccccgc-------------------------------
A0A3Q2HRY3_BCL2-02      --------gccacccccgt-------------------------------
A0A3Q2HRY3_BCL2-01      --------gccacccccgt-------------------------------
G1LIC9_BCL2-01          -------------ccccgc-------------------------------
A0A452R110_BCL2-01      --------gccgcccccgc-------------------------------
A0A452R110_BCL2-02      --------gccgcccccgc-------------------------------
M3X1R9_BCL2-02          --------gccgcccccgc-------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------gccgcccccgc-------------------------------
Q8I008_BCL2-01          --------gccgcccccgc-------------------------------
Q00709_BCL2-01          --------ccggctcccgc---------------tgctgctcccgctgcg
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------cactccgcttc---------------tgctgctgctgcgat-
H0YUX3_BCL2-01          --------cactccgcttctgctgctgctgcgattgctgctgctgcgat-
A0A493T1X3_BCL2-01      --------ctc---gctcc---------------tgctgctgctgcggt-
U3KEW4_BCL2-01          --------ctctctgctcc---------------tgctgctgctgcggtt
A0A452I9V7_BCL2-01      --------ctctctccccc-------------------------------
K7F5Y3_BCL2-01          --------ctctctcctcc-------------------------------
K7F5Y3_BCL2-02          --------ctctctcctcc-------------------------------
A0A3B3TCS4_BCL2-01      --------aatggatcggt-------------------------------
A0A0U3DHY6_BCL2-01      --------aatttatttgg-------------------------------
A0A3P9AAB2_BCL2-01      --------aacgtctttga-------------------------------
                                                                          

X4ZGI8_BCL2-01          ------------ggactcctctccgag--------ctctgacaggaggct
Q564A4_BCL2-01          ------------ggaatcctctccaaa--------ctctgacaggaggct
B9ZYL7_BCL2-01          tcactcgcatctgctgcttcctcagatgaggaaaccccaagtaatactcc
A0A3P8YNB4_BCL2-01      ------------gatttctcctccgccgg------gtttggt---acggc
A0A3B4A3G8_BCL2-01      ------------agttgcatcttctccgg------ttctggtgaaccgtc
A0A3Q2XQX2_BCL2-01      ------------ggttgcaccctcgccga------ctttggt---gctcc
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      ------------tggggaccattccccga------ctccggt---ccgcc
A0A3Q2PN77_BCL2-01      ------------ggtga-ccgctcgccga------ctttggt---ccggc
A0A3Q3B0R2_BCL2-01      ------------ggcgagccagtccccga------ccctggt---ccgga
A0A3P8WUE9_BCL2-01      ------------agtttcccgtccaccga------ctctggt---tcacc
A0A3Q3K1K1_BCL2-01      ------------agttgcccctccaccga------ctttggt---tcgtc
A0A2U9BJ09_BCL2-01      ------------agttgcccctccaccga------ctctggt---gcgcc
A0A3Q3MEY1_BCL2-01      ------------agttgcccctccgccga------ctgtggt---ccgcc
A0A3Q3G1D7_BCL2-01      ------------agttgcccctccgccga------ctttggt---tcgcc
A0A3Q1I5N1_BCL2-01      ------------agttccccctccaccga------ctttggt---ccggc
A0A3Q0S5Z7_BCL2-01      ------------aaatgaccctccaccga------ctttggt---ccgcc
A0A3P8QVM8_BCL2-01      ------------aactgaccctccaccga------ctttggt---ccacc
A0A3P9DIG5_BCL2-01      ------------aactgaccctccaccga------ctttggt---ccacc
A0A3Q2UYW8_BCL2-01      ------------aactgaccctccaccga------ctttggt---ccacc
A0A3B4G3K4_BCL2-01      ------------aactgaccctccaccga------ctttggt---ccacc
A0A3B4TX71_BCL2-01      ------------agttgcccctccaccga------ctttggt---ccgcc
A0A3B4YAG2_BCL2-01      ------------agttgcccctccaccga------ctttggt---ccgcc
A0A3B5BBQ0_BCL2-01      ------------agttgaccctccgccga------ctttggt---gcgcc
A0A3Q1B8C3_BCL2-01      ------------agtggaccctccgccga------ctttggt---ccgtc
A0A3P8S9L3_BCL2-01      ------------agtggaccctccgccga------ctttggt---ccgtc
A0A3Q1FLK7_BCL2-01      ------------agttgaccctccgccga------ctttggt---ccgtc
A0A1X9JZA1_BCL2-01      ------------agttgcccctccaccga------gtttggt---ccgcc
A0A4D6FTA2_BCL2-01      ------------agttgctcctccaccga------ctttagt---ccgcc
W5N4F7_BCL2-01          --------attggtgggcccctccgcctc----------gggtccggggc
H9GPE7_BCL2-01          --------gaaagtcagcatctctttccc---------------------
F6YNL8_BCL2-01          gcccctgctgttggaatcttctctaccca------gccacgaaacacacc
G3WZW9_BCL2-01          gcccctgctgttggaatcttctctaacca------gccaagacatacacc
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          -----------------------------------actgggtcgcaactc
P10417_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccc
Q7TSN8_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccc
F1LNV0_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccg
P49950_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccg
Q6R755_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccc
Q9JJV8_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccc
Q923R6_BCL2-01          --------ccctggcatcttctccttcca------gcctgagagcaaccc
O02718_BCL2-01          --------gccgggcatcctgtcctccca------gccgggccgcacacc
A0A4P8GLJ2_BCL2-01      --------gccgggcatcctgtcctccca------gccgggccgcacacc
F6R2C4_BCL2-01          --------gccgggcatcctgtcctccca------gccgggccgcacacc
A0A076FU27_BCL2-01      --------gccgggcatcctgtcctccca------gccgggccgcacacc
A0A076FZV9_BCL2-01      --------gccgggcatcctgtcctccca------gccgggccgcacacc
A0A452EV13_BCL2-01      --------gccgggcatcctgtcctccca------gccgggccgcgcgcc
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------gccgggcgtcctctcttctcc------gcccgcg--------
G1TW27_BCL2-01          --------gccgggcgtcttctcctccca------gcccgcgc-------
G1TW27_BCL2-02          --------gccgggcgtcttctcctccca------gcccgcgc-------
A0A250YD83_BCL2-01      --------gccgggcatcttctccttcca------gcccgggagcaaccc
H0WKI0_BCL2-01          --------gccgggcgtcttctcctccca------gcccgggcgcacccc
A0A2K6G3I7_BCL2-01      --------gccgggcatcttctcctccca------gcccgggcgcaaccc
A0A2K5PP81_BCL2-01      --------gccgggcatcttctcctccca------gcccgggcacacgcc
A0A2K5EB04_BCL2-01      --------gccgggcatcttctcctccca------gcctggacacacgcc
A0A2K6UEL3_BCL2-01      --------gccgggcatcttctcctccca------gcccgggcacacgcc
A0A2R8MY14_BCL2-01      --------ggagggcatcttctcttccca------gcccgggcacacgcc
A0A2K6R2I5_BCL2-02      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K5HK49_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K6KHG1_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K6R2I5_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K5XRD4_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K5NZS5_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A0D9S017_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K5UDI5_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2K6CIX3_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A096MPU7_BCL2-01      --------accgggcatcttctcctccca------gcccgggcacacgcc
H2NWH5_BCL2-01          --------acccggcatcttctcctccca------gcccgggcacacgcc
G3QES9_BCL2-01          --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2I3GZF9_BCL2-01      --------accgggcatcttctcctccca------gccggggcacacgcc
A9QXG9_BCL2-01          --------accgggcatcttctcctccca------gcccgggcacacgcc
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------accgggcatcttctcctccca------gcccgggcacacgcc
I3MVK9_BCL2-01          --------gccgggcatcttctcttccca------accggggagccatac
E2QWA1_BCL2-01          --------gccagaacttgcttccccccc------cccc-----------
M3YYK3_BCL2-01          --------cccaccccccctctcccgcca------cc-------------
E2QWA1_BCL2-02          --------gccgggcatctccgcctcgca------gnnnnnnnnnnnnn-
Q75SV7_BCL2-01          --------gccgggcatcttctcctcgca------gcccggccgcgcccc
A0A3Q2HRY3_BCL2-02      --------gccgggcatcttctcctccca------gcccgggcgcacccc
A0A3Q2HRY3_BCL2-01      --------gccgggcatcttctcctccca------gcccgggcgcacccc
G1LIC9_BCL2-01          --------agcg---------tccccccg------gccc-----------
A0A452R110_BCL2-01      --------gccgggcatcttctcctccca------gcctgggctcacccc
A0A452R110_BCL2-02      --------gccgggcatcttctcctccca------gcctgggctcacccc
M3X1R9_BCL2-02          --------gccgggcatcttctcctccca------gcccgggcgcacccc
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------gccgggcatcttctcctccca------gcccgggcgcacccc
Q8I008_BCL2-01          --------gccgggcatcttctcctccca------gcccgggcgcacccc
Q00709_BCL2-01          gtggctgctgctggagcctcctcccacca---------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --tgctgctgctgggact---tctgatca------cactgggctggtgtc
H0YUX3_BCL2-01          --tgctgctgctgggact---tctgatca------cactgggctggtgtc
A0A493T1X3_BCL2-01      --tgctgctgctgggactccctcccgccaccgccccgccgggctgctgtc
U3KEW4_BCL2-01          gctgctgctgctgggacttcctctgatca------cactgggccggtgtc
A0A452I9V7_BCL2-01      --tactgttactgggacctcatctgacca------tgctgggctgatgtc
K7F5Y3_BCL2-01          --tgctg---ctgggaccccatctgacca------tgctgggctggtgtc
K7F5Y3_BCL2-02          --tgctg---ctgggaccccatctgacca------tgctgggctggtgtc
A0A3B3TCS4_BCL2-01      ------------ggactcccct---cccg-------gctctc---aagtt
A0A0U3DHY6_BCL2-01      ------------ggacccctctacaccca-------acacccccgaagtt
A0A3P9AAB2_BCL2-01      ------------ggatccctctcccccca-------actcccccgaactt
                                                                          

X4ZGI8_BCL2-01          ccaggctccctcagc--------------cggagggggaaacaactctga
Q564A4_BCL2-01          tcaggctccctcagc--------------cggcggagggaacaactctga
B9ZYL7_BCL2-01          aataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctg
A0A3P8YNB4_BCL2-01      ggat-------------------------tcatggggccagta-------
A0A3B4A3G8_BCL2-01      ggtg-------------------------ccgcgc---------------
A0A3Q2XQX2_BCL2-01      ggtg-------------------------ccgcgaagccagct------c
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      gccg-------------------------ctgcgacgcaggaa------c
A0A3Q2PN77_BCL2-01      gctg-------------------------ccgcgacgc---agcggcacc
A0A3Q3B0R2_BCL2-01      ggtg-------------------------ccgcggcgcacgaggagcccc
A0A3P8WUE9_BCL2-01      ggtg-------------------------ccgtggtgccagca------c
A0A3Q3K1K1_BCL2-01      ggtg-------------------------ccgtgaagccagca------c
A0A2U9BJ09_BCL2-01      ggtg-------------------------ccatggagccagca------c
A0A3Q3MEY1_BCL2-01      ggtg-------------------------ccgtgacgcgagca------c
A0A3Q3G1D7_BCL2-01      ggtg-------------------------ccgtgaagcgagct------c
A0A3Q1I5N1_BCL2-01      ggtg-------------------------ccgtgaagccagca------c
A0A3Q0S5Z7_BCL2-01      ggtg-------------------------ccgagaacccagca------a
A0A3P8QVM8_BCL2-01      ggtg-------------------------ccgagaagccagca------c
A0A3P9DIG5_BCL2-01      ggtg-------------------------ccgagaagccagca------c
A0A3Q2UYW8_BCL2-01      ggtg-------------------------ccgagaagccagca------c
A0A3B4G3K4_BCL2-01      ggtg-------------------------ccgagaagccagca------c
A0A3B4TX71_BCL2-01      ggtg-------------------------ccgtgaagccaaca------c
A0A3B4YAG2_BCL2-01      ggtg-------------------------ccgtgaagccaaca------c
A0A3B5BBQ0_BCL2-01      ggtg-------------------------ccatgaagccagca------c
A0A3Q1B8C3_BCL2-01      ggtg-------------------------ccatgaagccagca------c
A0A3P8S9L3_BCL2-01      ggtg-------------------------ccatgaagccagca------c
A0A3Q1FLK7_BCL2-01      ggtg-------------------------ccatgaagccagca------c
A0A1X9JZA1_BCL2-01      ggtg-------------------------ccgtggagccagca------c
A0A4D6FTA2_BCL2-01      ggtg-------------------------ccgtgaggccagca------c
W5N4F7_BCL2-01          tgcaggcgcggcggctccagg--------ctgccggggccgagc------
H9GPE7_BCL2-01          --------cagagcttctcaattctgatcctgtgagtaccaa--------
F6YNL8_BCL2-01          attgcctgctgc--------------------------------------
G3WZW9_BCL2-01          tctgcctgctgcaccccaggacttggccacttctactactgctgctgcta
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          cccgcttggtgtgccccgggacccgg---ccgccaggacctcgcc-----
P10417_BCL2-01          aatgcccgctgtgcaccgggacatgg---ctgccaggacgtctcc-----
Q7TSN8_BCL2-01          aatgcccgctgtgcaccgggacatgg---ctgccaggacgtctcc-----
F1LNV0_BCL2-01          gacgcccgctgtgcaccgagacacgg---ctgccaggacgtcgcc-----
P49950_BCL2-01          aacgcccgctgtgcaccgagacacgg---ctgccaggacgtcgcc-----
Q6R755_BCL2-01          aacgcccgctgtgcaccgggacatgg---ctgccaggacatcgcc-----
Q9JJV8_BCL2-01          aacgcccgctgtgcaccgggacatgg---ctgccaggacatcgcc-----
Q923R6_BCL2-01          aacgcccgctgtgcaccgggacatgg---ctgccaggacatcgcc-----
O02718_BCL2-01          cg---------------------ccc---cctccaggacctcccc-----
A0A4P8GLJ2_BCL2-01      cg---------------------cgc---cctccaggacctcccc-----
F6R2C4_BCL2-01          cg---------------------cgc---cctccaggacctcccc-----
A0A076FU27_BCL2-01      cg---------------------cgc---cctccaggacctcccc-----
A0A076FZV9_BCL2-01      cg---------------------cgc---cctccaggacctcccc-----
A0A452EV13_BCL2-01      cg---------------------cgc---cctccaggacctcccc-----
G3SLZ1_BCL2-02          -------------------------g---acaccaggacctcgcc-----
G3SLZ1_BCL2-01          ----------gcgccccggggcccgg---acaccaggacctcgcc-----
G1TW27_BCL2-01          -----ccgctgcgccccgggacccgg---ccgccaggacctcgcc-----
G1TW27_BCL2-02          -----ccgctgcgccccgggacccgg---ccgccaggacctcgcc-----
A0A250YD83_BCL2-01      cctgcccgctgcgccccgggaccggg---ccgccaggaccacgtc-----
H0WKI0_BCL2-01          tactcccgctgcgccccgggacccgg---ccgccaggacctcgcc-----
A0A2K6G3I7_BCL2-01      ccctcccgctgcgcctcgggacccgg---ccgccaggacctcgcc-----
A0A2K5PP81_BCL2-01      cggtcccgccgcgccccgggacccgg---tcgccaggacctcgcc-----
A0A2K5EB04_BCL2-01      cggtcccgccgcgccccgggacccgg---tctccaggacctcgcc-----
A0A2K6UEL3_BCL2-01      cggtcccgctgcgccccgggaccctg---tcgccaggaccnnnnn-----
A0A2R8MY14_BCL2-01      cggtcccgccgcgccccgggacccgg---tcgccaggacctcgcc-----
A0A2K6R2I5_BCL2-02      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K5HK49_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K6KHG1_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K6R2I5_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K5XRD4_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K5NZS5_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A0D9S017_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K5UDI5_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A2K6CIX3_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
A0A096MPU7_BCL2-01      ccatcccgccgcgtcccgggacccgg---tcgccaggacctcgcc-----
H2NWH5_BCL2-01          tcatccagccgcatcccgggacccg------gccaggacctcgcc-----
G3QES9_BCL2-01          ccatccagccgcatcccgggaccggg---tcgccaggacctcgcc-----
A0A2I3GZF9_BCL2-01      ccatccagctgcatcccgggacccgg---tcgccaggacctcgcc-----
A9QXG9_BCL2-01          ccatccagccgcatcccgggacccgg---tcgccaggacctcgcc-----
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          ccatccagccgcatcccgggacccgg---tcgccaggacctcgcc-----
I3MVK9_BCL2-01          cc---------------------cgg---ccgccaggacctcgcc-----
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          -------------------------g---ccgcccgcagctcacc-----
E2QWA1_BCL2-02          -----------------------------------------nnnn-----
Q75SV7_BCL2-01          cg---------------------cgc---ccgccaggacctcgcc-----
A0A3Q2HRY3_BCL2-02      cg---------------------cgc---ccgccaggacctcccc-----
A0A3Q2HRY3_BCL2-01      cg---------------------cgc---ccgccaggacctcccc-----
G1LIC9_BCL2-01          -------------------------t---tcgtgaggcgctggca-----
A0A452R110_BCL2-01      cg---------------------cgc---ccgccaggacctcgcc-----
A0A452R110_BCL2-02      cg---------------------cgc---ccgccaggacctcgcc-----
M3X1R9_BCL2-02          tg---------------------cgc---ccgccaggacctcccc-----
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          tg---------------------cgc---ccgccaggacctcccc-----
Q8I008_BCL2-01          tg---------------------cgc---ccgccaggacctcccc-----
Q00709_BCL2-01          ---ccgccccgagccccccggctcggctgctgctagtgaggtgcc-----
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      tccgcaccccgagccccccggctcggctactgctagccacacgcc-----
H0YUX3_BCL2-01          tccgcaccccgagccccccggctcggctactgctagccacacgcc-----
A0A493T1X3_BCL2-01      cccgcaccccgagccccccggctcggctgctgctagcgaggcgcc-----
U3KEW4_BCL2-01          tccgcaccccgagccccccggctcggctgctgctagccccgcgcc-----
A0A452I9V7_BCL2-01      tctgcctcctgagccccctggctcggctgctgctagtaacgtgcc-----
K7F5Y3_BCL2-01          tttgccgcctgaaccccctggttcggctgctgctagtaatgtgcc-----
K7F5Y3_BCL2-02          tttgccgcctgaaccccctggttcggctgctgctagtaatgtgcc-----
A0A3B3TCS4_BCL2-01      ttggcacgccggtcccaagcagctgccgccggcggagaggacgcgtc---
A0A0U3DHY6_BCL2-01      tttgcacggaggtcccagcccaccgccgcggtcgaggacaccgactc---
A0A3P9AAB2_BCL2-01      tttgcacggaggctccaacctcccgccgctggcgaggacaacgaccc---
                                                                          

X4ZGI8_BCL2-01          atgcct--------------------------------------------
Q564A4_BCL2-01          atgcct--------------------------------------------
B9ZYL7_BCL2-01          ctgtttcacccttagctgaattgaatgtcgaaccaagagatcttaatgtt
A0A3P8YNB4_BCL2-01      -aagccggacag-ggcagcg------------------------------
A0A3B4A3G8_BCL2-01      --------------agagcg------------------------------
A0A3Q2XQX2_BCL2-01      cgggcccgagcgcgactgcg------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      ggggcctgacgaggagagca------------------------------
A0A3Q2PN77_BCL2-01      ggggcaagacagcgacggcg------------------------------
A0A3Q3B0R2_BCL2-01      aggaggag-caggaacggcg------------------------------
A0A3P8WUE9_BCL2-01      cgggcctgggaacgacggca------------------------------
A0A3Q3K1K1_BCL2-01      tgggcctgacagcgagagca------------------------------
A0A2U9BJ09_BCL2-01      cgggcccgacgacgagagcc------------------------------
A0A3Q3MEY1_BCL2-01      cgggcccgacagcgagagca------------------------------
A0A3Q3G1D7_BCL2-01      cgggcctgaccgtgagagca------------------------------
A0A3Q1I5N1_BCL2-01      cgggcctgacagcgacagca------------------------------
A0A3Q0S5Z7_BCL2-01      cgggcctgacggcgagagca------------------------------
A0A3P8QVM8_BCL2-01      cgggcctgacggcgagagca------------------------------
A0A3P9DIG5_BCL2-01      cgggcctgacggcgagagca------------------------------
A0A3Q2UYW8_BCL2-01      cgggcctgacggcgagagca------------------------------
A0A3B4G3K4_BCL2-01      cgggcctgacggcgagagca------------------------------
A0A3B4TX71_BCL2-01      cgggcctgacaacgacagct------------------------------
A0A3B4YAG2_BCL2-01      cgggcctgacaacgacagct------------------------------
A0A3B5BBQ0_BCL2-01      cgggcccgacaacgagagcg------------------------------
A0A3Q1B8C3_BCL2-01      cgggcccgacaacgagagcg------------------------------
A0A3P8S9L3_BCL2-01      cgggcccgacaacgagagcg------------------------------
A0A3Q1FLK7_BCL2-01      cgggcccgacaacgagagcg------------------------------
A0A1X9JZA1_BCL2-01      cgggcccgacagcgagagca------------------------------
A0A4D6FTA2_BCL2-01      cgggcctgacaccgagagca------------------------------
W5N4F7_BCL2-01          ---gcggagctgtcccggtc------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          gaaactcacctttgcctcct------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          ---acc-gccacccctggcc------------------------------
P10417_BCL2-01          ---tct-caggcccctcgtt------------------------------
Q7TSN8_BCL2-01          ---tct-caggcccctcgtt------------------------------
F1LNV0_BCL2-01          ---tct-acggccccttgtc------------------------------
P49950_BCL2-01          ---tct-acggccccttgtc------------------------------
Q6R755_BCL2-01          ---act-aaggcccatagtc------------------------------
Q9JJV8_BCL2-01          ---act-aaggcccatagtc------------------------------
Q923R6_BCL2-01          ---act-aaggcccatagtc------------------------------
O02718_BCL2-01          ---gcc-gccgcccccggcc------------------------------
A0A4P8GLJ2_BCL2-01      ---gcc-gccgcccccggcc------------------------------
F6R2C4_BCL2-01          ---gcc-gccgcccccggcc------------------------------
A0A076FU27_BCL2-01      ---gcc-gccgcccccggcc------------------------------
A0A076FZV9_BCL2-01      ---gcc-gccgcccccggcc------------------------------
A0A452EV13_BCL2-01      ---gcc-gccgcccccggcc------------------------------
G3SLZ1_BCL2-02          ---gct-------ccaggct------------------------------
G3SLZ1_BCL2-01          ---gct-------ccaggct------------------------------
G1TW27_BCL2-01          ---gcc-gccgccgccggc-------------------------------
G1TW27_BCL2-02          ---gcc-gccgccgccggc-------------------------------
A0A250YD83_BCL2-01      ---gct-gccgcccccggtc------------------------------
H0WKI0_BCL2-01          ---ccc-ggccgcccccgcc------------------------------
A0A2K6G3I7_BCL2-01      ---ccc-gc-----------------------------------------
A0A2K5PP81_BCL2-01      ---gcc-gtcgcccccggcc------------------------------
A0A2K5EB04_BCL2-01      ---gcc-gccgcccccggcc------------------------------
A0A2K6UEL3_BCL2-01      ---nnn-nnnnnnnnnnnnn------------------------------
A0A2R8MY14_BCL2-01      ---gcc-gccgcccccagcc------------------------------
A0A2K6R2I5_BCL2-02      ---gct-gccgaccccggct------------------------------
A0A2K5HK49_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A2K6KHG1_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A2K6R2I5_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A2K5XRD4_BCL2-01      ---act-gccgaccccggct------------------------------
A0A2K5NZS5_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A0D9S017_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A2K5UDI5_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A2K6CIX3_BCL2-01      ---gct-gccgaccccggct------------------------------
A0A096MPU7_BCL2-01      ---gct-gccgaccccggct------------------------------
H2NWH5_BCL2-01          ---gct-gccgaccccggct------------------------------
G3QES9_BCL2-01          ---gct-gcagaccccggct------------------------------
A0A2I3GZF9_BCL2-01      ---gct-gccgaccccggct------------------------------
A9QXG9_BCL2-01          ---gct-gcagaccccggct------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          ---gct-gcagaccccggct------------------------------
I3MVK9_BCL2-01          ---acc-gccacccccggct------------------------------
E2QWA1_BCL2-01          -----------cccccaggg------------------------------
M3YYK3_BCL2-01          ---tcc--------ccggcc------------------------------
E2QWA1_BCL2-02          ---nnn-nnnnnnnnnnnnn------------------------------
Q75SV7_BCL2-01          ---gcc-cccgccccccgcc------------------------------
A0A3Q2HRY3_BCL2-02      ---gct-gctacccccggcc------------------------------
A0A3Q2HRY3_BCL2-01      ---gct-gctacccccggcc------------------------------
G1LIC9_BCL2-01          ---ggt----------ggcg------------------------------
A0A452R110_BCL2-01      ---gcttaccgcccccggcc------------------------------
A0A452R110_BCL2-02      ---gcttaccgcccccggcc------------------------------
M3X1R9_BCL2-02          ---gcc-gccgcccccggtc------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          ---gcc-gccgcccccggtc------------------------------
Q8I008_BCL2-01          ---gcc-gccgcccccggtc------------------------------
Q00709_BCL2-01          ---ccc--------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      ---ccc--------------------------------------------
H0YUX3_BCL2-01          ---ccc--------------------------------------------
A0A493T1X3_BCL2-01      ---ccc--------------------------------------------
U3KEW4_BCL2-01          ---ccc--------------------------------------------
A0A452I9V7_BCL2-01      ---cct--------------------------------------------
K7F5Y3_BCL2-01          ---cct--------------------------------------------
K7F5Y3_BCL2-02          ---cct--------------------------------------------
A0A3B3TCS4_BCL2-01      ---gcc--------------------------------------------
A0A0U3DHY6_BCL2-01      ---tcc--------------------------------------------
A0A3P9AAB2_BCL2-01      ---tca--------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          aatccagatgccagtcgtgctgcagatggtgataataatgatgctgatgg
A0A3P8YNB4_BCL2-01      ------------------ttccccata-----------------------
A0A3B4A3G8_BCL2-01      ------------------gctctgttc-----------------------
A0A3Q2XQX2_BCL2-01      ------------------cccccaagc-----------------------
A0A3Q2XQX2_BCL2-02      ------------------------atc-----------------------
A0A3P9J8Y9_BCL2-01      ------------------gcccccgcc-----------------------
A0A3Q2PN77_BCL2-01      ------------------acccccgccgcg--------------------
A0A3Q3B0R2_BCL2-01      ------------------ccccctgacgcggagagcgaccccgaccccgt
A0A3P8WUE9_BCL2-01      ------------------tccctaacc-----------------------
A0A3Q3K1K1_BCL2-01      ------------------ccccccacc-----------------------
A0A2U9BJ09_BCL2-01      ------------------accccgacc-----------------------
A0A3Q3MEY1_BCL2-01      ------------------tcccccagc-----------------------
A0A3Q3G1D7_BCL2-01      ------------------tcccccacc-----------------------
A0A3Q1I5N1_BCL2-01      ------------------tcccgcaac-----------------------
A0A3Q0S5Z7_BCL2-01      ------------------acacccacc-----------------------
A0A3P8QVM8_BCL2-01      ------------------acacccacc-----------------------
A0A3P9DIG5_BCL2-01      ------------------acacccacc-----------------------
A0A3Q2UYW8_BCL2-01      ------------------acacccacc-----------------------
A0A3B4G3K4_BCL2-01      ------------------acacccacc-----------------------
A0A3B4TX71_BCL2-01      ------------------cacctaacc-----------------------
A0A3B4YAG2_BCL2-01      ------------------cacctaacc-----------------------
A0A3B5BBQ0_BCL2-01      ------------------acccccacc-----------------------
A0A3Q1B8C3_BCL2-01      ------------------acccccacc-----------------------
A0A3P8S9L3_BCL2-01      ------------------acccccacc-----------------------
A0A3Q1FLK7_BCL2-01      ------------------acccccacc-----------------------
A0A1X9JZA1_BCL2-01      ------------------tcccccacc-----------------------
A0A4D6FTA2_BCL2-01      ------------------tcccccacc-----------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          -----------------------------------------tgc------
G3WZW9_BCL2-01          ------------------cctcctgctgttgctgctgctactgt------
G3WZW9_BCL2-02          -----------------------------------------tgt------
H0W1T3_BCL2-01          ------------------ggcc---------------tcgccgt------
P10417_BCL2-01          ------------------gc------------------------------
Q7TSN8_BCL2-01          ------------------gc------------------------------
F1LNV0_BCL2-01          ------------------gc------------------------------
P49950_BCL2-01          ------------------gc------------------------------
Q6R755_BCL2-01          ------------------gc------------------------------
Q9JJV8_BCL2-01          ------------------gc------------------------------
Q923R6_BCL2-01          ------------------gc------------------------------
O02718_BCL2-01          ------------------gc------------------------------
A0A4P8GLJ2_BCL2-01      ------------------gc------------------------------
F6R2C4_BCL2-01          ------------------gc------------------------------
A0A076FU27_BCL2-01      ------------------gc------------------------------
A0A076FZV9_BCL2-01      ------------------gc------------------------------
A0A452EV13_BCL2-01      ------------------gc------------------------------
G3SLZ1_BCL2-02          ------------------gaccc---------------------------
G3SLZ1_BCL2-01          ------------------gaccc---------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          --------------------------------------------------
A0A250YD83_BCL2-01      ------------------gccc---------------ccgccgc------
H0WKI0_BCL2-01          ------------------g------------------ccgccgc------
A0A2K6G3I7_BCL2-01      -------------------------------------ccgccgc------
A0A2K5PP81_BCL2-01      ------------------gccc------------ccgccgccgc------
A0A2K5EB04_BCL2-01      ------------------gccc------------ccgccgccgc------
A0A2K6UEL3_BCL2-01      ------------------nnnn---------------nnnnnnn------
A0A2R8MY14_BCL2-01      ------------------gccc------------ccgccgccgc------
A0A2K6R2I5_BCL2-02      ------------------gccc---------------ccgccgc------
A0A2K5HK49_BCL2-01      ------------------gccc---------------ccgccgc------
A0A2K6KHG1_BCL2-01      ------------------gccc---------------ccgccgc------
A0A2K6R2I5_BCL2-01      ------------------gccc---------------ccgccgc------
A0A2K5XRD4_BCL2-01      ------------------gccc---------------ccgccgc------
A0A2K5NZS5_BCL2-01      ------------------gccc---------------ccgccgc------
A0A0D9S017_BCL2-01      ------------------gccc---------------ccgccgc------
A0A2K5UDI5_BCL2-01      ------------------gccc------ccgccgccgccgccgc------
A0A2K6CIX3_BCL2-01      ------------------gccc---------------ccgccgc------
A0A096MPU7_BCL2-01      ------------------gccc---------------ccgccgc------
H2NWH5_BCL2-01          ------------------gccc---------------ctggcgc------
G3QES9_BCL2-01          ------------------gccc---------------ccggcgc------
A0A2I3GZF9_BCL2-01      ------------------gccc---------------ccggcgc------
A9QXG9_BCL2-01          ------------------gccc---------------ccggcgc------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          ------------------gccc---------------ccggcgc------
I3MVK9_BCL2-01          ------------------gccc---------------ccgctgc------
E2QWA1_BCL2-01          ------------------ccacctgccgccgccgccgccgccgcctttcc
M3YYK3_BCL2-01          ------------------accg------ccctcgccgccgctgc------
E2QWA1_BCL2-02          ------------------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Q75SV7_BCL2-01          ------------------gcccccgctgccgccgccgccgccgccgccga
A0A3Q2HRY3_BCL2-02      ------------------gccc---------------ccgccgg------
A0A3Q2HRY3_BCL2-01      ------------------gccc---------------ccgccgg------
G1LIC9_BCL2-01          ------------------ccgc------caagcgccgccgccgc------
A0A452R110_BCL2-01      ------------------gccc------ccgccgccgccgccgc------
A0A452R110_BCL2-02      ------------------gccc------ccgccgccgccgccgc------
M3X1R9_BCL2-02          ------------------gcccccgccgccgccgccgccgccgc------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          ----------------------------cccccgccgccgccgc------
M3X1R9_BCL2-01          ------------------gcccccgccgccgccgccgccgccgc------
Q8I008_BCL2-01          ------------------gccc------ccgccgccgccgccgc------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          gatagcaaaccgggtcaca---cgttcagaccct---tattcgaggatct
Q564A4_BCL2-01          gatagc---ccgggtcact---cgttcagaccct---catttgaggctct
B9ZYL7_BCL2-01          tggtgatgaagctgttatg---cagccagtccct---tcggc---agtgc
A0A3P8YNB4_BCL2-01      --tttccaaatggctctcc---caaccagacccg---catgcagctattc
A0A3B4A3G8_BCL2-01      ---------------cgct---ccgtccgaccca---cacgcggccatcc
A0A3Q2XQX2_BCL2-01      -----------gaagccac---ggttccgacccg---ctcgccgatatcc
A0A3Q2XQX2_BCL2-02      -----------gaagccac---ggttccgacccg---ctcgccgatatcc
A0A3P9J8Y9_BCL2-01      --tcatcagagcgctctcc---cgggcggacccg---ctcgcggacatcc
A0A3Q2PN77_BCL2-01      --tccgcgggcggctctcc---cagtccgacccg---cacgcggacatcc
A0A3Q3B0R2_BCL2-01      cctctgcgggcggatctcc---ccgcacgagccg---ctcgcgcacatcc
A0A3P8WUE9_BCL2-01      --tctgcaaacggccacct---gcgcccgaggcg---cacgccgccattc
A0A3Q3K1K1_BCL2-01      --gctgcaagcggccccct---cagtccgacatg---cacgccgccattc
A0A2U9BJ09_BCL2-01      --tctgtaggcggccgcct---cagtccgagccg---cgcgccgccgtcc
A0A3Q3MEY1_BCL2-01      --tctgcagagggctccct---cagtccgaccca---caagccgccattc
A0A3Q3G1D7_BCL2-01      --tctgcaaacggcccccc---cagtccgacccagcctacgcggatatcc
A0A3Q1I5N1_BCL2-01      --actgcagacggctccct---ccgtccgacccg---cacgctgcgctcc
A0A3Q0S5Z7_BCL2-01      --tctgcagacggctccca---cagtccgaccca---cacgcagacatcc
A0A3P8QVM8_BCL2-01      --tctgcagacggctccca---cagtccgaccca---cacgcaggcatcc
A0A3P9DIG5_BCL2-01      --tctgcagacggctccca---cagtccgaccca---cacgcaggcatcc
A0A3Q2UYW8_BCL2-01      --tctgcagacggctccca---cagtccgaccca---cacgcaggcatcc
A0A3B4G3K4_BCL2-01      --tctgcagacggctccca---cagtccgaccca---cacgcaggcatcc
A0A3B4TX71_BCL2-01      --tctgcagacggctctct---cagtccgacccg---cacgccgagatcc
A0A3B4YAG2_BCL2-01      --tctgcagacggctctct---cagtccgacccg---cacgccgagatcc
A0A3B5BBQ0_BCL2-01      --tctgcagacggctcccc---cagtccgacccg---cacgctgccatcc
A0A3Q1B8C3_BCL2-01      --tctgcagacggctcccc---cagtccgacccg---cacgctgccatcc
A0A3P8S9L3_BCL2-01      --tctgcagacggctcccc---cagtccgacccg---cacgctgccatcc
A0A3Q1FLK7_BCL2-01      --tctgcagacggctcccc---cagtccgacccg---cacgctgccatcc
A0A1X9JZA1_BCL2-01      --tctgcacacggctcccc---cagtccgacccg---catgccgccatcc
A0A4D6FTA2_BCL2-01      --tctgcaaacgtctcccc---cagtccgacccg---cacgccgccatcc
W5N4F7_BCL2-01          ccccgccggacccccccgcccgacccccacgccg---ctc-------tcc
H9GPE7_BCL2-01          tgcccccagggaagaacct---gacccggtgcca---caggt---tgtcc
F6YNL8_BCL2-01          tgctgctggacctaccgtc---agtccagtgcca---cctgt---ggtcc
G3WZW9_BCL2-01          tgctgctggaccagctgtc---agtccagtgcca---cctgt---ggtcc
G3WZW9_BCL2-02          tgctgctggaccagctgtc---agtccagtgcca---cctgt---ggtcc
H0W1T3_BCL2-01          cgcccaggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
P10417_BCL2-01          caccgctgggcctgcgctc---agccctgtgcca---cctgt---ggtcc
Q7TSN8_BCL2-01          caccgctgggcctgcgctc---agccctgtgcca---cctgt---ggtcc
F1LNV0_BCL2-01          caccgctgggcctgcgctc---agccctgtgcca---cctgt---ggtcc
P49950_BCL2-01          caacgctgggcctgcgctc---agccctgtgcca---cctgt---ggtcc
Q6R755_BCL2-01          caccactgggcctaccctt---agccccgtgcca---cctgt---ggtcc
Q9JJV8_BCL2-01          caccactgggcctaccctt---agccccgtgcca---cctgt---ggtcc
Q923R6_BCL2-01          caccactgggcctaccctt---agccccgtgcca---cctgt---ggtcc
O02718_BCL2-01          cgccgccgggcctgcgccc---agcccggtgccg---cctgt---ggtgc
A0A4P8GLJ2_BCL2-01      cgccgccgggcctgcgccc---agcccggtgccg---cctgt---ggtgc
F6R2C4_BCL2-01          cgccgccgggcctgcgccc---agcccggtgccg---cctgt---ggtgc
A0A076FU27_BCL2-01      cgccgccgggcctgcgccc---agcccggtgcca---cctgt---ggtcc
A0A076FZV9_BCL2-01      cgccgccgggcctgcgccc---agcccggtgcca---cctgt---ggtcc
A0A452EV13_BCL2-01      cgccgccgggcctgcgccc---agcccggtgcca---cctgt---ggtcc
G3SLZ1_BCL2-02          ggccgcgcagccggcgctc---agcccggtgcca---cctgt---agttc
G3SLZ1_BCL2-01          ggccgcgcagccggcgctc---agcccggtgcca---cctgt---agttc
G1TW27_BCL2-01          cgccgcggggcccgcgctc---agcccggtgcca---cctgt---ggtcc
G1TW27_BCL2-02          cgccgcggggcccgcgctc---agcccggtgcca---cctgt---ggtcc
A0A250YD83_BCL2-01      ccgcgccgggcctgcgctc---agcccagtacca---cctgt---ggtcc
H0WKI0_BCL2-01          cgccgcggagcctctgctc---agcccggtgcca---cctgt---ggtcc
A0A2K6G3I7_BCL2-01      cgccgcggggcctgcgccc---agcccggtgcca---cctgt---ggtcc
A0A2K5PP81_BCL2-01      cgccaccgggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K5EB04_BCL2-01      cgccacggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K6UEL3_BCL2-01      nnnnnnnnnnnnnnnnnnc---agcccagtgcca---cctgt---ggtcc
A0A2R8MY14_BCL2-01      cgccacggggcctacgctc---agcccggtgcca---cctgt---ggtcc
A0A2K6R2I5_BCL2-02      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K5HK49_BCL2-01      cgccgcggggcctgcgctt---agcccagtgcca---cctgt---ggtcc
A0A2K6KHG1_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K6R2I5_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K5XRD4_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K5NZS5_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A0D9S017_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K5UDI5_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2K6CIX3_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A096MPU7_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
H2NWH5_BCL2-01          cgccgtggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
G3QES9_BCL2-01          cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2I3GZF9_BCL2-01      cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A9QXG9_BCL2-01          cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
A0A2R9APW6_BCL2-01      ----------------ctc---agcccggtgcca---cctgt---ggtcc
H2QEM8_BCL2-01          cgccgcggggcctgcgctc---agcccggtgcca---cctgt---ggtcc
I3MVK9_BCL2-01          cgccgcggggcccgtgctc---agcccggtgcca---cctgt---ggtcc
E2QWA1_BCL2-01          ccctcgtgctcctnnnnnc---agccccgtgcca---cctgt---ggtcc
M3YYK3_BCL2-01          cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
E2QWA1_BCL2-02          nnnnnnnnnnnnnnnnnnc---agccccgtgcca---cctgt---ggtcc
Q75SV7_BCL2-01          cgccgcgggccccgcgccc---agccccgtgcca---cctgt---ggtcc
A0A3Q2HRY3_BCL2-02      cgccgcgggacctgccctc---agccctgtgcca---cctgt---ggtcc
A0A3Q2HRY3_BCL2-01      cgccgcgggacctgccctc---agccctgtgcca---cctgt---ggtcc
G1LIC9_BCL2-01          cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
A0A452R110_BCL2-01      cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
A0A452R110_BCL2-02      cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
M3X1R9_BCL2-02          cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
A0A452T603_BCL2-01      ------------------------ccccgtgcca---cctgt---ggtcc
G1LIC9_BCL2-02          cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
M3X1R9_BCL2-01          cgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
Q8I008_BCL2-01          tgccgcgggccctgcgctc---agccccgtgcca---cctgt---ggtcc
Q00709_BCL2-01          ggctgaggg------gctg---cgccccgcgcct---cccgg---cgtcc
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      ggcagaggg------gctg---cgccctgcaccc---caggt---cgtcc
H0YUX3_BCL2-01          agccgaggg------gctg---cgccctgcaccc---caggc---cgtcc
A0A493T1X3_BCL2-01      gggcgaggg------gctg---cgccccgcgccc---cccgt---ggtcc
U3KEW4_BCL2-01          ggccgaggg------gctg---cgccccgcaccc---caggt---cgtcc
A0A452I9V7_BCL2-01      tggtgatgg------gctg---cgcccagcaccg---caggc---tgttc
K7F5Y3_BCL2-01          tggtgatgg------gctg---cgctcagcacca---caggc---tgttc
K7F5Y3_BCL2-02          tggtgatgg------gctg---cgctcagcacca---caggc---tgttc
A0A3B3TCS4_BCL2-01      tgtccgcagccggacgccc---agatttgatcca---cacgcccggctgc
A0A0U3DHY6_BCL2-01      tttccaaaacaggagtccg---caaccggaccca---catgtcaggctcc
A0A3P9AAB2_BCL2-01      gttcgcaaataggatcccg---caaccggacccg---cacgcccggctcc
                                                                          

X4ZGI8_BCL2-01          accgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgt
Q564A4_BCL2-01          accgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgc
B9ZYL7_BCL2-01          tacagaccttgagtcgagctggagatgagttctctcgcctatatcagcaa
A0A3P8YNB4_BCL2-01      acagagtgttgcgtgaggccggggacgaactcgaaagactgtaccaaccc
A0A3B4A3G8_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgagcggctgtaccagccc
A0A3Q2XQX2_BCL2-01      accgggtcctgcgtgaggccggcgacgaactcgagagactttaccagccg
A0A3Q2XQX2_BCL2-02      accgggtcctgcgtgaggccggcgacgaactcgagagactttaccagccg
A0A3P9J8Y9_BCL2-01      acagggtcctgcgcgaggcgggagacgagctggagcggctgtaccagcgg
A0A3Q2PN77_BCL2-01      accgggtcctgcgcgaggccggcgacgagctggagagactgtaccagctg
A0A3Q3B0R2_BCL2-01      acagggtgctgcgcgaggccggcgacgagctggagcgcctctaccagccg
A0A3P8WUE9_BCL2-01      acagagtcctgcgcgaagccggagacgaactggagcgactgtaccagccg
A0A3Q3K1K1_BCL2-01      acagagtcctgcgggaggctggagatgaacttgaaagactataccagcca
A0A2U9BJ09_BCL2-01      accgggtcctgcgcgaggcgggcgacgaacttgagagactgtaccagccg
A0A3Q3MEY1_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtatcagccg
A0A3Q3G1D7_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactttaccagccg
A0A3Q1I5N1_BCL2-01      acagggtcctgcgtgaggctggagatgaacttgaaagactatatcagccg
A0A3Q0S5Z7_BCL2-01      acagagtcctgcgagaggctggagatgaacttgaaagactgtaccagccg
A0A3P8QVM8_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccg
A0A3P9DIG5_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccg
A0A3Q2UYW8_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccg
A0A3B4G3K4_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccg
A0A3B4TX71_BCL2-01      acagagtcctgcgcgaggctggagacgaacttgagagattataccagccg
A0A3B4YAG2_BCL2-01      acagagtcctgcgcgaggctggagacgaacttgagagattataccagccg
A0A3B5BBQ0_BCL2-01      acagagtcctgcgggaggctggagacgaacttgaaagactgtaccagccg
A0A3Q1B8C3_BCL2-01      acagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccg
A0A3P8S9L3_BCL2-01      acagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccg
A0A3Q1FLK7_BCL2-01      acagagtcctgcgggaggctggggatgaacttgaaagactgtaccagccg
A0A1X9JZA1_BCL2-01      acagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccg
A0A4D6FTA2_BCL2-01      acagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccg
W5N4F7_BCL2-01          acaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgg
H9GPE7_BCL2-01          atacaacattacgccaagccggagatgagttctcccgacgctatcggagg
F6YNL8_BCL2-01          acctgactcttcgtcaagctggagatgatttctctagaaggtaccggaga
G3WZW9_BCL2-01          acctgactcttcgtcaagctggagatgatttctctcgaagatatcgaaga
G3WZW9_BCL2-02          acctgactcttcgtcaagctggagatgatttctctcgaagatatcgaaga
H0W1T3_BCL2-01          acctgaccctccgccaggccggcgatgacttctcccgccgctatcgccaa
P10417_BCL2-01          atctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcgt
Q7TSN8_BCL2-01          atctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcgt
F1LNV0_BCL2-01          acctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcgc
P49950_BCL2-01          acctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcgc
Q6R755_BCL2-01          acctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcgc
Q9JJV8_BCL2-01          acctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcgc
Q923R6_BCL2-01          acctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcgc
O02718_BCL2-01          acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A4P8GLJ2_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
F6R2C4_BCL2-01          acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A076FU27_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A076FZV9_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A452EV13_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
G3SLZ1_BCL2-02          acctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgc
G3SLZ1_BCL2-01          acctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgc
G1TW27_BCL2-01          acctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgc
G1TW27_BCL2-02          acctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgc
A0A250YD83_BCL2-01      acctgaccctccgccaggctggcgatgacttctcccggcgctaccgccgc
H0WKI0_BCL2-01          acctgaccctccgccaggcgggcgatgacttctctcgccgctaccgccgc
A0A2K6G3I7_BCL2-01      acctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgc
A0A2K5PP81_BCL2-01      acctgaccctccgccaagccggcgacgacttctcccgccgctaccgccgc
A0A2K5EB04_BCL2-01      acctgaccctccgccaggccggggacgacttctcccgccgctaccgccgc
A0A2K6UEL3_BCL2-01      acctgaccctccgccaggccggcgacgacttctcccgccgctatcgccgc
A0A2R8MY14_BCL2-01      acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
A0A2K6R2I5_BCL2-02      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K5HK49_BCL2-01      accttaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K6KHG1_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K6R2I5_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K5XRD4_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K5NZS5_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A0D9S017_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K5UDI5_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A2K6CIX3_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
A0A096MPU7_BCL2-01      acctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgc
H2NWH5_BCL2-01          acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
G3QES9_BCL2-01          acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
A0A2I3GZF9_BCL2-01      acctgaccctccgccaggccggcgatgacttctcccgccgctaccgccgc
A9QXG9_BCL2-01          acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
A0A2R9APW6_BCL2-01      acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
H2QEM8_BCL2-01          acctgaccctccgccaggccggcgacgacttctcccgccgctaccgccgc
I3MVK9_BCL2-01          acctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgc
E2QWA1_BCL2-01          acctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcg-
M3YYK3_BCL2-01          acctgaccctgcgccaggccggcgacgacttctcccgtcgctaccgccgc
E2QWA1_BCL2-02          acctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcg-
Q75SV7_BCL2-01          acctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccgc
A0A3Q2HRY3_BCL2-02      acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
A0A3Q2HRY3_BCL2-01      acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
G1LIC9_BCL2-01          acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
A0A452R110_BCL2-01      acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
A0A452R110_BCL2-02      acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
M3X1R9_BCL2-02          acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
A0A452T603_BCL2-01      acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
G1LIC9_BCL2-02          acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
M3X1R9_BCL2-01          acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
Q8I008_BCL2-01          acctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgc
Q00709_BCL2-01          acctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagg
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      acctcgtcctgcgccaggcgggggatgagttctcccgacgctaccagagg
H0YUX3_BCL2-01          acctcgtcctgcgccaggcgggggatgagttctcccgacgctaccagaga
A0A493T1X3_BCL2-01      acctcgccctgcgccaggccggggacgagttctcccgtcgctaccagcgg
U3KEW4_BCL2-01          acctggtcctgcgccaggcgggcgacgagttctcccggcgctaccagagg
A0A452I9V7_BCL2-01      tcttggctctgtgccaagctggagatgaattttcccgtcgctaccacaga
K7F5Y3_BCL2-01          acttgactctgtgccaagccggagatgaattttcccgccgctatcacaga
K7F5Y3_BCL2-02          acttgactctgtgccaagccggagatgaattttcccgccgctatcacaga
A0A3B3TCS4_BCL2-01      acagggtcctgcgcgaagcgggggacgagatcgagaggatgttccagcgg
A0A0U3DHY6_BCL2-01      acagggtcctgcgcgaggcgggggacgagattgaaagaatgtatctgcgg
A0A3P9AAB2_BCL2-01      acagagtcctccgcgatgccgggaacgagatcgaaagaatgtatcagcgg
                                                                          

X4ZGI8_BCL2-01          gaatttgaggagatgtcccaccagatgacattcagtcccagtgcagcaca
Q564A4_BCL2-01          gaatttgaggaaatgtcccaacaaatggtgttcaacccaaattctgcgca
B9ZYL7_BCL2-01          gatttcagacagatctcagggctcctccatttaaccccatccacagttag
A0A3P8YNB4_BCL2-01      gactttttggagatgtcacaccagctgtatctgacgtcctctgtggccga
A0A3B4A3G8_BCL2-01      gacttcaccgagatgtccagacagctgtatctgacatcctcaacggcgca
A0A3Q2XQX2_BCL2-01      gatttcaccgagatgtcccgacagctgtacctctcgtccactacagctca
A0A3Q2XQX2_BCL2-02      gatttcaccgagatgtcccgacagctgtacctctcgtccactacagctca
A0A3P9J8Y9_BCL2-01      gacttcacggagatgtcgcggcagctgtacctcacctccaccacggcgaa
A0A3Q2PN77_BCL2-01      gacttcgcggagatgtcgcagcagctgtacatcaccagggacacggcgag
A0A3Q3B0R2_BCL2-01      gacttcgtggagatgtcgcggcagctggggctcgccagcgccgcggccaa
A0A3P8WUE9_BCL2-01      gacttctcagagatgtcacggcagctctatctcacctccagcacggcgca
A0A3Q3K1K1_BCL2-01      gacttcacagaaatgtcgcgccagctccatctcacctccaccacggcgca
A0A2U9BJ09_BCL2-01      gacttcacggagatgtcgcggcagctgtacctcacctccaccacggcgca
A0A3Q3MEY1_BCL2-01      gactttacggagatgtcgcgacagctgtatctcacctccaccacggcgca
A0A3Q3G1D7_BCL2-01      gacttcacggagatgtcgcggcagctgtatctcacctccaccacggcgca
A0A3Q1I5N1_BCL2-01      gacttcacggagatgtcccgacagctgtatctcacctccaccacggcgca
A0A3Q0S5Z7_BCL2-01      gacttcacggagatgtcgcggcagctgcatctcacctccgccacggcgca
A0A3P8QVM8_BCL2-01      gacttcacggagatgtcgcggcagctgcatctcacctcctccacggcgca
A0A3P9DIG5_BCL2-01      gacttcacggagatgtcgcggcagctgcatctcacctcctccacggcgca
A0A3Q2UYW8_BCL2-01      gacttcacggagatgtcgcggcagctgcatctcacctccgccacggcgca
A0A3B4G3K4_BCL2-01      gacttcacggagatgtcgcggcagctgcatctcacctccgccacggcgca
A0A3B4TX71_BCL2-01      gacttcacggagatgtcgcggcagctctatctcacctccaccacggcgca
A0A3B4YAG2_BCL2-01      gacttcacggagatgtcgcggcagctctatctcacctccaccacggcgca
A0A3B5BBQ0_BCL2-01      gacttcacggagatgtccaggcagctgtatctcacctccaccacggcgca
A0A3Q1B8C3_BCL2-01      gacttcacggagatgtccaggcagctgtatctcacctccaccacggcgca
A0A3P8S9L3_BCL2-01      gacttcacggagatgtccaggcagctgtatctcacctccaccacggcgca
A0A3Q1FLK7_BCL2-01      gacttcacggagatgtccaggcagctctatctcaccaccaccacggcgca
A0A1X9JZA1_BCL2-01      gacttcacggagatgtcgcggcagctgtatctcacctccaccacggcgca
A0A4D6FTA2_BCL2-01      gacttcacggagatgtcacggcagctgtatctcacctccaccacggcgca
W5N4F7_BCL2-01          gacttcgcggagatgtcggatcagttgcacttcacccccaacaccgcccg
H9GPE7_BCL2-01          gactttgctcaaatgtctggccagctgcatttgacccccagcactgccag
F6YNL8_BCL2-01          gactttgatgaaatgtcaggtcaactgcacctgacccctgttactgctag
G3WZW9_BCL2-01          gatttcgatgaaatgtcaggtcagctgcacctgacccctgttactgctag
G3WZW9_BCL2-02          gatttcgatgaaatgtcaggtcagctgcacctgacccctgttactgctag
H0W1T3_BCL2-01          gacttcgctgagatgtccagccagctgcacctgacgcctttcaccgcgag
P10417_BCL2-01          gacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgag
Q7TSN8_BCL2-01          gacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgag
F1LNV0_BCL2-01          gactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgag
P49950_BCL2-01          gactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgag
Q6R755_BCL2-01          gacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgag
Q9JJV8_BCL2-01          gacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgag
Q923R6_BCL2-01          gacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgag
O02718_BCL2-01          gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
A0A4P8GLJ2_BCL2-01      gacttcgccgagatgtccagtcaactgcacctgacgcccttcaccgcgag
F6R2C4_BCL2-01          gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
A0A076FU27_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A076FZV9_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A452EV13_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
G3SLZ1_BCL2-02          gacttcgccgagatgtcgagccagctgcacctgactcccttcaccgcgag
G3SLZ1_BCL2-01          gacttcgccgagatgtcgagccagctgcacctgactcccttcaccgcgag
G1TW27_BCL2-01          gacttcgcggagatgtccagccagctgcacctgacgccctttcacgcgag
G1TW27_BCL2-02          gacttcgcggagatgtccagccagctgcacctgacgccctttcacgcgag
A0A250YD83_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
H0WKI0_BCL2-01          gacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgag
A0A2K6G3I7_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A2K5PP81_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K5EB04_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K6UEL3_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2R8MY14_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K6R2I5_BCL2-02      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K5HK49_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K6KHG1_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K6R2I5_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K5XRD4_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K5NZS5_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A0D9S017_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K5UDI5_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2K6CIX3_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A096MPU7_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
H2NWH5_BCL2-01          gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
G3QES9_BCL2-01          gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2I3GZF9_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A9QXG9_BCL2-01          gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
A0A2R9APW6_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
H2QEM8_BCL2-01          gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcg
I3MVK9_BCL2-01          gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcaag
E2QWA1_BCL2-01          --tttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
M3YYK3_BCL2-01          gacttcgcggagatgtccagccagctgcacctgacgcccttcaccgcgag
E2QWA1_BCL2-02          --tttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
Q75SV7_BCL2-01          gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A3Q2HRY3_BCL2-02      gactttgccgagatgtccagccagctgcacctgacgcctttcaccgcaag
A0A3Q2HRY3_BCL2-01      gactttgccgagatgtccagccagctgcacctgacgcctttcaccgcaag
G1LIC9_BCL2-01          gacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaag
A0A452R110_BCL2-01      gacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaag
A0A452R110_BCL2-02      gacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaag
M3X1R9_BCL2-02          gacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaag
A0A452T603_BCL2-01      gacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaag
G1LIC9_BCL2-02          gacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaag
M3X1R9_BCL2-01          gacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaag
Q8I008_BCL2-01          gacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaag
Q00709_BCL2-01          gacttcgcccagatgtcgggccagctgcacctgacgcccttcacggccca
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      gacttttcccaaatgtctggccagctgcacctgacgcccttcacggccag
H0YUX3_BCL2-01          gacttttcccaaatgtctggccagctgcacctgacgccctttacagccag
A0A493T1X3_BCL2-01      gacttcgcccagatgtccggccagctgcacctgacgcccttcacggccag
U3KEW4_BCL2-01          gactttgcccaaatgtctggccagctgcacctgacgcccttcacggccag
A0A452I9V7_BCL2-01      gattttgcccagatgtctggccagctgcacttgaccccattcacggccag
K7F5Y3_BCL2-01          gattttgcccagatgtctgggcagctgcacttgaccccattcacggccag
K7F5Y3_BCL2-02          gattttgcccagatgtctgggcagctgcacttgaccccattcacggccag
A0A3B3TCS4_BCL2-01      gacttctcagaaatgcacgaagagctgcacatcacgcccagcacggcgca
A0A0U3DHY6_BCL2-01      gactttgcagagatgtcggggcaattgcattttacgcccagcacggcaca
A0A3P9AAB2_BCL2-01      gactttgcagagatgtcggggcagttgcatattacgcccagcacggcaca
                                                                          

X4ZGI8_BCL2-01          acgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
Q564A4_BCL2-01          acgcagctttctaaccgtggccgaagagctctttagagacggagtgaact
B9ZYL7_BCL2-01          ggtgcgctttgcaacagtggtggaggagctctttcatgatggggtaaact
A0A3P8YNB4_BCL2-01      gaggagattcagagaggttatagacgagctgttcagagacggagttaact
A0A3B4A3G8_BCL2-01      gaggaggttcgcggaggttatagacgaactgttccgcgatggagtgaact
A0A3Q2XQX2_BCL2-01      gaggcggttcgccgaggtgatcgacgaactgttccgggacggcgtcaact
A0A3Q2XQX2_BCL2-02      gaggcggttcgccgaggtgatcgacgaactgttccgggacggcgtcaact
A0A3P9J8Y9_BCL2-01      gacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaact
A0A3Q2PN77_BCL2-01      gacgaggttcgccgaggtcgtggacgagctgttccgggacggcgtgaact
A0A3Q3B0R2_BCL2-01      ggcgcgcttcgccgaggtgatggacgagctgttccgggacggcgtcaact
A0A3P8WUE9_BCL2-01      gaggagattcaccgaggtgattgacgaactgttccgggacggcgtgaact
A0A3Q3K1K1_BCL2-01      gagaagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A2U9BJ09_BCL2-01      gaggcgcttcgccgaggtgatcgacgaactgttccgggacggggtgaact
A0A3Q3MEY1_BCL2-01      gaggcgattcgccgaggtgatagatgaactgttccgggacggggtgaact
A0A3Q3G1D7_BCL2-01      gaggaggttcgccgaggtgatagacgaactgtttcgggacggggtgaact
A0A3Q1I5N1_BCL2-01      gcggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3Q0S5Z7_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggagtgaact
A0A3P8QVM8_BCL2-01      gaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3P9DIG5_BCL2-01      gaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3Q2UYW8_BCL2-01      gaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3B4G3K4_BCL2-01      gaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3B4TX71_BCL2-01      gagaagattcgccgaggtgatagacgaactgttccgggacggggtgaatt
A0A3B4YAG2_BCL2-01      gagaagattcgccgaggttatagacgaactgttccgggacggggtgaact
A0A3B5BBQ0_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3Q1B8C3_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3P8S9L3_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A3Q1FLK7_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
A0A1X9JZA1_BCL2-01      gaggagattcgccgacgtgatagacgaactgttccgggacggggtgaact
A0A4D6FTA2_BCL2-01      gaggagattcgccgaggtgatagacgaactgttccgggacggggtgaact
W5N4F7_BCL2-01          gaggaagttcaccgcggtggtggaggagctgtttcgggacggagtcaact
H9GPE7_BCL2-01          aagtcgttttgtggccgtggtggaagagctcttccaggacggtgtgaact
F6YNL8_BCL2-01          gggacgctttgccacagtggtagaggagctgttcagggatggggtgaact
G3WZW9_BCL2-01          gggacgctttgccacagtagtggaagagctgttcagggatggggtgaact
G3WZW9_BCL2-02          gggacgctttgccacagtagtggaagagctgttcagggatggggtgaact
H0W1T3_BCL2-01          gggacgctttgccacg------------ctcttcagggatggggtgaact
P10417_BCL2-01          gggacgctttgccacggtggtggaggaactcttcagggatggggtgaact
Q7TSN8_BCL2-01          gggacgctttgccacggtggtggaggaactcttcagggatggggtgaact
F1LNV0_BCL2-01          gggacgctttgccacggtggtggaggaactcttcagggatggggtgaact
P49950_BCL2-01          gggacgctttgccacggtggtggaggaactcttcagggatggggtgaact
Q6R755_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
Q9JJV8_BCL2-01          gggacgctttgctacggtggtggaggaactcttcagggatggggtgaact
Q923R6_BCL2-01          gggacgctttgctacggtggtggaggaactcttcagggatggggtgaact
O02718_BCL2-01          ggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A4P8GLJ2_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
F6R2C4_BCL2-01          gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A076FU27_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A076FZV9_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A452EV13_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
G3SLZ1_BCL2-02          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
G3SLZ1_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
G1TW27_BCL2-01          ggggcgctttgccacggtggtggaggagctcttcagggatggggtgaact
G1TW27_BCL2-02          ggggcgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A250YD83_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
H0WKI0_BCL2-01          aggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A2K6G3I7_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A2K5PP81_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K5EB04_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K6UEL3_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2R8MY14_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K6R2I5_BCL2-02      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K5HK49_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K6KHG1_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K6R2I5_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K5XRD4_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K5NZS5_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A0D9S017_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K5UDI5_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2K6CIX3_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A096MPU7_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
H2NWH5_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
G3QES9_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2I3GZF9_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A9QXG9_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
A0A2R9APW6_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
H2QEM8_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
I3MVK9_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
E2QWA1_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
M3YYK3_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
E2QWA1_BCL2-02          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
Q75SV7_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A3Q2HRY3_BCL2-02      gggacgctttgccacggtagtggaggagctcttcagggatggggtgaact
A0A3Q2HRY3_BCL2-01      gggacgctttgccacggtagtggaggagctcttcagggatggggtgaact
G1LIC9_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A452R110_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
A0A452R110_BCL2-02      gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
M3X1R9_BCL2-02          gggacgctttgccacggtggtggaggagctcttcagggatggagtgaact
A0A452T603_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
G1LIC9_BCL2-02          gggacgctttgccacggtggtggaggagctcttcagggatggggtgaact
M3X1R9_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggagtgaact
Q8I008_BCL2-01          gggacgctttgccacggtggtggaggagctcttcagggatggcgtgaact
Q00709_BCL2-01          cggccgcttcgtggccgtggtggaggagctcttccgtgatggggtcaact
G1MZW1_BCL2-01          -------------------gtggaggagcttttccgtgatggggtcaatt
A0A218UQA0_BCL2-01      gagccgcttcgtggcggtggtggaggagctcttccgagatggggttaact
H0YUX3_BCL2-01          gagccgcttcgtggcggtggtggaggagctcttccgagatggggttaact
A0A493T1X3_BCL2-01      aggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaact
U3KEW4_BCL2-01          gagccgcttcgtggccgtggtggaggagctcttccgagacggggttaact
A0A452I9V7_BCL2-01      ggggcgctttgtggcggtggtggaggagctgttccgagatggggttaact
K7F5Y3_BCL2-01          ggggcgctttgtggcggtggtggaggagctattccgagatgggattaact
K7F5Y3_BCL2-02          ggggcgctttgtggcggtggtggaggagctattccgagatgggattaact
A0A3B3TCS4_BCL2-01      gcgccgcttcacggccgtcatcgaggagctgttcagcgatggcgtgaact
A0A0U3DHY6_BCL2-01      ganaaggtttaccgctgtaatagatgagctcttcagcgacggggtaaact
A0A3P9AAB2_BCL2-01      tggacgatttaccgcagtaatagacgaactgttcagcgacggtgtaaact
                                                    ** **    ** **  * ** *

X4ZGI8_BCL2-01          gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggag
Q564A4_BCL2-01          gggggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaa
B9ZYL7_BCL2-01          ggggaaggattgttgcttttttcgagtttggtggggtcatgtgcgtggag
A0A3P8YNB4_BCL2-01      ggggacgtattatcgctttcttcgagttcgggggcacaatatgcgtggaa
A0A3B4A3G8_BCL2-01      ggggcaggattattgcgtttttcgagtttggtggaaccgtgtgcgtggag
A0A3Q2XQX2_BCL2-01      ggggccggatcatcgccttcttcgagttcggcggcaccgtgtgcgtggag
A0A3Q2XQX2_BCL2-02      ggggccggatcatcgccttcttcgagttcggcggcaccgtgtgcgtggag
A0A3P9J8Y9_BCL2-01      ggggccggattatcgcgttcttcgagttcgggggcacggtgtgcgtggag
A0A3Q2PN77_BCL2-01      ggggtcggattatcgctttcttcgagttcggcggcacggtgtgcgtggag
A0A3Q3B0R2_BCL2-01      ggggccgcatcattgccttcttcgagttcggcggcacggtgtgcgtggag
A0A3P8WUE9_BCL2-01      ggggccggattatcgccttcttcgagtttggaggcgtcgtgtgtgtggag
A0A3Q3K1K1_BCL2-01      ggggccggattatcgcattcttcgagttcggcggcacgatgtgcgtggag
A0A2U9BJ09_BCL2-01      ggggccggattatcgcgttcttcgagttcgggggcaccgtgtgcgtggag
A0A3Q3MEY1_BCL2-01      ggggccggattatcgctttcttcgagttcggcggcaccgtgtgcgtggag
A0A3Q3G1D7_BCL2-01      ggggccggattatcgcctttttcgagttcgggggcacggtgtgcgtggag
A0A3Q1I5N1_BCL2-01      ggggccggattatcgctttcttcgagttcggcggcaccgtgtgcgtggag
A0A3Q0S5Z7_BCL2-01      ggggccggattattgctttcttcgagtttgggggcacggtgtgcgtggag
A0A3P8QVM8_BCL2-01      ggggccggattattgctttcttcgagtttgggggcactgtgtgcgtggag
A0A3P9DIG5_BCL2-01      ggggccggattattgctttcttcgagtttgggggcactgtgtgcgtggag
A0A3Q2UYW8_BCL2-01      ggggccggattattgctttcttcgagtttgggggcactgtgtgcgtggag
A0A3B4G3K4_BCL2-01      ggggccggattattgctttcttcgagtttgggggcactgtgtgcgtggag
A0A3B4TX71_BCL2-01      ggggccggattatcgctttcttcgagttcgggggcacggtgtgcgttgag
A0A3B4YAG2_BCL2-01      ggggccggattatcgctttcttcgagttcgggggcacggtgtgcgttgag
A0A3B5BBQ0_BCL2-01      ggggccggattatcgctttcttcgagttcgggggaaccgtgtgcgtcgag
A0A3Q1B8C3_BCL2-01      ggggccggattatcgctttcttcgagttcggggggacggtgtgcgtcgag
A0A3P8S9L3_BCL2-01      ggggccggattatcgctttcttcgagttcggggggacggtgtgcgtcgag
A0A3Q1FLK7_BCL2-01      ggggccggattatcgctttcttcgagttcggggggacggtgtgcgtcgag
A0A1X9JZA1_BCL2-01      ggggccggattatcgctttcttcgagttcgggggcacggtgtgcgtggag
A0A4D6FTA2_BCL2-01      ggggccggattatcgctttcttcgagttcgggggcacggtgtgcgtggag
W5N4F7_BCL2-01          gggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggag
H9GPE7_BCL2-01          gggggaggattgtggcgttctttgaatttggtggcatgctgtgcgtggag
F6YNL8_BCL2-01          gggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggag
G3WZW9_BCL2-01          gggggcggattgtggccttctttgaatttggtggtgttatgtgtgtggag
G3WZW9_BCL2-02          gggggcggattgtggccttctttgaatttggtggtgttatgtgtgtggag
H0W1T3_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P10417_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
Q7TSN8_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
F1LNV0_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
P49950_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtgggg
Q6R755_BCL2-01          gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
Q9JJV8_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
Q923R6_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
O02718_BCL2-01          gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
A0A4P8GLJ2_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
F6R2C4_BCL2-01          gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
A0A076FU27_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggag
A0A076FZV9_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
A0A452EV13_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
G3SLZ1_BCL2-02          gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G3SLZ1_BCL2-01          gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G1TW27_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G1TW27_BCL2-02          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A250YD83_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
H0WKI0_BCL2-01          gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6G3I7_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5PP81_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5EB04_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6UEL3_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2R8MY14_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6R2I5_BCL2-02      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5HK49_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6KHG1_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6R2I5_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5XRD4_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5NZS5_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A0D9S017_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K5UDI5_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6CIX3_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A096MPU7_BCL2-01      gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
H2NWH5_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G3QES9_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2I3GZF9_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A9QXG9_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2R9APW6_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
H2QEM8_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
I3MVK9_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
E2QWA1_BCL2-01          gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
M3YYK3_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
E2QWA1_BCL2-02          gggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
Q75SV7_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A3Q2HRY3_BCL2-02      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A3Q2HRY3_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G1LIC9_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A452R110_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A452R110_BCL2-02      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
M3X1R9_BCL2-02          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A452T603_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G1LIC9_BCL2-02          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
M3X1R9_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
Q8I008_BCL2-01          gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
Q00709_BCL2-01          ggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgag
G1MZW1_BCL2-01          ggggccggatcgtcgccttctttgagttcggcggcgtgatgtgcgtcgag
A0A218UQA0_BCL2-01      ggggcagaattgtggccttcttcgagtttggcggtgtgatgtgtgtggag
H0YUX3_BCL2-01          ggggcagaattgtggccttcttcgagtttggcggtgtgatgtgtgtggag
A0A493T1X3_BCL2-01      ggggccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
U3KEW4_BCL2-01          ggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
A0A452I9V7_BCL2-01      ggggaaggatcgtggccttctttgaatttggtggtgtgatgtgtgtggag
K7F5Y3_BCL2-01          ggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggag
K7F5Y3_BCL2-02          ggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggag
A0A3B3TCS4_BCL2-01      ggggccgtattgtggcgtttctcgagttcggcggcaccatgtgcgtggag
A0A0U3DHY6_BCL2-01      ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggag
A0A3P9AAB2_BCL2-01      ggggtcggattgtggctttccttgagtttggagggacaatgtgcgtggag
                        ****  * **  * ** **  * ** ** ** **     * ** ** *  

X4ZGI8_BCL2-01          agctt---caaccgggagatggcgtcccaggtagataatattgcacactg
Q564A4_BCL2-01          agcgt---caaccgggagatggcgtcccaggtagataatattgcacactg
B9ZYL7_BCL2-01          attgt---taaccgcgaaatgtctcctctggtggactccattgtgggttg
A0A3P8YNB4_BCL2-01      tgcgtg---aacaaggaaatgacttcgcaggtggaccacattgccgggtg
A0A3B4A3G8_BCL2-01      tgcgcgtccaaagaggacatgtcatcccaagtggacaacatcgcagactg
A0A3Q2XQX2_BCL2-01      tgcgccactaaggaggacatgacgtcgcaagtggacaacatagccgagtg
A0A3Q2XQX2_BCL2-02      tgcgccactaaggaggacatgacgtcgcaagtggacaacatagccgagtg
A0A3P9J8Y9_BCL2-01      tgcgcgtccaacgaggagatgagcacgcaggtggccagcatcgccgagtg
A0A3Q2PN77_BCL2-01      tgcgcgtccaaggagggcatgtcatcgcaggtggacaacatcgcggagtg
A0A3Q3B0R2_BCL2-01      tgcgcgtccagggaggagatgacgccgcaggtggaccacatcgcggagtg
A0A3P8WUE9_BCL2-01      tgtgcggctaaggaggacttgacgccgcaagtggagcaggtcgtggactg
A0A3Q3K1K1_BCL2-01      tgcgctgccaaggaggagatgacaccgcaagtggacaagatcgcggagtg
A0A2U9BJ09_BCL2-01      tgcgccgacaccgaggagatgacatcgcaggtggacaacatcgcggagtg
A0A3Q3MEY1_BCL2-01      tgcgcggccaaggaggagatgacatcgcaagtggacaacatcgcggagtg
A0A3Q3G1D7_BCL2-01      tgcatgtccaaacaggagatgacatcgcaggtggacaacatcgcagagtg
A0A3Q1I5N1_BCL2-01      tgcgcgtccaaggaggagatgacaccgcaggtgaacaacatcgcagagtg
A0A3Q0S5Z7_BCL2-01      tgcgcttccaacgaggggatgacatcgcaggtggacaacatcgcagagtg
A0A3P8QVM8_BCL2-01      tgcgcttccaacgaggggatgtcatcccaggtggacaacatcgcagactg
A0A3P9DIG5_BCL2-01      tgcgcttccaacgaggggatgtcatcccaggtggacaacatcgcagactg
A0A3Q2UYW8_BCL2-01      tgcgcttccaacgaggggatgtcatcccaggtggacaacatcgcagactg
A0A3B4G3K4_BCL2-01      tgcgcttccaacgaggggatgtcatcccaggtggacaacatcgcagactg
A0A3B4TX71_BCL2-01      tgcgcggccaaggaggagatgacatcgcaggtggacaacatcgtggagtg
A0A3B4YAG2_BCL2-01      tgcgcggccaaggaggagatgacatcgcaggtggacaacatcgtggagtg
A0A3B5BBQ0_BCL2-01      tgcgcggccaaagaggagatgacgtcgcaggtggacaacatcgcggagtg
A0A3Q1B8C3_BCL2-01      tgcgcggccaaagaggagatgacatcgcaggtggacaacatcgcggagtg
A0A3P8S9L3_BCL2-01      tgcgcggccaaagaggagatgacatcgcaggtggacaacatcgcggagtg
A0A3Q1FLK7_BCL2-01      tgcgcggccaaagaggagatgacatcgcaggtggacaacatcgcggagtg
A0A1X9JZA1_BCL2-01      tgcgtggcgaaggaggagatggcagcgcaggtgaacaacatcgcggagtg
A0A4D6FTA2_BCL2-01      tgcgtggccaaggaggagatgacaccgcaggtggacaacatcgcggagtg
W5N4F7_BCL2-01          agcgt---gaaccgggagatgacgtcccaggtggacaacattgccaactg
H9GPE7_BCL2-01          agtgt---cagccgggagatgtccccccttgtggacaatattgctacgtg
F6YNL8_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacagcattgccctatg
G3WZW9_BCL2-01          agcgt---caaccgggagatgtcgcctctggtggacagcatagccctgtg
G3WZW9_BCL2-02          agcgt---caaccgggagatgtcgcctctggtggacagcatagccctgtg
H0W1T3_BCL2-01          agtgt---caaccgggagatgtcacctctggtggacaacatcgccctctg
P10417_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgccctgtg
Q7TSN8_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgccctgtg
F1LNV0_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgctctgtg
P49950_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgctctgtg
Q6R755_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
Q9JJV8_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgccctgtg
Q923R6_BCL2-01          agcgt---caacagggagatgtcacccctggtggacaacatcgccctgtg
O02718_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
A0A4P8GLJ2_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
F6R2C4_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
A0A076FU27_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
A0A076FZV9_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
A0A452EV13_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacagcatcgccctgtg
G3SLZ1_BCL2-02          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctctg
G3SLZ1_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctctg
G1TW27_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
G1TW27_BCL2-02          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A250YD83_BCL2-01      agcgt---caaccgggagatgtcgcctctggtggacaacatcgccttgtg
H0WKI0_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K6G3I7_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5PP81_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5EB04_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgcgctgtg
A0A2K6UEL3_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2R8MY14_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K6R2I5_BCL2-02      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5HK49_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K6KHG1_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K6R2I5_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5XRD4_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5NZS5_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A0D9S017_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K5UDI5_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2K6CIX3_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A096MPU7_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
H2NWH5_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
G3QES9_BCL2-01          agcgt---caaccgggagatgtctcccctggtggacaacatcgccctgtg
A0A2I3GZF9_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A9QXG9_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A2R9APW6_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
H2QEM8_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
I3MVK9_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
E2QWA1_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
M3YYK3_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctatg
E2QWA1_BCL2-02          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
Q75SV7_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A3Q2HRY3_BCL2-02      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A3Q2HRY3_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacatcgccctgtg
G1LIC9_BCL2-01          agcgt---caaccgggagatgtcgcccctggtggacaacattgccctgtg
A0A452R110_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacattgccctgtg
A0A452R110_BCL2-02      agcgt---caaccgggagatgtcgcccctggtggacaacattgccctgtg
M3X1R9_BCL2-02          agcgt---caaccgagagatgtcgcccctggtggacaacatcgccctgtg
A0A452T603_BCL2-01      agcgt---caaccgggagatgtcgcccctggtggacaacattgccctgtg
G1LIC9_BCL2-02          agcgt---caaccgggagatgtcgcccctggtggacaacattgccctgtg
M3X1R9_BCL2-01          agcgt---caaccgagagatgtcgcccctggtggacaacatcgccctgtg
Q8I008_BCL2-01          ggcgt---caaccgagagatgtcgcccctggtggacaacatcgccctgtg
Q00709_BCL2-01          agcgt---caaccgggagatgtcgccgctggtggacaacattgccacctg
G1MZW1_BCL2-01          agcgt---caaccgggagatgtcgccgctggtggacaacattgccacctg
A0A218UQA0_BCL2-01      agcgt---caaccgggagatgtttcccctcgtggacaacattgccacctg
H0YUX3_BCL2-01          agcgt---caacagggagatgtttcccctcgtggacaacattgccacctg
A0A493T1X3_BCL2-01      agcgt---caaccgggagatgtctcccctggtggacagcatcgccgcctg
U3KEW4_BCL2-01          agcgt---caacagggagatgtctccgctggtggacagcatcgccgcctg
A0A452I9V7_BCL2-01      agcgt---taatcgggagatgtcgcctcttgtggacagcattgctgtgtg
K7F5Y3_BCL2-01          agtgt---caaccgggagatgtcgcctcttgtggacagtattgctgtgtg
K7F5Y3_BCL2-02          agtgt---caaccgggagatgtcgcctcttgtggacagtattgctgtgtg
A0A3B3TCS4_BCL2-01      agtgt---caaccgagagatgacgtcccaggtggataacattgcacactg
A0A0U3DHY6_BCL2-01      agcgt---caaccgggagatgacgtcccaggtggacaacatcgctctttg
A0A3P9AAB2_BCL2-01      agcgt---caaccgggagatgacgccccaggtgaacaacatcgtccattg
                                 *     *   **    * *  **        * *     **

X4ZGI8_BCL2-01          gatgacagactacctgaacgggccactggaaaactggatcgaggaaaatg
Q564A4_BCL2-01          gatgactgactacctgaacgggccactggaaaactggatcgaggaaaatg
B9ZYL7_BCL2-01          gatgacagagtacctaaaccgtcacttacaaaattggatccaggaaca--
A0A3P8YNB4_BCL2-01      gatgacagaatatctaaatggacccctgcacagctggattcaagaaaacg
A0A3B4A3G8_BCL2-01      gatgacggagtatttgaatggaactctcagcagctggatccaagacaacg
A0A3Q2XQX2_BCL2-01      gatgactgagtacttaaacggacccctaggcagctggatccaagacaacg
A0A3Q2XQX2_BCL2-02      gatgactgagtacttaaacggacccctaggcagctggatccaagacaacg
A0A3P9J8Y9_BCL2-01      gatgacggagtatttaaacggacctctcaacagctggattgaagaaaacg
A0A3Q2PN77_BCL2-01      gatgacggaatatttgaatggacctcttggcagctggatacaggataacg
A0A3Q3B0R2_BCL2-01      gatgacggagtatttaaatggacctctgaacagctggatagaggataacg
A0A3P8WUE9_BCL2-01      gatgacagagtatttaaatggacctcttaacatctggattaaagagaacg
A0A3Q3K1K1_BCL2-01      gatgacggagtatttaaatggacctctaaacagctggattcaagaaaacg
A0A2U9BJ09_BCL2-01      gatgacagagtatttaaatggaccgcttaacagctggattatggacaacg
A0A3Q3MEY1_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3Q3G1D7_BCL2-01      gatgacggagtatttgaatggacctctgaacagctggatacaagataacg
A0A3Q1I5N1_BCL2-01      gatgacggagtatttaaatggacctcttcacagctggatacaagataacg
A0A3Q0S5Z7_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3P8QVM8_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3P9DIG5_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3Q2UYW8_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3B4G3K4_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3B4TX71_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggataaaggataacg
A0A3B4YAG2_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggataaaggataacg
A0A3B5BBQ0_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaggataacg
A0A3Q1B8C3_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3P8S9L3_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A3Q1FLK7_BCL2-01      gatgacggagtatttaaatggacctcttaacagctggatacaagataacg
A0A1X9JZA1_BCL2-01      gatgactgagtatttaaatggacctctgaacagctggatacaagataacg
A0A4D6FTA2_BCL2-01      gatgacggagtatttaaatggacctctgaacagctggatacaagataacg
W5N4F7_BCL2-01          gatgacggagtatctcaacgggccccttcagaactggatccaggagaacg
H9GPE7_BCL2-01          gatgactgagtatctgaaccagtacctgcgcaactggatccaggagaacg
F6YNL8_BCL2-01          gatgactgagtacctgaaccggcacctgcacacttggatccaggataacg
G3WZW9_BCL2-01          gatgactgagtacctgaaccggcacctgcacaactggatccaggataacg
G3WZW9_BCL2-02          gatgactgagtacctgaaccggcacctgcacaactggatccaggataacg
H0W1T3_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
P10417_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggataacg
Q7TSN8_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggataacg
F1LNV0_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggataacg
P49950_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggataacg
Q6R755_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
Q9JJV8_BCL2-01          gatgaccgagtacctgaaccggcatctgcacacctggatccaggataacg
Q923R6_BCL2-01          gatgaccgagtacctgaaccggcatctgcacacctggatccaggataacg
O02718_BCL2-01          gatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacg
A0A4P8GLJ2_BCL2-01      gatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacg
F6R2C4_BCL2-01          gatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacg
A0A076FU27_BCL2-01      gatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacg
A0A076FZV9_BCL2-01      gatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacg
A0A452EV13_BCL2-01      gatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacg
G3SLZ1_BCL2-02          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
G3SLZ1_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
G1TW27_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataatg
G1TW27_BCL2-02          gatgactgagtacctgaaccggcacctgcacacctggatccaggataatg
A0A250YD83_BCL2-01      gatgattgagtacctgaaccggcacctgcacacctggatccaggataacg
H0WKI0_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K6G3I7_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K5PP81_BCL2-01      gatgaccgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K5EB04_BCL2-01      gatgaccgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K6UEL3_BCL2-01      gatgaccgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2R8MY14_BCL2-01      gatgaccgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K6R2I5_BCL2-02      gatgactgagtacctgaaccggcacctgcacacttggatccaggataacg
A0A2K5HK49_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K6KHG1_BCL2-01      gatgactgagtacctgaaccggcacctgcacacttggatccaggataacg
A0A2K6R2I5_BCL2-01      gatgactgagtacctgaaccggcacctgcacacttggatccaggataacg
A0A2K5XRD4_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K5NZS5_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A0D9S017_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K5UDI5_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2K6CIX3_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A096MPU7_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
H2NWH5_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
G3QES9_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2I3GZF9_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A9QXG9_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
A0A2R9APW6_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
H2QEM8_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
I3MVK9_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
E2QWA1_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
M3YYK3_BCL2-01          gatgactgagtacctgaaccggcacttgcacacctggatccaggacaacg
E2QWA1_BCL2-02          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
Q75SV7_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
A0A3Q2HRY3_BCL2-02      gatgactgaatacctgaaccggcacctgcacacctggatccaggataacg
A0A3Q2HRY3_BCL2-01      gatgactgaatacctgaaccggcacctgcacacctggatccaggataacg
G1LIC9_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggacaacg
A0A452R110_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggacaacg
A0A452R110_BCL2-02      gatgactgagtacctgaaccggcacctgcacacctggatccaggacaacg
M3X1R9_BCL2-02          gatgactgagtacctgaaccggcacctgcacacctggatccaagacaacg
A0A452T603_BCL2-01      gatgactgagtacctgaaccggcacctgcacacctggatccaggacaacg
G1LIC9_BCL2-02          gatgactgagtacctgaaccggcacctgcacacctggatccaggacaacg
M3X1R9_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaagacaacg
Q8I008_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
Q00709_BCL2-01          gatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacg
G1MZW1_BCL2-01          gatgaccgaatacctgaacaggcacctgcacaactggatccaggacaacg
A0A218UQA0_BCL2-01      gatgactgagtacctgaaccggcacctgcacaactggatccaggacaacg
H0YUX3_BCL2-01          gatgactgagtacctgaaccggcacctgcacaactggatccaggacaacg
A0A493T1X3_BCL2-01      gatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacg
U3KEW4_BCL2-01          gatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacg
A0A452I9V7_BCL2-01      gatgactgaatacctgaacagacacctacacaactggatccaggacaacg
K7F5Y3_BCL2-01          gatgactgagtacctgaacagacacttgcacaactggatccaggacaatg
K7F5Y3_BCL2-02          gatgactgagtacctgaacagacacttgcacaactggatccaggacaatg
A0A3B3TCS4_BCL2-01      gatgacggagtacctgaacggaccactgcataactggatccaggaaaatg
A0A0U3DHY6_BCL2-01      gatgacggagtacctgaacggacccctacagaactggatccaggagaatg
A0A3P9AAB2_BCL2-01      gatgacggagtacctgaatggacccctgcaaaactggatccaggagaatg
                        *****  ** **  * **        *       *****    **  *  

X4ZGI8_BCL2-01          gaggct-------------------------gg---g-a-----------
Q564A4_BCL2-01          gaggtt-------------------------gg---g-a-----------
B9ZYL7_BCL2-01          -------------------------------gg-----a-----------
A0A3P8YNB4_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3B4A3G8_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q2XQX2_BCL2-01      ggggct-------------------------gg---g-a-----------
A0A3Q2XQX2_BCL2-02      ggggct-------------------------gg---g-a-----------
A0A3P9J8Y9_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q2PN77_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q3B0R2_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3P8WUE9_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q3K1K1_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A2U9BJ09_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q3MEY1_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q3G1D7_BCL2-01      gtggat-------------------------gg---g-a-----------
A0A3Q1I5N1_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q0S5Z7_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3P8QVM8_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3P9DIG5_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q2UYW8_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3B4G3K4_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3B4TX71_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3B4YAG2_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3B5BBQ0_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q1B8C3_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3P8S9L3_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A3Q1FLK7_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A1X9JZA1_BCL2-01      ggggat-------------------------gg---g-a-----------
A0A4D6FTA2_BCL2-01      ggggat-------------------------gg---g-a-----------
W5N4F7_BCL2-01          gaggct-------------------------gg---g-a-----------
H9GPE7_BCL2-01          gaggct-------------------------gg-----------------
F6YNL8_BCL2-01          gaggat-------------------------gg---g-------------
G3WZW9_BCL2-01          gaggat-------------------------gg---ggt-----------
G3WZW9_BCL2-02          gaggat-------------------------gg---g-------------
H0W1T3_BCL2-01          gaggat-------------------------gg-----------------
P10417_BCL2-01          gaggct-------------------------gg---g-a-----------
Q7TSN8_BCL2-01          gaggct-------------------------gg---g-a-----------
F1LNV0_BCL2-01          gaggct-------------------------gg---g-a-----------
P49950_BCL2-01          gaggct-------------------------gg---g-a-----------
Q6R755_BCL2-01          gaggct-------------------------gg---g-a-----------
Q9JJV8_BCL2-01          gaggct-------------------------gg---g-a-----------
Q923R6_BCL2-01          gaggct-------------------------gg---g-a-----------
O02718_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A4P8GLJ2_BCL2-01      gaggct-------------------------gg---g-a-----------
F6R2C4_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A076FU27_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A076FZV9_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A452EV13_BCL2-01      gaggct-------------------------gg---g-a-----------
G3SLZ1_BCL2-02          gaggat-------------------------gggtag-g-----------
G3SLZ1_BCL2-01          gaggat-------------------------gg---g-a-----------
G1TW27_BCL2-01          gaggct-------------------------gg---g-a-----------
G1TW27_BCL2-02          gaggctgggcagacaaaagcccttggatctcgg---g-g-----------
A0A250YD83_BCL2-01      gaggct-------------------------gg---g-a-----------
H0WKI0_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A2K6G3I7_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K5PP81_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K5EB04_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K6UEL3_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2R8MY14_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K6R2I5_BCL2-02      gaggct-------------------------gg---c-g-----------
A0A2K5HK49_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K6KHG1_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K6R2I5_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K5XRD4_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K5NZS5_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A0D9S017_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K5UDI5_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A2K6CIX3_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A096MPU7_BCL2-01      gaggct-------------------------gg---g-a-----------
H2NWH5_BCL2-01          gaggct-------------------------gg---g-a-----------
G3QES9_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A2I3GZF9_BCL2-01      gaggct-------------------------gg---g-a-----------
A9QXG9_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A2R9APW6_BCL2-01      gaggct-------------------------gg---g-a-----------
H2QEM8_BCL2-01          gaggct-------------------------gg---g-a-----------
I3MVK9_BCL2-01          gaggct-------------------------gg-----------------
E2QWA1_BCL2-01          gaggct-------------------------gg---g-a-----------
M3YYK3_BCL2-01          gaggct-------------------------gg---c-c-----------
E2QWA1_BCL2-02          gaggct-------------------------gg---g-a-----------
Q75SV7_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A3Q2HRY3_BCL2-02      gaggct-------------------------gg---c-aactttgccaag
A0A3Q2HRY3_BCL2-01      gaggct-------------------------gg---g-a-----------
G1LIC9_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A452R110_BCL2-01      gaggct-------------------------gg---g-a-----------
A0A452R110_BCL2-02      gaggct-------------------------gg---g-------------
M3X1R9_BCL2-02          gaggct-------------------------gg-----------------
A0A452T603_BCL2-01      gaggct-------------------------gg-----------------
G1LIC9_BCL2-02          gaggct-------------------------gg-----------------
M3X1R9_BCL2-01          gaggct-------------------------gg---g-a-----------
Q8I008_BCL2-01          gaggct-------------------------gg---g-a-----------
Q00709_BCL2-01          gaggat-------------------------gg---g-a-----------
G1MZW1_BCL2-01          gaggat-------------------------gg---g-a-----------
A0A218UQA0_BCL2-01      gaggct-------------------------gg---g-a-----------
H0YUX3_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A493T1X3_BCL2-01      gaggct-------------------------gg---g-a-----------
U3KEW4_BCL2-01          gaggct-------------------------gg---g-a-----------
A0A452I9V7_BCL2-01      gaggct-------------------------gg---gta-----------
K7F5Y3_BCL2-01          gaggtt-------------------------gg---g-a-----------
K7F5Y3_BCL2-02          gaggtt-------------------------gg---g-c-----------
A0A3B3TCS4_BCL2-01      gtggct-------------------------gg---g-a-----------
A0A0U3DHY6_BCL2-01      gtggct-------------------------gg---g-a-----------
A0A3P9AAB2_BCL2-01      gtggat-------------------------gg---g-a-----------
                                                       **                 

X4ZGI8_BCL2-01          -------cgcctttg-----------------------------------
Q564A4_BCL2-01          -------tgccttcg-----------------------------------
B9ZYL7_BCL2-01          -------tgcatttg-----------------------------------
A0A3P8YNB4_BCL2-01      -------ggcctttg-----------------------------------
A0A3B4A3G8_BCL2-01      -------agcctttg-----------------------------------
A0A3Q2XQX2_BCL2-01      -------tgcttttg-----------------------------------
A0A3Q2XQX2_BCL2-02      -------tgcttttg-----------------------------------
A0A3P9J8Y9_BCL2-01      -------tgcctttg-----------------------------------
A0A3Q2PN77_BCL2-01      -------tgccttcg-----------------------------------
A0A3Q3B0R2_BCL2-01      -------tgcgttcg-----------------------------------
A0A3P8WUE9_BCL2-01      -------tgcctttg-----------------------------------
A0A3Q3K1K1_BCL2-01      -------tgcctttg-----------------------------------
A0A2U9BJ09_BCL2-01      -------cgccttcg-----------------------------------
A0A3Q3MEY1_BCL2-01      -------tgcctttg-----------------------------------
A0A3Q3G1D7_BCL2-01      -------tgcctttg-----------------------------------
A0A3Q1I5N1_BCL2-01      -------tgccttcg-----------------------------------
A0A3Q0S5Z7_BCL2-01      -------tgcatttg-----------------------------------
A0A3P8QVM8_BCL2-01      -------tgcatttg-----------------------------------
A0A3P9DIG5_BCL2-01      -------tgcatttg-----------------------------------
A0A3Q2UYW8_BCL2-01      -------tgcatttg-----------------------------------
A0A3B4G3K4_BCL2-01      -------tgcatttg-----------------------------------
A0A3B4TX71_BCL2-01      -------tgcctttg-----------------------------------
A0A3B4YAG2_BCL2-01      -------tgcctttg-----------------------------------
A0A3B5BBQ0_BCL2-01      -------cgcctttg-----------------------------------
A0A3Q1B8C3_BCL2-01      -------tgcctttg-----------------------------------
A0A3P8S9L3_BCL2-01      -------tgcctttg-----------------------------------
A0A3Q1FLK7_BCL2-01      -------tgccttcg-----------------------------------
A0A1X9JZA1_BCL2-01      -------tgcctttg-----------------------------------
A0A4D6FTA2_BCL2-01      -------tgcctttg-----------------------------------
W5N4F7_BCL2-01          -------cgcctttg-----------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          -------tgcctttg-----------------------------------
Q7TSN8_BCL2-01          -------tgcctttg-----------------------------------
F1LNV0_BCL2-01          -------tgcctttg-----------------------------------
P49950_BCL2-01          -------tgcctttg-----------------------------------
Q6R755_BCL2-01          -------tgcctttg-----------------------------------
Q9JJV8_BCL2-01          -------cgcatttg-----------------------------------
Q923R6_BCL2-01          -------cgcatttg-----------------------------------
O02718_BCL2-01          -------cgcctttg-----------------------------------
A0A4P8GLJ2_BCL2-01      -------cgcctttg-----------------------------------
F6R2C4_BCL2-01          -------cgcctttg-----------------------------------
A0A076FU27_BCL2-01      -------cgcctttg-----------------------------------
A0A076FZV9_BCL2-01      -------cgcctttg-----------------------------------
A0A452EV13_BCL2-01      -------cgcctttg-----------------------------------
G3SLZ1_BCL2-02          -------tgcatgtg-----------------------------------
G3SLZ1_BCL2-01          -------tgcctttg-----------------------------------
G1TW27_BCL2-01          -------tgccttcg-----------------------------------
G1TW27_BCL2-02          -------tgtctttgtacttctcggagagccaccccaggagcacattccc
A0A250YD83_BCL2-01      -------tgcctttg-----------------------------------
H0WKI0_BCL2-01          -------cgcctttg-----------------------------------
A0A2K6G3I7_BCL2-01      -------cgcctttg-----------------------------------
A0A2K5PP81_BCL2-01      -------tgcctttg-----------------------------------
A0A2K5EB04_BCL2-01      -------tgcctttg-----------------------------------
A0A2K6UEL3_BCL2-01      -------tgcctttg-----------------------------------
A0A2R8MY14_BCL2-01      -------tgcctttg-----------------------------------
A0A2K6R2I5_BCL2-02      -------tac----------------------------------------
A0A2K5HK49_BCL2-01      -------tgcctttg-----------------------------------
A0A2K6KHG1_BCL2-01      -------tgcctttg-----------------------------------
A0A2K6R2I5_BCL2-01      -------tgcctttg-----------------------------------
A0A2K5XRD4_BCL2-01      -------cgcctttg-----------------------------------
A0A2K5NZS5_BCL2-01      -------cgcctttg-----------------------------------
A0A0D9S017_BCL2-01      -------cgcctttg-----------------------------------
A0A2K5UDI5_BCL2-01      -------cgcctttg-----------------------------------
A0A2K6CIX3_BCL2-01      -------cgcctttg-----------------------------------
A0A096MPU7_BCL2-01      -------cgcctttg-----------------------------------
H2NWH5_BCL2-01          -------tgcctttg-----------------------------------
G3QES9_BCL2-01          -------tgcctttg-----------------------------------
A0A2I3GZF9_BCL2-01      -------tgcctttg-----------------------------------
A9QXG9_BCL2-01          -------tgcctttg-----------------------------------
A0A2R9APW6_BCL2-01      -------tgcctttg-----------------------------------
H2QEM8_BCL2-01          -------tgcctttg-----------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          -------tgcctttg-----------------------------------
M3YYK3_BCL2-01          -------tgcccccg-----------------------------------
E2QWA1_BCL2-02          -------tgcctttg-----------------------------------
Q75SV7_BCL2-01          -------tgcctttg-----------------------------------
A0A3Q2HRY3_BCL2-02      caccaacaggctctc-----------------------------------
A0A3Q2HRY3_BCL2-01      -------cgcctttg-----------------------------------
G1LIC9_BCL2-01          -------tgcctttg-----------------------------------
A0A452R110_BCL2-01      -------tgcctttg-----------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          -------tgcctttg-----------------------------------
Q8I008_BCL2-01          -------tgcctttg-----------------------------------
Q00709_BCL2-01          -------tgcctttg-----------------------------------
G1MZW1_BCL2-01          -------tgccttcg-----------------------------------
A0A218UQA0_BCL2-01      -------tgcctttg-----------------------------------
H0YUX3_BCL2-01          -------tgcctttg-----------------------------------
A0A493T1X3_BCL2-01      -------tgccttcg-----------------------------------
U3KEW4_BCL2-01          -------tgcctttg-----------------------------------
A0A452I9V7_BCL2-01      -------tg----tg-----------------------------------
K7F5Y3_BCL2-01          -------tgcctttg-----------------------------------
K7F5Y3_BCL2-02          -------tg-----g-----------------------------------
A0A3B3TCS4_BCL2-01      -------cgcgtttg-----------------------------------
A0A0U3DHY6_BCL2-01      -------cgcctttg-----------------------------------
A0A3P9AAB2_BCL2-01      -------tgctttcg-----------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          tgacggagggctcagccacctcttccgcctcattatactctgctcagcac
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          ------------------------tggag---------------------
Q564A4_BCL2-01          ------------------------tggag---------------------
B9ZYL7_BCL2-01          ------------------------tggag---------------------
A0A3P8YNB4_BCL2-01      ------------------------tggag---------------------
A0A3B4A3G8_BCL2-01      ------------------------tggag---------------------
A0A3Q2XQX2_BCL2-01      ------------------------tggag---------------------
A0A3Q2XQX2_BCL2-02      ------------------------tggag---------------------
A0A3P9J8Y9_BCL2-01      ------------------------tggag---------------------
A0A3Q2PN77_BCL2-01      ------------------------tggaa---------------------
A0A3Q3B0R2_BCL2-01      ------------------------tggaa---------------------
A0A3P8WUE9_BCL2-01      ------------------------tggag---------------------
A0A3Q3K1K1_BCL2-01      ------------------------tggag---------------------
A0A2U9BJ09_BCL2-01      ------------------------tggag---------------------
A0A3Q3MEY1_BCL2-01      ------------------------tggag---------------------
A0A3Q3G1D7_BCL2-01      ------------------------tggag---------------------
A0A3Q1I5N1_BCL2-01      ------------------------tggac---------------------
A0A3Q0S5Z7_BCL2-01      ------------------------tggag---------------------
A0A3P8QVM8_BCL2-01      ------------------------tggag---------------------
A0A3P9DIG5_BCL2-01      ------------------------tggag---------------------
A0A3Q2UYW8_BCL2-01      ------------------------tggag---------------------
A0A3B4G3K4_BCL2-01      ------------------------tggag---------------------
A0A3B4TX71_BCL2-01      ------------------------tggag---------------------
A0A3B4YAG2_BCL2-01      ------------------------tggag---------------------
A0A3B5BBQ0_BCL2-01      ------------------------tggag---------------------
A0A3Q1B8C3_BCL2-01      ------------------------tggag---------------------
A0A3P8S9L3_BCL2-01      ------------------------tggag---------------------
A0A3Q1FLK7_BCL2-01      ------------------------tggag---------------------
A0A1X9JZA1_BCL2-01      ------------------------tggag---------------------
A0A4D6FTA2_BCL2-01      ------------------------tagag---------------------
W5N4F7_BCL2-01          ------------------------tggag---------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          ------------------------accaa---------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          ------------------------tggaa---------------------
Q7TSN8_BCL2-01          ------------------------tggaa---------------------
F1LNV0_BCL2-01          ------------------------tggaa---------------------
P49950_BCL2-01          ------------------------tggaa---------------------
Q6R755_BCL2-01          ------------------------tggaa---------------------
Q9JJV8_BCL2-01          ------------------------tggaa---------------------
Q923R6_BCL2-01          ------------------------tggaa---------------------
O02718_BCL2-01          ------------------------tggag---------------------
A0A4P8GLJ2_BCL2-01      ------------------------tggag---------------------
F6R2C4_BCL2-01          ------------------------tggag---------------------
A0A076FU27_BCL2-01      ------------------------tggag---------------------
A0A076FZV9_BCL2-01      ------------------------tggag---------------------
A0A452EV13_BCL2-01      ------------------------tggag---------------------
G3SLZ1_BCL2-02          ------------------------tgg-----------------------
G3SLZ1_BCL2-01          ------------------------tggaa---------------------
G1TW27_BCL2-01          ------------------------tggaa---------------------
G1TW27_BCL2-02          cgagaagcctggcatggtttctgctggaatgaaaagattggcagagctgc
A0A250YD83_BCL2-01      ------------------------tggaa---------------------
H0WKI0_BCL2-01          ------------------------tggaa---------------------
A0A2K6G3I7_BCL2-01      ------------------------tggaa---------------------
A0A2K5PP81_BCL2-01      ------------------------tggaa---------------------
A0A2K5EB04_BCL2-01      ------------------------tggaa---------------------
A0A2K6UEL3_BCL2-01      ------------------------tggaa---------------------
A0A2R8MY14_BCL2-01      ------------------------tggaa---------------------
A0A2K6R2I5_BCL2-02      ----------------------------a---------------------
A0A2K5HK49_BCL2-01      ------------------------tggaa---------------------
A0A2K6KHG1_BCL2-01      ------------------------tggaa---------------------
A0A2K6R2I5_BCL2-01      ------------------------tggaa---------------------
A0A2K5XRD4_BCL2-01      ------------------------tggaa---------------------
A0A2K5NZS5_BCL2-01      ------------------------tggaa---------------------
A0A0D9S017_BCL2-01      ------------------------tggaa---------------------
A0A2K5UDI5_BCL2-01      ------------------------tggaa---------------------
A0A2K6CIX3_BCL2-01      ------------------------tggaa---------------------
A0A096MPU7_BCL2-01      ------------------------tggaa---------------------
H2NWH5_BCL2-01          ------------------------tggaa---------------------
G3QES9_BCL2-01          ------------------------tggaa---------------------
A0A2I3GZF9_BCL2-01      ------------------------tggaa---------------------
A9QXG9_BCL2-01          ------------------------tggaa---------------------
A0A2R9APW6_BCL2-01      ------------------------tggaa---------------------
H2QEM8_BCL2-01          ------------------------tggaa---------------------
I3MVK9_BCL2-01          -------------------------gtag---------------------
E2QWA1_BCL2-01          ------------------------tggaa---------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          ------------------------tggaa---------------------
Q75SV7_BCL2-01          ------------------------tggaa---------------------
A0A3Q2HRY3_BCL2-02      ------------------------aggaa---------------------
A0A3Q2HRY3_BCL2-01      ------------------------tggaa---------------------
G1LIC9_BCL2-01          ------------------------tggag---------------------
A0A452R110_BCL2-01      ------------------------tggag---------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          -------------------------ctaa---------------------
A0A452T603_BCL2-01      -------------------------gtag---------------------
G1LIC9_BCL2-02          -------------------------gtag---------------------
M3X1R9_BCL2-01          ------------------------tggaa---------------------
Q8I008_BCL2-01          ------------------------tggaa---------------------
Q00709_BCL2-01          ------------------------tggaa---------------------
G1MZW1_BCL2-01          ------------------------tggaa---------------------
A0A218UQA0_BCL2-01      ------------------------tggag---------------------
H0YUX3_BCL2-01          ------------------------tggag---------------------
A0A493T1X3_BCL2-01      ------------------------tggag---------------------
U3KEW4_BCL2-01          ------------------------tggag---------------------
A0A452I9V7_BCL2-01      ------------------------tccag---------------------
K7F5Y3_BCL2-01          ------------------------tggaa---------------------
K7F5Y3_BCL2-02          ------------------------tgcag---------------------
A0A3B3TCS4_BCL2-01      ------------------------tggag---------------------
A0A0U3DHY6_BCL2-01      ------------------------tggag---------------------
A0A3P9AAB2_BCL2-01      ------------------------tggag---------------------
                                                                          

X4ZGI8_BCL2-01          -ttatacagt------------cagca-----------------------
Q564A4_BCL2-01          -atgtacggt------------cagca-----------------------
B9ZYL7_BCL2-01          -ctgtacaac----------agcaata-----------------------
A0A3P8YNB4_BCL2-01      -ctctatgac------------agaca-----------------------
A0A3B4A3G8_BCL2-01      -ctgtacgat------------cgcca-----------------------
A0A3Q2XQX2_BCL2-01      -ctctacgac------------cgtca-----------------------
A0A3Q2XQX2_BCL2-02      -ctctacgac------------cgtca-----------------------
A0A3P9J8Y9_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q2PN77_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q3B0R2_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3P8WUE9_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q3K1K1_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A2U9BJ09_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q3MEY1_BCL2-01      -atgtatgac------------aggca-----------------------
A0A3Q3G1D7_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q1I5N1_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3Q0S5Z7_BCL2-01      -ctgtatggc------------agaca-----------------------
A0A3P8QVM8_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3P9DIG5_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3Q2UYW8_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3B4G3K4_BCL2-01      -ctgtacgac------------agaca-----------------------
A0A3B4TX71_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3B4YAG2_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3B5BBQ0_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3Q1B8C3_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3P8S9L3_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A3Q1FLK7_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A1X9JZA1_BCL2-01      -ctgtatgac------------agaca-----------------------
A0A4D6FTA2_BCL2-01      -ctgtatgac------------agaca-----------------------
W5N4F7_BCL2-01          -ctctatgggagacag----------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------agcaatt-----------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          -ctatatggc----------cccagca-----------------------
Q7TSN8_BCL2-01          -ctatatggc----------cccagca-----------------------
F1LNV0_BCL2-01          -ctatatggc----------cccagca-----------------------
P49950_BCL2-01          -ctatatggc----------cccagca-----------------------
Q6R755_BCL2-01          -ctgtacggc----------cccacca-----------------------
Q9JJV8_BCL2-01          -ctgtacggc----------cccagtg-----------------------
Q923R6_BCL2-01          -ctgtacggc----------cccagtg-----------------------
O02718_BCL2-01          -ctgtatggc----------cctagca-----------------------
A0A4P8GLJ2_BCL2-01      -ctgtatggc----------cctagca-----------------------
F6R2C4_BCL2-01          -ctgtatggc----------cctagca-----------------------
A0A076FU27_BCL2-01      -ctgtacggc----------cctagca-----------------------
A0A076FZV9_BCL2-01      -ctgtacggc----------cctagca-----------------------
A0A452EV13_BCL2-01      -ctgtacggc----------cctagca-----------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          -ctgtatggc----------cccaaca-----------------------
G1TW27_BCL2-01          -ctgtacggc----------cccagcg-----------------------
G1TW27_BCL2-02          cctagacaac----------agcaccgcaaaacactgtggcagaaggttt
A0A250YD83_BCL2-01      -ctgtatggc----------cccagtg-----------------------
H0WKI0_BCL2-01          -ttgtatggc----------cccagca-----------------------
A0A2K6G3I7_BCL2-01      -ttgtatggt----------cccagca-----------------------
A0A2K5PP81_BCL2-01      -ctgtatggc----------cccagca-----------------------
A0A2K5EB04_BCL2-01      -ctgtatggc----------cccagca-----------------------
A0A2K6UEL3_BCL2-01      -ctgtatggc----------cccagca-----------------------
A0A2R8MY14_BCL2-01      -ctgtatggc----------cccagca-----------------------
A0A2K6R2I5_BCL2-02      -atgt-------------------gca-----------------------
A0A2K5HK49_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K6KHG1_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K6R2I5_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K5XRD4_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K5NZS5_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A0D9S017_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K5UDI5_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A2K6CIX3_BCL2-01      -ctgtacggc----------cccagca-----------------------
A0A096MPU7_BCL2-01      -ctgtacggc----------cccagca-----------------------
H2NWH5_BCL2-01          -ctgtacggc----------cccagca-----------------------
G3QES9_BCL2-01          -ctgtacggc----------cccagca-----------------------
A0A2I3GZF9_BCL2-01      -ctgtacggc----------cccagca-----------------------
A9QXG9_BCL2-01          -ctgtacggc----------cccagca-----------------------
A0A2R9APW6_BCL2-01      -ctgtacggc----------cccagca-----------------------
H2QEM8_BCL2-01          -ctgtacggc----------cccagca-----------------------
I3MVK9_BCL2-01          -gtgcacgtc----------------------------------------
E2QWA1_BCL2-01          -ctgtacggc----------cccacca-----------------------
M3YYK3_BCL2-01          --------------------cccccca-----------------------
E2QWA1_BCL2-02          -ctgtacggc----------cccacca-----------------------
Q75SV7_BCL2-01          -ctgtacggc----------cccacca-----------------------
A0A3Q2HRY3_BCL2-02      -atgttcagcggtgggtggaccattca-----------------------
A0A3Q2HRY3_BCL2-01      -ctgtacggc----------cccagca-----------------------
G1LIC9_BCL2-01          -ttgtacggc----------cccagca-----------------------
A0A452R110_BCL2-01      -ttgtacggc----------cccagca-----------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          -tcttgctgc----------c---tcg-----------------------
A0A452T603_BCL2-01      -gtgcacgtc----------cgcttga-----------------------
G1LIC9_BCL2-02          -gtgcacgtc----------c-----------------------------
M3X1R9_BCL2-01          -ctgtacggc----------cccagca-----------------------
Q8I008_BCL2-01          -ctgtacggc----------cccagca-----------------------
Q00709_BCL2-01          -ttgtacggc----------aacagta-----------------------
G1MZW1_BCL2-01          -ttgtacggc----------accagta-----------------------
A0A218UQA0_BCL2-01      -ttgtatggc----------aacaata-----------------------
H0YUX3_BCL2-01          -ttgtatggc----------aacaata-----------------------
A0A493T1X3_BCL2-01      -ttgtatggc----------aacagta-----------------------
U3KEW4_BCL2-01          -ttgtatggc----------aacagta-----------------------
A0A452I9V7_BCL2-01      -t------------------------------------------------
K7F5Y3_BCL2-01          -ttgtatggc----------agcaaca-----------------------
K7F5Y3_BCL2-02          -t------------------------------------------------
A0A3B3TCS4_BCL2-01      -atttacggg------------caaca-----------------------
A0A0U3DHY6_BCL2-01      -atctatgaa------------cagca-----------------------
A0A3P9AAB2_BCL2-01      -atctatggg------------cagaa-----------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------gagagaccct--------
Q564A4_BCL2-01          --------------------------------gagagactct--------
B9ZYL7_BCL2-01          --------------------------------tccagccacc--------
A0A3P8YNB4_BCL2-01      --------------------------------gagggactct--------
A0A3B4A3G8_BCL2-01      --------------------------------gagggactcg--------
A0A3Q2XQX2_BCL2-01      --------------------------------gagggactct--------
A0A3Q2XQX2_BCL2-02      --------------------------------gagggactct--------
A0A3P9J8Y9_BCL2-01      --------------------------------gaaggaaacc--------
A0A3Q2PN77_BCL2-01      --------------------------------aaaggagtcc--------
A0A3Q3B0R2_BCL2-01      --------------------------------caaggagtcc--------
A0A3P8WUE9_BCL2-01      --------------------------------gggggagtct--------
A0A3Q3K1K1_BCL2-01      --------------------------------gagggagtcg--------
A0A2U9BJ09_BCL2-01      --------------------------------cggggagtcc--------
A0A3Q3MEY1_BCL2-01      --------------------------------gagggagtct--------
A0A3Q3G1D7_BCL2-01      --------------------------------gagagactcg--------
A0A3Q1I5N1_BCL2-01      --------------------------------gagggagtct--------
A0A3Q0S5Z7_BCL2-01      --------------------------------gagggagtcc--------
A0A3P8QVM8_BCL2-01      --------------------------------gagggactcc--------
A0A3P9DIG5_BCL2-01      --------------------------------gagggactcc--------
A0A3Q2UYW8_BCL2-01      --------------------------------gagggactcc--------
A0A3B4G3K4_BCL2-01      --------------------------------gagggactcc--------
A0A3B4TX71_BCL2-01      --------------------------------gagggagtcc--------
A0A3B4YAG2_BCL2-01      --------------------------------gagggagtcc--------
A0A3B5BBQ0_BCL2-01      --------------------------------gagggactca--------
A0A3Q1B8C3_BCL2-01      --------------------------------gagggactca--------
A0A3P8S9L3_BCL2-01      --------------------------------gagggactca--------
A0A3Q1FLK7_BCL2-01      --------------------------------gagggactca--------
A0A1X9JZA1_BCL2-01      --------------------------------gagggactcc--------
A0A4D6FTA2_BCL2-01      --------------------------------gagggactcc--------
W5N4F7_BCL2-01          --------------------------------agaggctcca--------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------tgcgacctct--------
Q7TSN8_BCL2-01          --------------------------------tgcgacctct--------
F1LNV0_BCL2-01          --------------------------------tgcgacctct--------
P49950_BCL2-01          --------------------------------tgcgacctct--------
Q6R755_BCL2-01          --------------------------------tgcagcctct--------
Q9JJV8_BCL2-01          --------------------------------tgaggcctct--------
Q923R6_BCL2-01          --------------------------------tgaggcctct--------
O02718_BCL2-01          --------------------------------tgcggcccct--------
A0A4P8GLJ2_BCL2-01      --------------------------------tgcggcccct--------
F6R2C4_BCL2-01          --------------------------------tgcggcccct--------
A0A076FU27_BCL2-01      --------------------------------tgcggcccct--------
A0A076FZV9_BCL2-01      --------------------------------tgcggcccct--------
A0A452EV13_BCL2-01      --------------------------------tgcggcccct--------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------tgcgacctct--------
G1TW27_BCL2-01          --------------------------------tgcggcctct--------
G1TW27_BCL2-02          ggtctacataccaaggcagccaaagtattaattgcattctct--------
A0A250YD83_BCL2-01      --------------------------------tgcgacctct--------
H0WKI0_BCL2-01          --------------------------------tgcggcctct--------
A0A2K6G3I7_BCL2-01      --------------------------------tgcggcctct--------
A0A2K5PP81_BCL2-01      --------------------------------tgcggcctct--------
A0A2K5EB04_BCL2-01      --------------------------------tgcggcctct--------
A0A2K6UEL3_BCL2-01      --------------------------------tgcggcctct--------
A0A2R8MY14_BCL2-01      --------------------------------tgcggcctct--------
A0A2K6R2I5_BCL2-02      --------------------------------cgtggt------------
A0A2K5HK49_BCL2-01      --------------------------------tgtggcctct--------
A0A2K6KHG1_BCL2-01      --------------------------------tgcggcctct--------
A0A2K6R2I5_BCL2-01      --------------------------------tgcggcctct--------
A0A2K5XRD4_BCL2-01      --------------------------------tgcggcctct--------
A0A2K5NZS5_BCL2-01      --------------------------------tgcggcctct--------
A0A0D9S017_BCL2-01      --------------------------------tgcggcctct--------
A0A2K5UDI5_BCL2-01      --------------------------------tgcggcctct--------
A0A2K6CIX3_BCL2-01      --------------------------------tgcggcctct--------
A0A096MPU7_BCL2-01      --------------------------------tgcggcctct--------
H2NWH5_BCL2-01          --------------------------------tgcggcctct--------
G3QES9_BCL2-01          --------------------------------tgcggcctct--------
A0A2I3GZF9_BCL2-01      --------------------------------tgcggcctct--------
A9QXG9_BCL2-01          --------------------------------tgcggcctct--------
A0A2R9APW6_BCL2-01      --------------------------------tgcggcctct--------
H2QEM8_BCL2-01          --------------------------------tgcggcctct--------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------tgcagcctct--------
M3YYK3_BCL2-01          --------------------------------tgaagg------------
E2QWA1_BCL2-02          --------------------------------tgcagcctct--------
Q75SV7_BCL2-01          --------------------------------tgcagcctct--------
A0A3Q2HRY3_BCL2-02      --------------------------------ttctggctctccattgca
A0A3Q2HRY3_BCL2-01      --------------------------------tgcggccgct--------
G1LIC9_BCL2-01          --------------------------------tgcagcctct--------
A0A452R110_BCL2-01      --------------------------------tgcagcctct--------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------tacctcgtat--------
A0A452T603_BCL2-01      --------------------------------atgtgcgtct--------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------tgcagcctct--------
Q8I008_BCL2-01          --------------------------------tgcagcctct--------
Q00709_BCL2-01          --------------------------------tgaggccttt--------
G1MZW1_BCL2-01          --------------------------------tgaggccttt--------
A0A218UQA0_BCL2-01      --------------------------------tgaggccttt--------
H0YUX3_BCL2-01          --------------------------------tgaggccttt--------
A0A493T1X3_BCL2-01      --------------------------------tgaggccttt--------
U3KEW4_BCL2-01          --------------------------------tgaggccttt--------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------tgaggccttt--------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------gcggggttcg--------
A0A0U3DHY6_BCL2-01      --------------------------------gaggatctct--------
A0A3P9AAB2_BCL2-01      --------------------------------gaggggctct--------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      gaatctttgtgtgtcaagggcaggaaattggttttcagagaagaaaaata
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------tgt---------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          ---------gt---------------------------------------
P10417_BCL2-01          ---------gt---------------------------------------
Q7TSN8_BCL2-01          ---------gt---------------------------------------
F1LNV0_BCL2-01          ---------gt---------------------------------------
P49950_BCL2-01          ---------gt---------------------------------------
Q6R755_BCL2-01          ---------gt---------------------------------------
Q9JJV8_BCL2-01          ---------gt---------------------------------------
Q923R6_BCL2-01          ---------gt---------------------------------------
O02718_BCL2-01          ---------gt---------------------------------------
A0A4P8GLJ2_BCL2-01      ---------gt---------------------------------------
F6R2C4_BCL2-01          ---------gt---------------------------------------
A0A076FU27_BCL2-01      ---------gt---------------------------------------
A0A076FZV9_BCL2-01      ---------gt---------------------------------------
A0A452EV13_BCL2-01      ---------gt---------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          ---------gt---------------------------------------
G1TW27_BCL2-01          ---------gt---------------------------------------
G1TW27_BCL2-02          ---------gtgatcgcaaaaaaggcgctgaattcttctcttcacgtttt
A0A250YD83_BCL2-01      ---------gt---------------------------------------
H0WKI0_BCL2-01          ---------gt---------------------------------------
A0A2K6G3I7_BCL2-01      ---------gt---------------------------------------
A0A2K5PP81_BCL2-01      ---------gt---------------------------------------
A0A2K5EB04_BCL2-01      ---------gt---------------------------------------
A0A2K6UEL3_BCL2-01      ---------gt---------------------------------------
A0A2R8MY14_BCL2-01      ---------gt---------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      ---------gt---------------------------------------
A0A2K6KHG1_BCL2-01      ---------gt---------------------------------------
A0A2K6R2I5_BCL2-01      ---------gt---------------------------------------
A0A2K5XRD4_BCL2-01      ---------gt---------------------------------------
A0A2K5NZS5_BCL2-01      ---------gt---------------------------------------
A0A0D9S017_BCL2-01      ---------gt---------------------------------------
A0A2K5UDI5_BCL2-01      ---------gt---------------------------------------
A0A2K6CIX3_BCL2-01      ---------gt---------------------------------------
A0A096MPU7_BCL2-01      ---------gt---------------------------------------
H2NWH5_BCL2-01          ---------gt---------------------------------------
G3QES9_BCL2-01          ---------gt---------------------------------------
A0A2I3GZF9_BCL2-01      ---------gt---------------------------------------
A9QXG9_BCL2-01          ---------gt---------------------------------------
A0A2R9APW6_BCL2-01      ---------gt---------------------------------------
H2QEM8_BCL2-01          ---------gt---------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          ---------gt---------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          ---------gt---------------------------------------
Q75SV7_BCL2-01          ---------gt---------------------------------------
A0A3Q2HRY3_BCL2-02      tgacttggtgt---------------------------------------
A0A3Q2HRY3_BCL2-01      ---------gt---------------------------------------
G1LIC9_BCL2-01          ---------gt---------------------------------------
A0A452R110_BCL2-01      ---------gt---------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          -------gaat---------------------------------------
A0A452T603_BCL2-01      -------gggc---------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          ---------gt---------------------------------------
Q8I008_BCL2-01          ---------gt---------------------------------------
Q00709_BCL2-01          ---------gt---------------------------------------
G1MZW1_BCL2-01          ---------gt---------------------------------------
A0A218UQA0_BCL2-01      ---------gt---------------------------------------
H0YUX3_BCL2-01          ---------gt---------------------------------------
A0A493T1X3_BCL2-01      ---------gt---------------------------------------
U3KEW4_BCL2-01          ---------gt---------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          ---------gt---------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          ----atgttccac--------------------------------ccat-
Q564A4_BCL2-01          ----gtgttccac--------------------------------ccgt-
B9ZYL7_BCL2-01          ------gtttgaccag-----------------------------agct-
A0A3P8YNB4_BCL2-01      ----gtgttc---tgt-----------------------------tcat-
A0A3B4A3G8_BCL2-01      ----gtcttctcctgc-----------------------------tctt-
A0A3Q2XQX2_BCL2-01      ----gtcttcagctgc-----------------------------acgt-
A0A3Q2XQX2_BCL2-02      ----gtcttcagctgc-----------------------------acgt-
A0A3P9J8Y9_BCL2-01      ----gtcttcagctgc-----------------------------tact-
A0A3Q2PN77_BCL2-01      ----atcttcagctgc-----------------------------tact-
A0A3Q3B0R2_BCL2-01      ----gtcttcagctgc-----------------------------tact-
A0A3P8WUE9_BCL2-01      ----gccttcagctgc-----------------------------tcct-
A0A3Q3K1K1_BCL2-01      ----gtcttcagttgc-----------------------------tctt-
A0A2U9BJ09_BCL2-01      ----gtcttcagctgc-----------------------------tcct-
A0A3Q3MEY1_BCL2-01      ----gtcttcagttgt-----------------------------tcct-
A0A3Q3G1D7_BCL2-01      ----gccttctgctcc-----------------------------tcct-
A0A3Q1I5N1_BCL2-01      ----gtgttcagttgc-----------------------------tcct-
A0A3Q0S5Z7_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3P8QVM8_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3P9DIG5_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3Q2UYW8_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3B4G3K4_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3B4TX71_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3B4YAG2_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3B5BBQ0_BCL2-01      ----gtcttcagttgc-----------------------------tctt-
A0A3Q1B8C3_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3P8S9L3_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A3Q1FLK7_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A1X9JZA1_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
A0A4D6FTA2_BCL2-01      ----gtcttcagttgc-----------------------------tcct-
W5N4F7_BCL2-01          --------tcagctgt-----------------------------tcat-
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------ttgatttc-----------------------------tcct-
Q7TSN8_BCL2-01          --------ttgatttc-----------------------------tcct-
F1LNV0_BCL2-01          --------ttgatttc-----------------------------tcct-
P49950_BCL2-01          --------ttgatttc-----------------------------tcct-
Q6R755_BCL2-01          --------ttgatttc-----------------------------tcct-
Q9JJV8_BCL2-01          --------ttgatttc-----------------------------tctt-
Q923R6_BCL2-01          --------ttgatttc-----------------------------tctt-
O02718_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A4P8GLJ2_BCL2-01      --------ttgatttc-----------------------------tcct-
F6R2C4_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A076FU27_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A076FZV9_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A452EV13_BCL2-01      --------ttgatttc-----------------------------tcct-
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------ttgatttc-----------------------------tcct-
G1TW27_BCL2-01          --------cagacttc-----------------------------tcct-
G1TW27_BCL2-02          cagaatgacagacttc-----------------------------tgctc
A0A250YD83_BCL2-01      --------ttgacttc-----------------------------tcct-
H0WKI0_BCL2-01          --------ttgacttc-----------------------------tcct-
A0A2K6G3I7_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K5PP81_BCL2-01      --------tcgatttc-----------------------------tcct-
A0A2K5EB04_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K6UEL3_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2R8MY14_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K6KHG1_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K6R2I5_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K5XRD4_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K5NZS5_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A0D9S017_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K5UDI5_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A2K6CIX3_BCL2-01      --------ttgatttc-----------------------------tcct-
A0A096MPU7_BCL2-01      --------ttgatttc-----------------------------tcct-
H2NWH5_BCL2-01          --------ttgatttc-----------------------------tcct-
G3QES9_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A2I3GZF9_BCL2-01      --------ttgatttc-----------------------------tcct-
A9QXG9_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A2R9APW6_BCL2-01      --------ttgatttc-----------------------------tcct-
H2QEM8_BCL2-01          --------ttgatttc-----------------------------tcct-
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------ttgacttc-----------------------------tcct-
M3YYK3_BCL2-01          ---------------------------------------------tcca-
E2QWA1_BCL2-02          --------ttgacttc-----------------------------tcct-
Q75SV7_BCL2-01          --------ttgacttc-----------------------------tcct-
A0A3Q2HRY3_BCL2-02      --------ttaacttcagacaaggatgtaatcgacaggacacccatccgc
A0A3Q2HRY3_BCL2-01      --------ttgatttc-----------------------------tcct-
G1LIC9_BCL2-01          --------ttgacttc-----------------------------tcct-
A0A452R110_BCL2-01      --------ttgacttc-----------------------------tcct-
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------taaaaagc-----------------------------tcccg
A0A452T603_BCL2-01      --------tgcacgtt-----------------------------tcaa-
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------ttgatttc-----------------------------tcct-
Q8I008_BCL2-01          --------ttgatttc-----------------------------tcct-
Q00709_BCL2-01          --------tcgatttc-----------------------------tcct-
G1MZW1_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A218UQA0_BCL2-01      --------ttgatttc-----------------------------tcct-
H0YUX3_BCL2-01          --------ttgatttc-----------------------------tcct-
A0A493T1X3_BCL2-01      --------tcgatttc-----------------------------tcct-
U3KEW4_BCL2-01          --------tcgatttc-----------------------------tcct-
A0A452I9V7_BCL2-01      -----------atttc-----------------------------t----
K7F5Y3_BCL2-01          --------ttgatttc-----------------------------tcct-
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      ----gtgatggcctgc-----------------------------ttct-
A0A0U3DHY6_BCL2-01      -------------cac-----------------------------tcct-
A0A3P9AAB2_BCL2-01      ----ctctt---ccat-----------------------------tcat-
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          tgccagctctgagcacagcgcatcacatggaaaggagcggctagatttga
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          gggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaa
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          gagttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaa
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          tgtcg---------------------tacctaacga--------------
Q564A4_BCL2-01          tttca---------------------tacctaacaa--------------
B9ZYL7_BCL2-01          ggtta---------------------tccatcaaga--------------
A0A3P8YNB4_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3B4A3G8_BCL2-01      ggccg---------------------tccatcaaaa--------------
A0A3Q2XQX2_BCL2-01      ggccg---------------------tccatcaaga--------------
A0A3Q2XQX2_BCL2-02      ggccg---------------------tccatcaaga--------------
A0A3P9J8Y9_BCL2-01      ggccg---------------------tccatcaaga--------------
A0A3Q2PN77_BCL2-01      ggccg---------------------tccatcaaga--------------
A0A3Q3B0R2_BCL2-01      ggccg---------------------tccatcaaga--------------
A0A3P8WUE9_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3Q3K1K1_BCL2-01      ggcct---------------------tccatcaaga--------------
A0A2U9BJ09_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3Q3MEY1_BCL2-01      ggccc---------------------tccatcaaaa--------------
A0A3Q3G1D7_BCL2-01      ggccc---------------------tccattaaga--------------
A0A3Q1I5N1_BCL2-01      ggtcc---------------------tccatcaaga--------------
A0A3Q0S5Z7_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3P8QVM8_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3P9DIG5_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3Q2UYW8_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3B4G3K4_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3B4TX71_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3B4YAG2_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3B5BBQ0_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3Q1B8C3_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3P8S9L3_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A3Q1FLK7_BCL2-01      ggccc---------------------tccatcaaga--------------
A0A1X9JZA1_BCL2-01      ggccc---------------------tccattaaga--------------
A0A4D6FTA2_BCL2-01      ggccc---------------------tccattaaga--------------
W5N4F7_BCL2-01          ggcca---------------------tctttgaaga--------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          ---------------------------------agg--------------
P10417_BCL2-01          ggctg---------------------tctctgaaga--------------
Q7TSN8_BCL2-01          ggctg---------------------tctctgaaga--------------
F1LNV0_BCL2-01          ggctg---------------------tctctgaaga--------------
P49950_BCL2-01          ggctg---------------------tctctgaaga--------------
Q6R755_BCL2-01          ggctg---------------------tctctgaagg--------------
Q9JJV8_BCL2-01          ggctg---------------------tctctgaaga--------------
Q923R6_BCL2-01          ggctg---------------------tctctgaana--------------
O02718_BCL2-01          ggctg---------------------tctctgaagg--------------
A0A4P8GLJ2_BCL2-01      ggctg---------------------tctctgaagg--------------
F6R2C4_BCL2-01          ggctg---------------------tctctgaagg--------------
A0A076FU27_BCL2-01      ggctg---------------------tctctgaagg--------------
A0A076FZV9_BCL2-01      ggctg---------------------tctctgaagg--------------
A0A452EV13_BCL2-01      ggctg---------------------tctctgaagg--------------
G3SLZ1_BCL2-02          -----------------------------ttgaa----------------
G3SLZ1_BCL2-01          ggctg---------------------tctctgaaga--------------
G1TW27_BCL2-01          gggtg---------------------tctctgaaga--------------
G1TW27_BCL2-02          ggatgtacttccatgcatttacataatctacgaagc--------------
A0A250YD83_BCL2-01      ggctg---------------------tctctgaaga--------------
H0WKI0_BCL2-01          ggctg---------------------tctctgaaga--------------
A0A2K6G3I7_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K5PP81_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K5EB04_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K6UEL3_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2R8MY14_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K6R2I5_BCL2-02      -gccg---------------------cttcag------------------
A0A2K5HK49_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K6KHG1_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K6R2I5_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K5XRD4_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K5NZS5_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A0D9S017_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K5UDI5_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A2K6CIX3_BCL2-01      ggctg---------------------tctctgaaga--------------
A0A096MPU7_BCL2-01      ggctg---------------------tctctgaaga--------------
H2NWH5_BCL2-01          ggctg---------------------tctctgaaga--------------
G3QES9_BCL2-01          ggctg---------------------tctctgaaga--------------
A0A2I3GZF9_BCL2-01      ggctg---------------------tctctgaaga--------------
A9QXG9_BCL2-01          ggctg---------------------tctctgaaga--------------
A0A2R9APW6_BCL2-01      ggctg---------------------tctctgaaga--------------
H2QEM8_BCL2-01          ggctg---------------------tctctgaaga--------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          ggctg---------------------tctctgaagg--------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          ggctg---------------------tctctgaagg--------------
Q75SV7_BCL2-01          ggctg---------------------tctctgaagg--------------
A0A3Q2HRY3_BCL2-02      atgta---------------------tcagggaaggaagagtagagaggc
A0A3Q2HRY3_BCL2-01      ggctg---------------------tctctgaagg--------------
G1LIC9_BCL2-01          ggctg---------------------tctctgaagg--------------
A0A452R110_BCL2-01      ggctg---------------------tctctgaagg--------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          ggctc---------------------tccgtgaaga--------------
A0A452T603_BCL2-01      atctg---------------------aggctgagaa--------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          ggctg---------------------tccctgaagg--------------
Q8I008_BCL2-01          ggctg---------------------tccctgaagg--------------
Q00709_BCL2-01          ggatc---------------------tctctgaaga--------------
G1MZW1_BCL2-01          ggatc---------------------tctctgaaga--------------
A0A218UQA0_BCL2-01      ggatc---------------------tctctgaaga--------------
H0YUX3_BCL2-01          ggatc---------------------tctctgaaga--------------
A0A493T1X3_BCL2-01      ggatc---------------------tctctgaaga--------------
U3KEW4_BCL2-01          ggatc---------------------tctctgaaga--------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          ggatc---------------------tctttgaaga--------------
K7F5Y3_BCL2-02          ----------------------------------ga--------------
A0A3B3TCS4_BCL2-01      ggccg---------------------tacctgaaga--------------
A0A0U3DHY6_BCL2-01      ggccg---------------------tacctaaaga--------------
A0A3P9AAB2_BCL2-01      ggcct---------------------ttcctcaaga--------------
                                                                          

X4ZGI8_BCL2-01          -------aagtgcttg--------------------------------ga
Q564A4_BCL2-01          -------aagtgctcg--------------------------------gc
B9ZYL7_BCL2-01          -------caatattaa--------------------------------gc
A0A3P8YNB4_BCL2-01      -------ctgtctttg--------------------------------gc
A0A3B4A3G8_BCL2-01      -------ccgtgttcg--------------------------------ga
A0A3Q2XQX2_BCL2-01      -------cagtcttcg--------------------------------gc
A0A3Q2XQX2_BCL2-02      -------cagtcttcg--------------------------------gc
A0A3P9J8Y9_BCL2-01      -------ctgtcttcg--------------------------------gc
A0A3Q2PN77_BCL2-01      -------ctgtcttcg--------------------------------gc
A0A3Q3B0R2_BCL2-01      -------cagtcttcg--------------------------------gc
A0A3P8WUE9_BCL2-01      -------ccgtctttg--------------------------------gt
A0A3Q3K1K1_BCL2-01      -------cagtttttg--------------------------------gt
A0A2U9BJ09_BCL2-01      -------ccgtcttcg--------------------------------gc
A0A3Q3MEY1_BCL2-01      -------cagtcttcg--------------------------------gc
A0A3Q3G1D7_BCL2-01      -------cagtcttcg--------------------------------gt
A0A3Q1I5N1_BCL2-01      -------cggtcttcg--------------------------------gc
A0A3Q0S5Z7_BCL2-01      -------cagttttcg--------------------------------gc
A0A3P8QVM8_BCL2-01      -------cagttttcg--------------------------------gc
A0A3P9DIG5_BCL2-01      -------cagttttcg--------------------------------gc
A0A3Q2UYW8_BCL2-01      -------cagttttcg--------------------------------gc
A0A3B4G3K4_BCL2-01      -------cagttttcg--------------------------------gc
A0A3B4TX71_BCL2-01      -------cagtcttcg--------------------------------gc
A0A3B4YAG2_BCL2-01      -------cagtcttcg--------------------------------gc
A0A3B5BBQ0_BCL2-01      -------cggtcttcg--------------------------------gt
A0A3Q1B8C3_BCL2-01      -------cggtcttcg--------------------------------gt
A0A3P8S9L3_BCL2-01      -------cggtcttcg--------------------------------gt
A0A3Q1FLK7_BCL2-01      -------cggttttcg--------------------------------gt
A0A1X9JZA1_BCL2-01      -------cggtcttcg--------------------------------gt
A0A4D6FTA2_BCL2-01      -------cggtcttcg--------------------------------gt
W5N4F7_BCL2-01          -------ctttctttg--------------------------------gt
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          -------ccctgctca--------------------------------gc
Q7TSN8_BCL2-01          -------ccctgctca--------------------------------gc
F1LNV0_BCL2-01          -------cgctgctca--------------------------------gc
P49950_BCL2-01          -------cgctgctca--------------------------------gc
Q6R755_BCL2-01          -------cgctgctca--------------------------------gt
Q9JJV8_BCL2-01          -------ccctgctca--------------------------------gc
Q923R6_BCL2-01          -------ccctgctca--------------------------------ac
O02718_BCL2-01          -------cactgctca--------------------------------gt
A0A4P8GLJ2_BCL2-01      -------cactgctca--------------------------------gt
F6R2C4_BCL2-01          -------cactgctca--------------------------------gt
A0A076FU27_BCL2-01      -------cactgctca--------------------------------gt
A0A076FZV9_BCL2-01      -------cactgctca--------------------------------gt
A0A452EV13_BCL2-01      -------cactgctca--------------------------------gt
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          -------cactgctca--------------------------------gt
G1TW27_BCL2-01          -------ctttgttca--------------------------------gc
G1TW27_BCL2-02          -------cttttcccatcttgaagtcttactttatgtgttgcagtgggac
A0A250YD83_BCL2-01      -------ctctgctca--------------------------------gc
H0WKI0_BCL2-01          -------ccctgctca--------------------------------gc
A0A2K6G3I7_BCL2-01      -------ctctgctca--------------------------------gc
A0A2K5PP81_BCL2-01      -------ctctgctca--------------------------------gc
A0A2K5EB04_BCL2-01      -------ctctgctca--------------------------------gc
A0A2K6UEL3_BCL2-01      -------ctctgctca--------------------------------gc
A0A2R8MY14_BCL2-01      -------ctctgctca--------------------------------gc
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K6KHG1_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K6R2I5_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K5XRD4_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K5NZS5_BCL2-01      -------ctctgctca--------------------------------gt
A0A0D9S017_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K5UDI5_BCL2-01      -------ctctgctca--------------------------------gt
A0A2K6CIX3_BCL2-01      -------ctctgctca--------------------------------gt
A0A096MPU7_BCL2-01      -------ctctgctca--------------------------------gt
H2NWH5_BCL2-01          -------ctctgctca--------------------------------gt
G3QES9_BCL2-01          -------ctctgctca--------------------------------gt
A0A2I3GZF9_BCL2-01      -------ctctgctca--------------------------------gt
A9QXG9_BCL2-01          -------ctctgctca--------------------------------gt
A0A2R9APW6_BCL2-01      -------ctctgctca--------------------------------gt
H2QEM8_BCL2-01          -------ctctgctca--------------------------------gt
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          -------cgctgctca--------------------------------gt
M3YYK3_BCL2-01          --------gctgccag--------------------------------ac
E2QWA1_BCL2-02          -------cgctgctca--------------------------------gt
Q75SV7_BCL2-01          -------cgctgctca--------------------------------gt
A0A3Q2HRY3_BCL2-02      agaaatacaaagccag--------------------------------tg
A0A3Q2HRY3_BCL2-01      -------cgctgctca--------------------------------gt
G1LIC9_BCL2-01          -------ccctgctca--------------------------------gt
A0A452R110_BCL2-01      -------ccctgctca--------------------------------gt
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          -------c------------------------------------------
A0A452T603_BCL2-01      -------tccg--tgg--------------------------------tt
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          -------ccctgctca--------------------------------gt
Q8I008_BCL2-01          -------ccctgctca--------------------------------gt
Q00709_BCL2-01          -------ccatcctga--------------------------------gc
G1MZW1_BCL2-01          -------ccatcctga--------------------------------gc
A0A218UQA0_BCL2-01      -------ctatcctga--------------------------------gt
H0YUX3_BCL2-01          -------ctatcctga--------------------------------gt
A0A493T1X3_BCL2-01      -------ctatcctga--------------------------------gt
U3KEW4_BCL2-01          -------ctatcctga--------------------------------gt
A0A452I9V7_BCL2-01      ----------ttctc-----------------------------------
K7F5Y3_BCL2-01          -------ctatcctca--------------------------------gt
K7F5Y3_BCL2-02          -------gcgttctc-----------------------------------
A0A3B3TCS4_BCL2-01      -------cagtgtttg--------------------------------gc
A0A0U3DHY6_BCL2-01      -------cagtgttcg--------------------------------gc
A0A3P9AAB2_BCL2-01      -------ccatgttta--------------------------------gc
                                                                          

X4ZGI8_BCL2-01          ttggca--gcactag---------gcttggca---------ggagtg---
Q564A4_BCL2-01          ttggcg--gcgctgg---------gcttggca---------ggagtg---
B9ZYL7_BCL2-01          cttgct--gtggttg---------gagcc------------tgcatc---
A0A3P8YNB4_BCL2-01      ctggct--gcactgg---------gggctgca---------agcctc---
A0A3B4A3G8_BCL2-01      ttagct--gctatcg---------gagcggcg---------agcctg---
A0A3Q2XQX2_BCL2-01      ctggcc--gcgctcg---------gggcggcc---------agcctc---
A0A3Q2XQX2_BCL2-02      ctggcc--gcgctcg---------gggcggcc---------agcctc---
A0A3P9J8Y9_BCL2-01      ctggct--gctctcg---------gggcggcg---------agcctg---
A0A3Q2PN77_BCL2-01      ctggct--gcgctgg---------gggcggcc---------agcatc---
A0A3Q3B0R2_BCL2-01      ctggcg--gcgctcg---------gggcggcc---------agcatc---
A0A3P8WUE9_BCL2-01      ctggct--gcactgg---------gggccgcc---------agcctc---
A0A3Q3K1K1_BCL2-01      ctggct--gcacttg---------gagcagct---------agcctt---
A0A2U9BJ09_BCL2-01      ctggct--gcactcg---------gggcggcg---------agcctc---
A0A3Q3MEY1_BCL2-01      ctggct--gcacttg---------gggcagct---------agcatt---
A0A3Q3G1D7_BCL2-01      ctggca--gcactcg---------gggcggct---------agcctc---
A0A3Q1I5N1_BCL2-01      ctcgct--gctctcg---------gggcagcc---------agcctc---
A0A3Q0S5Z7_BCL2-01      ttggct--gcactcg---------gagcggcc---------agcctc---
A0A3P8QVM8_BCL2-01      ttggct--gcgctcg---------gagcggcc---------agcctc---
A0A3P9DIG5_BCL2-01      ttggct--gcgctcg---------gagcggcc---------agcctc---
A0A3Q2UYW8_BCL2-01      ttggct--gcgctcg---------gagcggcc---------agcctc---
A0A3B4G3K4_BCL2-01      ttggct--gcgctcg---------gagcggcc---------agcctc---
A0A3B4TX71_BCL2-01      ctggct--gcactcg---------gggcagcg---------agcctc---
A0A3B4YAG2_BCL2-01      ctggct--gcactcg---------gggcagcg---------agcctc---
A0A3B5BBQ0_BCL2-01      ctggca--gcactcg---------gggcagcg---------agcctc---
A0A3Q1B8C3_BCL2-01      ctggca--gcactcg---------gggcagcg---------agcctc---
A0A3P8S9L3_BCL2-01      ctggca--gcactcg---------gggcagcg---------agcctc---
A0A3Q1FLK7_BCL2-01      ctggca--gcactcg---------gggcggcg---------agcctc---
A0A1X9JZA1_BCL2-01      gtggct--gcgcttg---------gagcagct---------agcctc---
A0A4D6FTA2_BCL2-01      atggct--gcgctcg---------gggcagcc---------agcctc---
W5N4F7_BCL2-01          ctagct--gctctgg---------gcgc-------------agcaggcct
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          ------------tag-----------------------------------
G3WZW9_BCL2-01          --------tgcatgg-----------------------------------
G3WZW9_BCL2-02          ------------tag-----------------------------------
H0W1T3_BCL2-01          -----------------------------------------tgcatg---
P10417_BCL2-01          ctggcc--ctggtcg---------gggc----------c--tgcatc---
Q7TSN8_BCL2-01          ctggcc--ctggtcg---------gggc----------c--tgcatc---
F1LNV0_BCL2-01          ctggcc--ctggtgg---------gggc----------c--tgcatc---
P49950_BCL2-01          ctggcc--ctggtgg---------gggc----------c--tgcatc---
Q6R755_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
Q9JJV8_BCL2-01          ctggcc--ctggtcg---------gggc----------c--tgcatc---
Q923R6_BCL2-01          ctggcc--ctggtcg---------gggc----------c--tgcatc---
O02718_BCL2-01          ctggcc--ctggtgg---------gcgc----------t--tgcatc---
A0A4P8GLJ2_BCL2-01      ctggcc--ctggtgg---------gcgc----------t--tgcatc---
F6R2C4_BCL2-01          ctggcc--ctggtgg---------gcgc----------t--tgcatc---
A0A076FU27_BCL2-01      ctggcc--ctggtgg---------gcgc----------t--tgcatc---
A0A076FZV9_BCL2-01      ctggcc--ctggtgg---------gcgc----------t--tgcatc---
A0A452EV13_BCL2-01      ctggcc--ctggtgg---------gcgc----------t--tgcatc---
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
G1TW27_BCL2-01          ctggcc--ctgatag---------gagc----------t--tgcatc---
G1TW27_BCL2-02          ctggccagctgccagctgcagtttgagcccatttccttt--tgcatt---
A0A250YD83_BCL2-01      ctggcc--ctggtgg---------gagt----------c--tgtatc---
H0WKI0_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6G3I7_BCL2-01      ctggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K5PP81_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K5EB04_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6UEL3_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2R8MY14_BCL2-01      ttggtc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6KHG1_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6R2I5_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K5XRD4_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K5NZS5_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A0D9S017_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K5UDI5_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2K6CIX3_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A096MPU7_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
H2NWH5_BCL2-01          ttggcc--ctggtgg---------gagc----------t--tgcatc---
G3QES9_BCL2-01          ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2I3GZF9_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
A9QXG9_BCL2-01          ttggcc--ctggtgg---------gagc----------t--tgcatc---
A0A2R9APW6_BCL2-01      ttggcc--ctggtgg---------gagc----------t--tgcatc---
H2QEM8_BCL2-01          ttggcc--ctggtgg---------gagc----------t--tgcatc---
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
M3YYK3_BCL2-01          ctattg--ttgatga---------ttcc----------tactg-------
E2QWA1_BCL2-02          ctggcc--ctggtgg---------gagc----------t--tgcatc---
Q75SV7_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
A0A3Q2HRY3_BCL2-02      cagacc--tccgtgc---------atgc----------tgctgcacctgc
A0A3Q2HRY3_BCL2-01      ctggcc--ctggtgg---------gagc----------t--tgcatc---
G1LIC9_BCL2-01          ctggcc--ctggtgg---------gagc----------t--tgcatc---
A0A452R110_BCL2-01      ctggcc--ctggtgg---------gagc----------t--tgcatc---
A0A452R110_BCL2-02      ----------------------------------------------c---
M3X1R9_BCL2-02          -----------gtaa---------gaat----------t--t----c---
A0A452T603_BCL2-01      ggagtg--tgggtgg---------gctc----------t--tggg-----
G1LIC9_BCL2-02          --------------------------gc----------t--tgaa-----
M3X1R9_BCL2-01          ctggcc--ctggtgg---------gggc----------t--tgcatc---
Q8I008_BCL2-01          ctggcc--ctggtgg---------gggc----------t--tgcatc---
Q00709_BCL2-01          ctggtt--ctggtgg---------gagc----------t--tgcatc---
G1MZW1_BCL2-01          ctggtt--ctggtgg---------gagc----------t--tgcatc---
A0A218UQA0_BCL2-01      ctggtt--ctggtgg---------gagc----------t--tgcatc---
H0YUX3_BCL2-01          ctggtt--ctggtgg---------gagc----------t--tgcatc---
A0A493T1X3_BCL2-01      ttggtt--ctggtgg---------gagc----------t--tgcatc---
U3KEW4_BCL2-01          ctggtt--ctggtgg---------gagc----------t--tgcatc---
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          cttgct--ctggtgg---------gagc----------t--tgcatc---
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      ctggct--gctctgg---------gggccgtc---------ggggtc---
A0A0U3DHY6_BCL2-01      ctggcc--gccctgg---------gagccgtc---------ggagtc---
A0A3P9AAB2_BCL2-01      ttggcc--gccctgg---------gggcagct---------ggagtc---
                                                                          

X4ZGI8_BCL2-01          -----accatcggagcct------ttttcgctca---gaag---------
Q564A4_BCL2-01          -----accatcggagcct------tttttgctca---gaag---------
B9ZYL7_BCL2-01          -----acaatagggggca----tatccttggccac--caaa---------
A0A3P8YNB4_BCL2-01      -----accattggagcat------accttacaca---gaag---------
A0A3B4A3G8_BCL2-01      -----accatcggcgcgt------acctgtcgca---gaag---------
A0A3Q2XQX2_BCL2-01      -----accattggcgcgt------acctcaccca---gaag---------
A0A3Q2XQX2_BCL2-02      -----accattggcgcgt------acctcaccca---gaag---------
A0A3P9J8Y9_BCL2-01      -----accattggagcat------accttgcaca---aaag---------
A0A3Q2PN77_BCL2-01      -----accatcggggcgt------accttgcaca---gaag---------
A0A3Q3B0R2_BCL2-01      -----accatcggcgcgt------acctcacgca---aaagatgcccctg
A0A3P8WUE9_BCL2-01      -----accatcggagcgt------atctgaccca---gaag---------
A0A3Q3K1K1_BCL2-01      -----actattggagctt------accttacaca---gaaa---------
A0A2U9BJ09_BCL2-01      -----accatcggagcgt------acctcacgca---gaag---------
A0A3Q3MEY1_BCL2-01      -----actatcggagcat------accttacaca---gaag---------
A0A3Q3G1D7_BCL2-01      -----accattggagcat------accttacaca---gaaa---------
A0A3Q1I5N1_BCL2-01      -----accattggagctt------accttgcaca---gaaa---------
A0A3Q0S5Z7_BCL2-01      -----accatcggagcat------atcttacaca---aaag---------
A0A3P8QVM8_BCL2-01      -----accatcggagcat------accttacaca---aaag---------
A0A3P9DIG5_BCL2-01      -----accatcggagcat------accttacaca---aaag---------
A0A3Q2UYW8_BCL2-01      -----accatcggagcat------accttacaca---aaag---------
A0A3B4G3K4_BCL2-01      -----accatcggagcat------accttacaca---aaag---------
A0A3B4TX71_BCL2-01      -----accatcggagcat------accttacaca---gaag---------
A0A3B4YAG2_BCL2-01      -----accatcggagcat------accttacaca---gaag---------
A0A3B5BBQ0_BCL2-01      -----accatcggagcgt------accttacaca---aaag---------
A0A3Q1B8C3_BCL2-01      -----accatcggagcgt------accttacaca---aaag---------
A0A3P8S9L3_BCL2-01      -----accatcggagcgt------accttacaca---aaag---------
A0A3Q1FLK7_BCL2-01      -----accatcggagcgt------accttacaca---aaag---------
A0A1X9JZA1_BCL2-01      -----accatcggagcgt------accttacaca---gaag---------
A0A4D6FTA2_BCL2-01      -----accatcggggcat------accttacaca---gaag---------
W5N4F7_BCL2-01          g----accgttggagcct------actttacaca---aaaa---------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          -----g-----------t------gcctag--------------------
G3WZW9_BCL2-01          -----gcaccagtggtcc------atttcagg-----taag---------
G3WZW9_BCL2-02          -----g-----------t------gtttcggc-----t------------
H0W1T3_BCL2-01          ----------------tt-------------------tgag---------
P10417_BCL2-01          -----actctgggtgcat------acctgggcca---caag---------
Q7TSN8_BCL2-01          -----actctgggtgcat------acctgggcca---caag---------
F1LNV0_BCL2-01          -----actctgggtgcat------acctgggcca---caag---------
P49950_BCL2-01          -----actctgggtgcat------acctgggcca---caag---------
Q6R755_BCL2-01          -----accctgggtgcct------atctgggcca---taag---------
Q9JJV8_BCL2-01          -----actctgggtacct------acctgggcca---caag---------
Q923R6_BCL2-01          -----actctgggtacct------acctgggcca---caag---------
O02718_BCL2-01          -----accctgggtgcct------atctgggcca---taag---------
A0A4P8GLJ2_BCL2-01      -----accctgggtgcct------atctgggcca---taag---------
F6R2C4_BCL2-01          -----accctgggtgcct------atctgggcca---taag---------
A0A076FU27_BCL2-01      -----accctgggtgcct------atctgggcca---taag---------
A0A076FZV9_BCL2-01      -----accctgggtgcct------atctgggcca---taag---------
A0A452EV13_BCL2-01      -----accctgggtgcct------atctgggcca---taag---------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          -----accctgggtgctt------acctggggca---caag---------
G1TW27_BCL2-01          -----accctcggtgcct------acctgggcca---caag---------
G1TW27_BCL2-02          -----ggtttctgtgtccagggaaaccttgtttc---tcta---------
A0A250YD83_BCL2-01      -----accctgggtgcct------acctgggcca---caag---------
H0WKI0_BCL2-01          -----accctgggtgcct------acctgggcca---caag---------
A0A2K6G3I7_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K5PP81_BCL2-01      -----accctgggtgcct------atctgggcca---caaa---------
A0A2K5EB04_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K6UEL3_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2R8MY14_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K6R2I5_BCL2-02      ----------------------------gggatg---tgat---------
A0A2K5HK49_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K6KHG1_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K6R2I5_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K5XRD4_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K5NZS5_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A0D9S017_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K5UDI5_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A2K6CIX3_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A0A096MPU7_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
H2NWH5_BCL2-01          -----accctgggtgcct------atctgggcca---caag---------
G3QES9_BCL2-01          -----accctgggtgcct------atctgggcca---caag---------
A0A2I3GZF9_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
A9QXG9_BCL2-01          -----accctgggtgcct------atctgagcca---caag---------
A0A2R9APW6_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
H2QEM8_BCL2-01          -----accctgggtgcct------atctgggcca---caag---------
I3MVK9_BCL2-01          ----------gggt-----------------------tgaa---------
E2QWA1_BCL2-01          -----accctgggtgcct------atctgggcca---taag---------
M3YYK3_BCL2-01          -----gcccaaagtgttt------tccttgcttgcc--------------
E2QWA1_BCL2-02          -----accctgggtgcct------atctgggcca---taag---------
Q75SV7_BCL2-01          -----accctgggtgcct------atctgggcca---taag---------
A0A3Q2HRY3_BCL2-02      tggaaatccaggttccag------ttctgtttctcagtgag---------
A0A3Q2HRY3_BCL2-01      -----accctgggtgcct------atctgggcca---caag---------
G1LIC9_BCL2-01          -----accctgggtgcct------acctgggcca---caag---------
A0A452R110_BCL2-01      -----accctgggtgcct------acctgggcca---caag---------
A0A452R110_BCL2-02      -----acactaa--------------------------------------
M3X1R9_BCL2-02          -----accctcttttctt------tttaaagact-ag-------------
A0A452T603_BCL2-01      ------ccaagggcaaac------tgatgagcca-gggaaa---------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          -----accctgggtgcct------atctgggcca---caag---------
Q8I008_BCL2-01          -----accctgggtgcct------atctgggcca---caag---------
Q00709_BCL2-01          -----actcttggcgctt------atcttggaca---taag---------
G1MZW1_BCL2-01          -----actcttggcgctt------atcttggaca---taag---------
A0A218UQA0_BCL2-01      -----actcttggcgctt------atcttggaca---taag---------
H0YUX3_BCL2-01          -----actcttggcgctt------atcttggaca---taag---------
A0A493T1X3_BCL2-01      -----actcttggcgctt------atctcggaca---taag---------
U3KEW4_BCL2-01          -----actcttggcgctt------atctcggaca---taag---------
A0A452I9V7_BCL2-01      --------------------------tttaaatt---acag---------
K7F5Y3_BCL2-01          -----acccttggagctt------atctgggaca---taag---------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      -----acaatcagcgcct------atttcaccaa---gaag---------
A0A0U3DHY6_BCL2-01      -----accatcggagcct------tgttcaccca---gaag---------
A0A3P9AAB2_BCL2-01      -----accattggagcca------tgttcaccca---gaag---------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      acccctcagagacaaccttcagaccagatctggctctcttcaaagcctcg
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      ctcagagaactgctttcctcctcctgcgcctccatgtcaaaacagacaca
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A3P8YNB4_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      --------------------------------------------------
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3P9J8Y9_BCL2-01      --------------------------------------------------
A0A3Q2PN77_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      aatcaaaacagcagagggaaccagaggcacggcccagagagcaaaggatg
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3Q3K1K1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A3Q1I5N1_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
G1TW27_BCL2-02          --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
E2QWA1_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
M3X1R9_BCL2-02          --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A218UQA0_BCL2-01      --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A3P9AAB2_BCL2-01      --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --tga----------------
Q564A4_BCL2-01          --tga----------------
B9ZYL7_BCL2-01          --taa----------------
A0A3P8YNB4_BCL2-01      --tga----------------
A0A3B4A3G8_BCL2-01      --tga----------------
A0A3Q2XQX2_BCL2-01      --tga----------------
A0A3Q2XQX2_BCL2-02      --tga----------------
A0A3P9J8Y9_BCL2-01      --tga----------------
A0A3Q2PN77_BCL2-01      --tga----------------
A0A3Q3B0R2_BCL2-01      tctgaggtggaatcacactag
A0A3P8WUE9_BCL2-01      --tga----------------
A0A3Q3K1K1_BCL2-01      --tga----------------
A0A2U9BJ09_BCL2-01      --tga----------------
A0A3Q3MEY1_BCL2-01      --tga----------------
A0A3Q3G1D7_BCL2-01      --tga----------------
A0A3Q1I5N1_BCL2-01      --tga----------------
A0A3Q0S5Z7_BCL2-01      --tga----------------
A0A3P8QVM8_BCL2-01      --tga----------------
A0A3P9DIG5_BCL2-01      --tga----------------
A0A3Q2UYW8_BCL2-01      --tga----------------
A0A3B4G3K4_BCL2-01      --tga----------------
A0A3B4TX71_BCL2-01      --tga----------------
A0A3B4YAG2_BCL2-01      --tga----------------
A0A3B5BBQ0_BCL2-01      --tga----------------
A0A3Q1B8C3_BCL2-01      --tga----------------
A0A3P8S9L3_BCL2-01      --tga----------------
A0A3Q1FLK7_BCL2-01      --tga----------------
A0A1X9JZA1_BCL2-01      --tga----------------
A0A4D6FTA2_BCL2-01      --tga----------------
W5N4F7_BCL2-01          --tga----------------
H9GPE7_BCL2-01          ---------------------
F6YNL8_BCL2-01          ---------------------
G3WZW9_BCL2-01          --ttaa---------------
G3WZW9_BCL2-02          ---------------------
H0W1T3_BCL2-01          --tgag---------------
P10417_BCL2-01          --tga----------------
Q7TSN8_BCL2-01          --tga----------------
F1LNV0_BCL2-01          --tga----------------
P49950_BCL2-01          --tga----------------
Q6R755_BCL2-01          --tga----------------
Q9JJV8_BCL2-01          --tga----------------
Q923R6_BCL2-01          --tga----------------
O02718_BCL2-01          ---------------------
A0A4P8GLJ2_BCL2-01      --tga----------------
F6R2C4_BCL2-01          --tga----------------
A0A076FU27_BCL2-01      --tga----------------
A0A076FZV9_BCL2-01      --tga----------------
A0A452EV13_BCL2-01      --tga----------------
G3SLZ1_BCL2-02          ---------------------
G3SLZ1_BCL2-01          --tga----------------
G1TW27_BCL2-01          --tga----------------
G1TW27_BCL2-02          --tga----------------
A0A250YD83_BCL2-01      --tga----------------
H0WKI0_BCL2-01          --tga----------------
A0A2K6G3I7_BCL2-01      --tga----------------
A0A2K5PP81_BCL2-01      --tga----------------
A0A2K5EB04_BCL2-01      --tga----------------
A0A2K6UEL3_BCL2-01      --tga----------------
A0A2R8MY14_BCL2-01      --tga----------------
A0A2K6R2I5_BCL2-02      --tga----------------
A0A2K5HK49_BCL2-01      --tga----------------
A0A2K6KHG1_BCL2-01      --tga----------------
A0A2K6R2I5_BCL2-01      --tga----------------
A0A2K5XRD4_BCL2-01      --tga----------------
A0A2K5NZS5_BCL2-01      --tga----------------
A0A0D9S017_BCL2-01      ---------------------
A0A2K5UDI5_BCL2-01      --tga----------------
A0A2K6CIX3_BCL2-01      --tga----------------
A0A096MPU7_BCL2-01      --tga----------------
H2NWH5_BCL2-01          --tga----------------
G3QES9_BCL2-01          --tga----------------
A0A2I3GZF9_BCL2-01      --tga----------------
A9QXG9_BCL2-01          --tga----------------
A0A2R9APW6_BCL2-01      --tga----------------
H2QEM8_BCL2-01          --tga----------------
I3MVK9_BCL2-01          --tga----------------
E2QWA1_BCL2-01          --tga----------------
M3YYK3_BCL2-01          ---------------------
E2QWA1_BCL2-02          --tga----------------
Q75SV7_BCL2-01          --tga----------------
A0A3Q2HRY3_BCL2-02      --taa----------------
A0A3Q2HRY3_BCL2-01      --tga----------------
G1LIC9_BCL2-01          ---------------------
A0A452R110_BCL2-01      --tga----------------
A0A452R110_BCL2-02      ---------------------
M3X1R9_BCL2-02          ---------------------
A0A452T603_BCL2-01      --taa----------------
G1LIC9_BCL2-02          ---------------------
M3X1R9_BCL2-01          --tga----------------
Q8I008_BCL2-01          --tga----------------
Q00709_BCL2-01          --tag----------------
G1MZW1_BCL2-01          ---------------------
A0A218UQA0_BCL2-01      --tag----------------
H0YUX3_BCL2-01          --tag----------------
A0A493T1X3_BCL2-01      --tag----------------
U3KEW4_BCL2-01          --tag----------------
A0A452I9V7_BCL2-01      --taa----------------
K7F5Y3_BCL2-01          --tga----------------
K7F5Y3_BCL2-02          ---------------------
A0A3B3TCS4_BCL2-01      --tga----------------
A0A0U3DHY6_BCL2-01      --tga----------------
A0A3P9AAB2_BCL2-01      --tga----------------
                                             

© 1998-2019