Dataset for CDS BCL-2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

69 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


X4ZGI8_BCL2-01          ------------------------------------------------at
Q564A4_BCL2-01          ------------------------------------------------at
A0A1X9JZA1_BCL2-01      ------------------------------------------------at
B9ZYL7_BCL2-01          ------------------------------------------------at
F7BXJ7_BCL2-01          ------------------------------------------------at
A0A287APJ6_BCL2-01      ------------------------------------------------at
A0A0U3DHY6_BCL2-01      ------------------------------------------------at
H9GPE7_BCL2-01          ------------------------------------------------at
W5N4F7_BCL2-01          ------------------------------------------------at
F6YNL8_BCL2-01          ---------------------------------------------atgat
G3WZW9_BCL2-01          ------------------------------------------------at
G3WZW9_BCL2-02          ccatttggctgctctccttggtgttcactgctctctcctttgggaataat
K7F5Y4_BCL2-02          ------------------------------------------------at
K7F5Y4_BCL2-01          ------------------------------------------------at
K7F5Y4_BCL2-03          ------------------------------------------------at
H0W1T3_BCL2-01          ------------------------------------------------at
F1LNV0_BCL2-01          ------------------------------------------------at
P49950_BCL2-01          ------------------------------------------------at
P10417_BCL2-02          ------------------------------------------------at
P10417_BCL2-01          ------------------------------------------------at
Q7TSN8_BCL2-01          ------------------------------------------------at
Q6R755_BCL2-01          ------------------------------------------------at
Q9JJV8_BCL2-01          ------------------------------------------------at
Q923R6_BCL2-01          ------------------------------------------------at
G3ULB7_BCL2-01          ------------------------------------------------at
G3ULB7_BCL2-02          ------------------------------------------------at
F6R2C4_BCL2-01          ------------------------------------------------at
O02718_BCL2-01          ------------------------------------------------at
A0A076FU27_BCL2-01      ------------------------------------------------at
A0A076FZV9_BCL2-01      ------------------------------------------------at
G1TW27_BCL2-01          ------------------------------------------------at
I3MVK9_BCL2-01          ------------------------------------------------at
M3YYK3_BCL2-01          ------------------------------------------------at
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          ------------------------------------------------at
A0A287APJ6_BCL2-03      ------------------------------------------------at
G1LID1_BCL2-02          ------------------------------------------------at
M3X1R9_BCL2-01          ------------------------------------------------at
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          ------------------------------------------------at
Q75SV7_BCL2-01          ------------------------------------------------at
H0WKI0_BCL2-01          ------------------------------------------------at
A0A2K6G3I7_BCL2-01      ------------------------------------------------at
A0A1D5QRF2_BCL2-01      ------------------------------------------------at
A0A2K5EB04_BCL2-01      ------------------------------------------------at
A0A2K6UEL3_BCL2-01      ------------------------------------------------at
A0A2R8MY14_BCL2-01      ------------------------------------------------at
A0A2K6R2I6_BCL2-02      ------------------------------------------------at
A0A2K5HK49_BCL2-01      ------------------------------------------------at
A0A2K6KHG1_BCL2-01      ------------------------------------------------at
A0A2K6R2I6_BCL2-01      ------------------------------------------------at
A0A2K5XRD4_BCL2-01      ------------------------------------------------at
A0A2K5NZS5_BCL2-01      ------------------------------------------------at
A0A0D9S017_BCL2-01      ------------------------------------------------at
A0A2K5UDI5_BCL2-01      ------------------------------------------------at
A0A2K6CIX3_BCL2-01      ------------------------------------------------at
A0A096MPU7_BCL2-01      ------------------------------------------------at
H2NWH5_BCL2-01          ------------------------------------------------at
G3QES9_BCL2-01          ------------------------------------------------at
A0A2I3GZF9_BCL2-01      ------------------------------------------------at
A9QXG9_BCL2-01          ------------------------------------------------at
A0A2R9APW6_BCL2-01      ------------------------------------------------at
H2QEM8_BCL2-01          ------------------------------------------------at
U3KEW4_BCL2-01          ------------------------------------------------at
H0YUX3_BCL2-01          ------------------------------------------------at
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ------------------------------------------------at
Q00709_BCL2-02          ------------------------------------------------at
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          g-------------------------------------------------
Q564A4_BCL2-01          g-------------------------------------------------
A0A1X9JZA1_BCL2-01      g-------------------------------------------------
B9ZYL7_BCL2-01          g-------------------------------------------------
F7BXJ7_BCL2-01          g-------------------------------------------------
A0A287APJ6_BCL2-01      gctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctaca
A0A0U3DHY6_BCL2-01      g-------------------------------------------------
H9GPE7_BCL2-01          g-------------------------------------------------
W5N4F7_BCL2-01          g-------------------------------------------------
F6YNL8_BCL2-01          g-------------------------------------------------
G3WZW9_BCL2-01          g-------------------------------------------------
G3WZW9_BCL2-02          g-------------------------------------------------
K7F5Y4_BCL2-02          g-------------------------------------------------
K7F5Y4_BCL2-01          g-------------------------------------------------
K7F5Y4_BCL2-03          g-------------------------------------------------
H0W1T3_BCL2-01          g-------------------------------------------------
F1LNV0_BCL2-01          g-------------------------------------------------
P49950_BCL2-01          g-------------------------------------------------
P10417_BCL2-02          g-------------------------------------------------
P10417_BCL2-01          g-------------------------------------------------
Q7TSN8_BCL2-01          g-------------------------------------------------
Q6R755_BCL2-01          g-------------------------------------------------
Q9JJV8_BCL2-01          g-------------------------------------------------
Q923R6_BCL2-01          g-------------------------------------------------
G3ULB7_BCL2-01          g-------------------------------------------------
G3ULB7_BCL2-02          g-------------------------------------------------
F6R2C4_BCL2-01          g-------------------------------------------------
O02718_BCL2-01          g-------------------------------------------------
A0A076FU27_BCL2-01      g-------------------------------------------------
A0A076FZV9_BCL2-01      g-------------------------------------------------
G1TW27_BCL2-01          g-------------------------------------------------
I3MVK9_BCL2-01          g-------------------------------------------------
M3YYK3_BCL2-01          g-------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          g-------------------------------------------------
A0A287APJ6_BCL2-03      g-------------------------------------------------
G1LID1_BCL2-02          g-------------------------------------------------
M3X1R9_BCL2-01          g-------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          g-------------------------------------------------
Q75SV7_BCL2-01          g-------------------------------------------------
H0WKI0_BCL2-01          g-------------------------------------------------
A0A2K6G3I7_BCL2-01      g-------------------------------------------------
A0A1D5QRF2_BCL2-01      g-------------------------------------------------
A0A2K5EB04_BCL2-01      g-------------------------------------------------
A0A2K6UEL3_BCL2-01      g-------------------------------------------------
A0A2R8MY14_BCL2-01      g-------------------------------------------------
A0A2K6R2I6_BCL2-02      g-------------------------------------------------
A0A2K5HK49_BCL2-01      g-------------------------------------------------
A0A2K6KHG1_BCL2-01      g-------------------------------------------------
A0A2K6R2I6_BCL2-01      g-------------------------------------------------
A0A2K5XRD4_BCL2-01      g-------------------------------------------------
A0A2K5NZS5_BCL2-01      g-------------------------------------------------
A0A0D9S017_BCL2-01      g-------------------------------------------------
A0A2K5UDI5_BCL2-01      g-------------------------------------------------
A0A2K6CIX3_BCL2-01      g-------------------------------------------------
A0A096MPU7_BCL2-01      g-------------------------------------------------
H2NWH5_BCL2-01          g-------------------------------------------------
G3QES9_BCL2-01          g-------------------------------------------------
A0A2I3GZF9_BCL2-01      g-------------------------------------------------
A9QXG9_BCL2-01          g-------------------------------------------------
A0A2R9APW6_BCL2-01      g-------------------------------------------------
H2QEM8_BCL2-01          g-------------------------------------------------
U3KEW4_BCL2-01          g-------------------------------------------------
H0YUX3_BCL2-01          g-------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          g-------------------------------------------------
Q00709_BCL2-02          g-------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          ----------gccaa---------------------------cgaaattc
Q564A4_BCL2-01          ----------gctaa---------------------------cgaaatta
A0A1X9JZA1_BCL2-01      ----------gcgaa-----------------------------------
B9ZYL7_BCL2-01          ----------gctca---------------------tcctagaagaggag
F7BXJ7_BCL2-01          ----------gctca---------------------tcctaggagaggag
A0A287APJ6_BCL2-01      tggtgtctccgctcatcagccccaagcccctcgccctgcccggagctcat
A0A0U3DHY6_BCL2-01      ----------gcaaa---------------------c-----gagaatc-
H9GPE7_BCL2-01          ----------gctca---------------------tcctgggataagag
W5N4F7_BCL2-01          ----------gcaaa---------------------taacg---aagccc
F6YNL8_BCL2-01          ----------gctca---------------------ccctggaagaagag
G3WZW9_BCL2-01          ----------gctca---------------------ccctggaagaagag
G3WZW9_BCL2-02          ----------gctca---------------------ccctggaagaagag
K7F5Y4_BCL2-02          ----------gctca---------------------tcctgggagaagag
K7F5Y4_BCL2-01          ----------gctca---------------------tcctgggagaagag
K7F5Y4_BCL2-03          ----------gctca---------------------tcctgggagaagag
H0W1T3_BCL2-01          ----------gctca---------------------cgctgggagaacag
F1LNV0_BCL2-01          ----------gcgca---------------------agccgggagaacag
P49950_BCL2-01          ----------gcgca---------------------agccgggagaacag
P10417_BCL2-02          ----------gcgca---------------------agccgggagaacag
P10417_BCL2-01          ----------gcgca---------------------agccgggagaacag
Q7TSN8_BCL2-01          ----------gcgca---------------------agccgggagaacag
Q6R755_BCL2-01          ----------gcgca---------------------agccgggagaacag
Q9JJV8_BCL2-01          ----------gctca---------------------agctgggagaacag
Q923R6_BCL2-01          ----------gctca---------------------agctgggagaacag
G3ULB7_BCL2-01          ----------gcgca---------------------cgcagggagaacag
G3ULB7_BCL2-02          ----------gcgca---------------------cgcagggagaacag
F6R2C4_BCL2-01          ----------gcgca---------------------cgcggggggaacag
O02718_BCL2-01          ----------gcgca---------------------cgcggggggaacag
A0A076FU27_BCL2-01      ----------gcgca---------------------cgcggggggcacag
A0A076FZV9_BCL2-01      ----------gcgca---------------------cgcggggggcacag
G1TW27_BCL2-01          ----------gcgca---------------------cgccgggcgaacag
I3MVK9_BCL2-01          ----------gctca---------------------cgctgggagaacag
M3YYK3_BCL2-01          ----------gcgca---------------------cgctgggagaacag
G1LID1_BCL2-01          ----------cccca---------------------ccccg------cag
F7CDX6_BCL2-01          ----------gcgca---------------------cgctgggagaacag
A0A287APJ6_BCL2-03      ----------gcgca---------------------cgctgggagaacag
G1LID1_BCL2-02          ----------gcgca---------------------cgctgggagaacag
M3X1R9_BCL2-01          ----------gcgca---------------------cgctgggagaacag
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          ----------gcgca---------------------cgctgggcgaacag
Q75SV7_BCL2-01          ----------gcgca---------------------cgctgggcgaacag
H0WKI0_BCL2-01          ----------gcgca---------------------cgctgggagaacag
A0A2K6G3I7_BCL2-01      ----------gcgca---------------------cgccgggagaacag
A0A1D5QRF2_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K5EB04_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K6UEL3_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2R8MY14_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K6R2I6_BCL2-02      ----------gcgca---------------------cgctgggagaacag
A0A2K5HK49_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K6KHG1_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K6R2I6_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K5XRD4_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K5NZS5_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A0D9S017_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K5UDI5_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A2K6CIX3_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A0A096MPU7_BCL2-01      ----------gcgca---------------------cgctgggagaacag
H2NWH5_BCL2-01          ----------gcgca---------------------cgctgggacaacag
G3QES9_BCL2-01          ----------gcgca---------------------cgctgggagaacag
A0A2I3GZF9_BCL2-01      ----------gcgca---------------------cgctgggagaacag
A9QXG9_BCL2-01          ----------gcgca---------------------cgctgggagaacgg
A0A2R9APW6_BCL2-01      ----------gcgca---------------------cgctgggagaacag
H2QEM8_BCL2-01          ----------gcgca---------------------cgctgggagaacag
U3KEW4_BCL2-01          ----------gctca---------------------tccggggagaagag
H0YUX3_BCL2-01          ----------gctca---------------------tccggggagaagag
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ----------gctca---------------------ccccgggagaagag
Q00709_BCL2-02          ----------gctca---------------------ccccgggagaagag
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          gctatgacaatcggaat----------attgt-ggagaaatacct--caa
Q564A4_BCL2-01          gctatgacaatcggaat----------attgt-ggagaaatacct--caa
A0A1X9JZA1_BCL2-01      -cgagtgtaatcgcaac----------attgt-ggaaaagtatat--ctg
B9ZYL7_BCL2-01          gctatgatcaccgggac----------atagt-ggtaaaatatat--cca
F7BXJ7_BCL2-01          gctatgatcaccgggac----------atagt-ggtaaaatatat--cca
A0A287APJ6_BCL2-01      gtggtggttactggaggctccagcggcatcgg----aaagtgcattgcca
A0A0U3DHY6_BCL2-01      cttatgacagtcgcttt----------attgt-cgaaaaatacat--cca
H9GPE7_BCL2-01          gttacgacaacagggaa----------atcgt-gctgaggtacat--cca
W5N4F7_BCL2-01          cgtacgatactcggaat----------atcgt-gacaaaatacat--cca
F6YNL8_BCL2-01          gatatgataaccgggag----------atagt-gatgaaatacat--tca
G3WZW9_BCL2-01          gatatgataaccgggaa----------atagt-gatgaaatacat--tca
G3WZW9_BCL2-02          gatatgataaccgggaa----------atagt-gatgaaatacat--tca
K7F5Y4_BCL2-02          gctatgataaccgggag----------atagt-gttgaagtacat--cca
K7F5Y4_BCL2-01          gctatgataaccgggag----------atagt-gttgaagtacat--cca
K7F5Y4_BCL2-03          gctatgataaccgggag----------atagt-gttgaagtacat--cca
H0W1T3_BCL2-01          ggtatgataaccgggaa----------atagt-gatgaagtacat--cca
F1LNV0_BCL2-01          ggtatgataaccgggag----------atcgt-gatgaagtacat--cca
P49950_BCL2-01          ggtatgataaccgggag----------atcgt-gatgaagtacat--cca
P10417_BCL2-02          ggtatgataaccgggag----------atcgt-gatgaagtacat--aca
P10417_BCL2-01          ggtatgataaccgggag----------atcgt-gatgaagtacat--aca
Q7TSN8_BCL2-01          ggtatgataaccgggag----------atcgt-gatgaagtacat--aca
Q6R755_BCL2-01          ggtatgataaccgggag----------atcgt-gatgaagtacat--aca
Q9JJV8_BCL2-01          ggtatgataaccgagag----------atcgt-gatgaagtacat--cca
Q923R6_BCL2-01          ggtatgataaccgagag----------atcgt-gatgaagtacat--cca
G3ULB7_BCL2-01          gttatgacaaccgggag----------atagt-gatgaagtatat--cca
G3ULB7_BCL2-02          gttatgacaaccgggag----------atagt-gatgaagtatat--cca
F6R2C4_BCL2-01          gctacgataaccgagag----------atcgt-gatgaagtacat--cca
O02718_BCL2-01          gctacgataaccgagag----------atcgt-gatgaagtacat--cca
A0A076FU27_BCL2-01      gctacgataaccgcgag----------atcgt-gatgaagtacat--cca
A0A076FZV9_BCL2-01      gctacgataaccgcgag----------atcgt-gatgaagtacat--cca
G1TW27_BCL2-01          ggtacgacaaccgggag----------atcgt-gatgaagtacat--cca
I3MVK9_BCL2-01          ggtatgataaccgggag----------atagt-gatgaagtacat--cca
M3YYK3_BCL2-01          ggtatgataaccgggag----------atagt-gatgaagtacat--cca
G1LID1_BCL2-01          cgt---------------------------------------------cc
F7CDX6_BCL2-01          ggtatgataaccgggag----------atagt-gatgaagtacat--cca
A0A287APJ6_BCL2-03      ggtatgataaccgggaa----------atagt-gatgaagtacat--cca
G1LID1_BCL2-02          ggtatgataaccgggag----------atagt-gatgaagtacat--cca
M3X1R9_BCL2-01          ggtatgataaccgggag----------atagt-catgaagtacat--cca
J9NXG3_BCL2-01          ----------------------------------atgaagtacat--cca
J9NXG3_BCL2-02          ggtacgataaccgggag----------atagt-gatgaagtacat--cca
Q75SV7_BCL2-01          ggtacgataaccgggag----------atagt-gatgaagtacat--cca
H0WKI0_BCL2-01          ggtatgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K6G3I7_BCL2-01      ggtatgataaccgggag----------atagt-gatgaagtacat--cca
A0A1D5QRF2_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K5EB04_BCL2-01      ggtacgataaccgagag----------atagt-gatgaagtacat--cca
A0A2K6UEL3_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2R8MY14_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K6R2I6_BCL2-02      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K5HK49_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K6KHG1_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K6R2I6_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K5XRD4_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K5NZS5_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A0D9S017_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K5UDI5_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2K6CIX3_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A096MPU7_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
H2NWH5_BCL2-01          ggtacgataaccgggag----------atagtcgatgaaa-ncat--cca
G3QES9_BCL2-01          ggtacgataaccgagag----------atagt-gatgaagtacat--cca
A0A2I3GZF9_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A9QXG9_BCL2-01          ggtacgataaccgggag----------atagt-gatgaagtacat--cca
A0A2R9APW6_BCL2-01      ggtacgataaccgggag----------atagt-gatgaagtacat--cca
H2QEM8_BCL2-01          ggtacgataaccgggag----------atagt-gatgaagtacat--cca
U3KEW4_BCL2-01          gctacgataaccgggag----------atagt-gctgaagtacat--cca
H0YUX3_BCL2-01          gctacgataaccgggag----------atagt-gctgaagtacat--cca
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          gctacgacaaccgcgag----------atagt-gctgaagtacat--cca
Q00709_BCL2-02          gctacgacaaccgcgag----------atagt-gctgaagtacat--cca
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          tc------------------------------------------------
Q564A4_BCL2-01          gc------------------------------------------------
A0A1X9JZA1_BCL2-01      cc------------------------------------------------
B9ZYL7_BCL2-01          tt------------------------------------------------
F7BXJ7_BCL2-01          tt------------------------------------------------
A0A287APJ6_BCL2-01      ttgagtgctataaacaaggagcgtttataactctggttgcacgaaatgag
A0A0U3DHY6_BCL2-01      ta------------------------------------------------
H9GPE7_BCL2-01          tt------------------------------------------------
W5N4F7_BCL2-01          tc------------------------------------------------
F6YNL8_BCL2-01          tt------------------------------------------------
G3WZW9_BCL2-01          tt------------------------------------------------
G3WZW9_BCL2-02          tt------------------------------------------------
K7F5Y4_BCL2-02          tt------------------------------------------------
K7F5Y4_BCL2-01          tt------------------------------------------------
K7F5Y4_BCL2-03          tt------------------------------------------------
H0W1T3_BCL2-01          ct------------------------------------------------
F1LNV0_BCL2-01          tt------------------------------------------------
P49950_BCL2-01          tt------------------------------------------------
P10417_BCL2-02          tt------------------------------------------------
P10417_BCL2-01          tt------------------------------------------------
Q7TSN8_BCL2-01          tt------------------------------------------------
Q6R755_BCL2-01          tt------------------------------------------------
Q9JJV8_BCL2-01          tt------------------------------------------------
Q923R6_BCL2-01          tt------------------------------------------------
G3ULB7_BCL2-01          ct------------------------------------------------
G3ULB7_BCL2-02          ct------------------------------------------------
F6R2C4_BCL2-01          ct------------------------------------------------
O02718_BCL2-01          ct------------------------------------------------
A0A076FU27_BCL2-01      ct------------------------------------------------
A0A076FZV9_BCL2-01      ct------------------------------------------------
G1TW27_BCL2-01          ct------------------------------------------------
I3MVK9_BCL2-01          ct------------------------------------------------
M3YYK3_BCL2-01          ct------------------------------------------------
G1LID1_BCL2-01          cc------------------------------------------------
F7CDX6_BCL2-01          ct------------------------------------------------
A0A287APJ6_BCL2-03      ct------------------------------------------------
G1LID1_BCL2-02          ct------------------------------------------------
M3X1R9_BCL2-01          ct------------------------------------------------
J9NXG3_BCL2-01          ct------------------------------------------------
J9NXG3_BCL2-02          ct------------------------------------------------
Q75SV7_BCL2-01          ct------------------------------------------------
H0WKI0_BCL2-01          ct------------------------------------------------
A0A2K6G3I7_BCL2-01      tt------------------------------------------------
A0A1D5QRF2_BCL2-01      ct------------------------------------------------
A0A2K5EB04_BCL2-01      ct------------------------------------------------
A0A2K6UEL3_BCL2-01      ct------------------------------------------------
A0A2R8MY14_BCL2-01      ct------------------------------------------------
A0A2K6R2I6_BCL2-02      ct------------------------------------------------
A0A2K5HK49_BCL2-01      ct------------------------------------------------
A0A2K6KHG1_BCL2-01      ct------------------------------------------------
A0A2K6R2I6_BCL2-01      ct------------------------------------------------
A0A2K5XRD4_BCL2-01      ct------------------------------------------------
A0A2K5NZS5_BCL2-01      ct------------------------------------------------
A0A0D9S017_BCL2-01      ct------------------------------------------------
A0A2K5UDI5_BCL2-01      ct------------------------------------------------
A0A2K6CIX3_BCL2-01      ct------------------------------------------------
A0A096MPU7_BCL2-01      ct------------------------------------------------
H2NWH5_BCL2-01          tt------------------------------------------------
G3QES9_BCL2-01          tt------------------------------------------------
A0A2I3GZF9_BCL2-01      tt------------------------------------------------
A9QXG9_BCL2-01          tt------------------------------------------------
A0A2R9APW6_BCL2-01      tt------------------------------------------------
H2QEM8_BCL2-01          tt------------------------------------------------
U3KEW4_BCL2-01          ct------------------------------------------------
H0YUX3_BCL2-01          ct------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ct------------------------------------------------
Q00709_BCL2-02          ct------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          -acaaactttcaaagaaggg--------------------atatgagtgg
Q564A4_BCL2-01          -ataaactttcaaagcgagg--------------------atatgtgtgg
A0A1X9JZA1_BCL2-01      -ataaactctccaaacaggg--------------------ctacgagtgg
B9ZYL7_BCL2-01          -ataaactatctcagaaggg--------------------gtatgcatgg
F7BXJ7_BCL2-01          -ataaactgtctcaaaaggg--------------------gtatgaatgg
A0A287APJ6_BCL2-01      gacaagctgttgcaggcaaagaaagaaattgaaaaacactctattaatga
A0A0U3DHY6_BCL2-01      -acaaactgttgaagaaggg--------------------atttgtatgg
H9GPE7_BCL2-01          -acaagctgtcgcagaaagg--------------------atatgactgg
W5N4F7_BCL2-01          -acaaactcctgaagaaggg--------------------ctacgtgtgg
F6YNL8_BCL2-01          -ataaactgtcacagagggg--------------------gtacgagtgg
G3WZW9_BCL2-01          -ataagctatcacagagagg--------------------gtacgagtgg
G3WZW9_BCL2-02          -ataagctatcacagagagg--------------------gtacga----
K7F5Y4_BCL2-02          -acaaactgtcacagagggg--------------------gtatgattgg
K7F5Y4_BCL2-01          -acaaactgtcacagagggg--------------------gtatgattgg
K7F5Y4_BCL2-03          -acaaactgtcacagagggg--------------------gtatgattgg
H0W1T3_BCL2-01          -ataagctgtcccagagagg--------------------ctacgagtgg
F1LNV0_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
P49950_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
P10417_BCL2-02          -ataagctgtcacagagggg--------------------ctacgagtgg
P10417_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
Q7TSN8_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
Q6R755_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
Q9JJV8_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
Q923R6_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
G3ULB7_BCL2-01          -ataagctgtcgcagcgggg--------------------ctacgaatgg
G3ULB7_BCL2-02          -ataagctgtcgcagcgggg--------------------ctacgaatgg
F6R2C4_BCL2-01          -ataagctgtcgcagcgggg--------------------ctacgagtgg
O02718_BCL2-01          -ataagctgtcgcagcgggg--------------------ctacgagtgg
A0A076FU27_BCL2-01      -acaagctgtcgcagcgcgg--------------------ctacgagtgg
A0A076FZV9_BCL2-01      -acaagctgtcgcagcgcgg--------------------ctacgagtgg
G1TW27_BCL2-01          -ataagctgtcccagagggg--------------------ctacgagtgg
I3MVK9_BCL2-01          -ataagctgtcacagagggg--------------------ctacgagtgg
M3YYK3_BCL2-01          -ataagctgtcgcagagggg------------------------------
G1LID1_BCL2-01          -ccggcccttcgt-gaggcg--------------------ctg-------
F7CDX6_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A287APJ6_BCL2-03      -ataagctgtcgcagagggg--------------------ctacgagtgg
G1LID1_BCL2-02          -ataagctgtcgcagagggg--------------------ctacgagtgg
M3X1R9_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
J9NXG3_BCL2-01          -acaagctgtcgcagagggg--------------------ctacgagtgg
J9NXG3_BCL2-02          -acaagctgtcgcagagggg--------------------ctacgagtgg
Q75SV7_BCL2-01          -acaagctgtcgcagagggg--------------------ctacgagtgg
H0WKI0_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6G3I7_BCL2-01      -ataagctggcgcagagggg--------------------ctacgagtgg
A0A1D5QRF2_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K5EB04_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6UEL3_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2R8MY14_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6R2I6_BCL2-02      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K5HK49_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6KHG1_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6R2I6_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K5XRD4_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K5NZS5_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A0D9S017_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K5UDI5_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2K6CIX3_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A096MPU7_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
H2NWH5_BCL2-01          -ataagttgtcgcagagggg--------------------ctacgagtgg
G3QES9_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2I3GZF9_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
A9QXG9_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
A0A2R9APW6_BCL2-01      -ataagctgtcgcagagggg--------------------ctacgagtgg
H2QEM8_BCL2-01          -ataagctgtcgcagagggg--------------------ctacgagtgg
U3KEW4_BCL2-01          -ataaactctcgcagagggg--------------------atacgactgg
H0YUX3_BCL2-01          -ataaactctctcagagggg--------------------atacgactgg
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          -ataaactctcgcagcgggg--------------------ctacgactgg
Q00709_BCL2-02          -ataaactctcgcagcgggg--------------------ctacgactgg
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          aaatttcaatcttccggggaggatgatg--------acactatcaatacg
Q564A4_BCL2-01          aaatgtcagtcctctgctgaggaagatg--------acaccttcaataaa
A0A1X9JZA1_BCL2-01      gg---------gtttgacgctgtccgga--atgcagatgccggtaataat
B9ZYL7_BCL2-01          ga---------agagggaaggcagcagg--------tctctgc---tgag
F7BXJ7_BCL2-01          ga---------agaggggcggcagcagg--------tctctgc---tgag
A0A287APJ6_BCL2-01      ta---------aacaggtggtgctttgt--------atatcag-ttgatg
A0A0U3DHY6_BCL2-01      ga---------atttcaagcagaaaacg--------attctccaaataat
H9GPE7_BCL2-01          gt---------tgccagtggagacagaggaaagtcagcatctc------t
W5N4F7_BCL2-01          ga---------atcccgcgtgtccggcg--------agaccga------t
F6YNL8_BCL2-01          ga---------tgctggagatctgag-g--------gcaccag------c
G3WZW9_BCL2-01          ga---------tgctggaaatctgag-g--------acaccag------c
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          gc---------tgccaatgaaaacag-a--------ggaccag------t
K7F5Y4_BCL2-01          gc---------tgccaatgaaaacag-a--------ggaccag------t
K7F5Y4_BCL2-03          gc---------tgccaatgaaaacag-a--------ggaccag------t
H0W1T3_BCL2-01          ga---------tgccggagacg--gg-a--------gcgc----------
F1LNV0_BCL2-01          ga---------tactggagatg--aa-g--------actccgc------g
P49950_BCL2-01          ga---------tactggagatg--aa-g--------actccgc------g
P10417_BCL2-02          ga---------tgctggagatg--cg-g--------acgcggc------g
P10417_BCL2-01          ga---------tgctggagatg--cg-g--------acgcggc------g
Q7TSN8_BCL2-01          ga---------tgctggagatg--cg-g--------acgcggc------g
Q6R755_BCL2-01          ga---------tgtgggagatg--tg-g--------acgccgc------g
Q9JJV8_BCL2-01          ga---------tgtgggagatg--tg-g--------acgccgc------g
Q923R6_BCL2-01          ga---------tgtgggagatg--tg-g--------acgccgc------g
G3ULB7_BCL2-01          ga---------ggctggcgaag--ct-a--------gcgccgc------g
G3ULB7_BCL2-02          ga---------ggctggcgaag--ct------------------------
F6R2C4_BCL2-01          ga---------tgccggagacg--cg-g--------gcgccgc------g
O02718_BCL2-01          ga---------tgccggagacg--cg-g--------gcgccgc------g
A0A076FU27_BCL2-01      ga---------tgccagagccg--cg-g--------gcgccgc------g
A0A076FZV9_BCL2-01      ga---------tgccggagccg--cg-g--------gcgccgc------g
G1TW27_BCL2-01          ga---------cgctggggacg--cg-g--------gc------------
I3MVK9_BCL2-01          ga---------tgctggagacg--tg-g--------gcgctgc------g
M3YYK3_BCL2-01          aa---------gaccagtgatg-----a--------aactcgt------g
G1LID1_BCL2-01          ------------gcaggtggcg--c-------------------------
F7CDX6_BCL2-01          ga---------tgccggagacg--cg-g--------gcgccgc------g
A0A287APJ6_BCL2-03      ga---------tgccggagacg--cg-g--------gcgccgc------g
G1LID1_BCL2-02          ga---------tgccggagacg--cg------------------------
M3X1R9_BCL2-01          ga---------tgccggggacg--cg-g--------gcgccgc------g
J9NXG3_BCL2-01          ga---------cgcgggagagg--cg-g--------gcgccgc------g
J9NXG3_BCL2-02          ga---------cgcgggagagg--cg-g--------gcgccgc------g
Q75SV7_BCL2-01          ga---------cgcgggagagg--cg-g--------gcgccgc------g
H0WKI0_BCL2-01          ga---------tgctggagacg--tg-g--------gcgttgc------a
A0A2K6G3I7_BCL2-01      ga---------tgccggagacg--cg-g--------gcgctgc------g
A0A1D5QRF2_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgcggc------g
A0A2K5EB04_BCL2-01      ga---------tgccggagatg--tg-g--------gcgccgc------a
A0A2K6UEL3_BCL2-01      ga---------tgccggagatg--tg-g--------gcgccgc------g
A0A2R8MY14_BCL2-01      ga---------tgccggagatg--tg-g--------gcgccgc------g
A0A2K6R2I6_BCL2-02      ga---------tgcgggagatg--tg-g--------gcgccgc------g
A0A2K5HK49_BCL2-01      ga---------tgcgggggatg--tg-g--------gagccgc------g
A0A2K6KHG1_BCL2-01      ga---------tgcgggagatg--tg-g--------gcgccgc------g
A0A2K6R2I6_BCL2-01      ga---------tgcgggagatg--tg-g--------gcgccgc------g
A0A2K5XRD4_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgcggc------g
A0A2K5NZS5_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgcggc------g
A0A0D9S017_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgccgc------g
A0A2K5UDI5_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgcggc------g
A0A2K6CIX3_BCL2-01      ga---------tgcgggggatg--tg-g--------gcgcggc------g
A0A096MPU7_BCL2-01      ga---------tgcgggggat------g--------gcgcggc------g
H2NWH5_BCL2-01          ga---------tgcgggagatg--tg-g--------gcgccgc------g
G3QES9_BCL2-01          ga---------tgcgggagatg--tg-g--------gcgccgt------g
A0A2I3GZF9_BCL2-01      ga---------tgcgggagatg--tg-g--------gcgccgc------g
A9QXG9_BCL2-01          ga---------tgcgggagatg--tg-g--------gcgccgc------g
A0A2R9APW6_BCL2-01      ga---------tgcgggagatg--tg-g--------gcgccgc------g
H2QEM8_BCL2-01          ga---------tgcgggagatg--tg-g--------gcgccgc------g
U3KEW4_BCL2-01          gc---------tgccggcgagcacag-g--------gcacccc------t
H0YUX3_BCL2-01          gc---------tgccggcgaggacag-g--------gcatccc------t
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          gc---------cgccggcgaggacag-g--------ccgcccg------t
Q00709_BCL2-02          gc---------cgccggcgaggacag-g--------ccgcccg------t
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          ggagtggaggactcctctccgagctc------------------------
Q564A4_BCL2-01          gcagtggaggaatcctctccaaactc------------------------
A0A1X9JZA1_BCL2-01      gggtcaatagttgccc----------------------------------
B9ZYL7_BCL2-01          caccctcaagcttctg----------------------------------
F7BXJ7_BCL2-01          caccctcaagcttctg----------------------------------
A0A287APJ6_BCL2-01      tgtctcaagactatag----------------------------------
A0A0U3DHY6_BCL2-01      ttatttggggacccct----------------------------------
H9GPE7_BCL2-01          ttccccagagcttctc----------------------------------
W5N4F7_BCL2-01          ccccccaataacggat----------------------------------
F6YNL8_BCL2-01          ctctccaagtcttcctcctgttgttgcttctgccc---------------
G3WZW9_BCL2-01          ctctccaagtcttcctcctgttgttgcttctgccc---------------
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          ttcttcaagtctctctcctc------------------------------
K7F5Y4_BCL2-01          ttcttcaagtctctctcctc------------------------------
K7F5Y4_BCL2-03          ttcttcaagtctctctcctc------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          cccctgagggctgccc----------------------------------
P49950_BCL2-01          cccctgagggctgccc----------------------------------
P10417_BCL2-02          cccctgggggctgccc----------------------------------
P10417_BCL2-01          cccctgggggctgccc----------------------------------
Q7TSN8_BCL2-01          cccctgggggctgccc----------------------------------
Q6R755_BCL2-01          cccctgggcgccgccc----------------------------------
Q9JJV8_BCL2-01          cccctgggcgccgccc----------------------------------
Q923R6_BCL2-01          cccctgggcgccgccc----------------------------------
G3ULB7_BCL2-01          ccccccggggccgctc----------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
F6R2C4_BCL2-01          ccccccggggccgctc----------------------------------
O02718_BCL2-01          ccccccggggccgctc----------------------------------
A0A076FU27_BCL2-01      ccccccggggccgccc----------------------------------
A0A076FZV9_BCL2-01      ccccccggggccgctc----------------------------------
G1TW27_BCL2-01          ---------gccgcct----------------------------------
I3MVK9_BCL2-01          tccccaggagccgccc----------------------------------
M3YYK3_BCL2-01          tacttacccaccgccc----------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          cccctgggggccaccc----------------------------------
A0A287APJ6_BCL2-03      tccccgggggccgctc----------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          cccccgggggccgccc----------------------------------
J9NXG3_BCL2-01          cccccgggggccgccc----------------------------------
J9NXG3_BCL2-02          cccccgggggccgccc----------------------------------
Q75SV7_BCL2-01          cccccgggggccgccc----------------------------------
H0WKI0_BCL2-01          ccccccggggccgcca----------------------------------
A0A2K6G3I7_BCL2-01      cccccgggggccgccc----------------------------------
A0A1D5QRF2_BCL2-01      acccctggggccgccc----------------------------------
A0A2K5EB04_BCL2-01      cccccaggggccgccc----------------------------------
A0A2K6UEL3_BCL2-01      cccccaggcgccgccc----------------------------------
A0A2R8MY14_BCL2-01      cccccaggggccgccc----------------------------------
A0A2K6R2I6_BCL2-02      acccctggggccgccc----------------------------------
A0A2K5HK49_BCL2-01      acccctggggccgccc----------------------------------
A0A2K6KHG1_BCL2-01      acccctggggccgccc----------------------------------
A0A2K6R2I6_BCL2-01      acccctggggccgccc----------------------------------
A0A2K5XRD4_BCL2-01      acccctggggtcgccc----------------------------------
A0A2K5NZS5_BCL2-01      acccctggggtcgccc----------------------------------
A0A0D9S017_BCL2-01      acccctggggccgccc----------------------------------
A0A2K5UDI5_BCL2-01      acccctggggccgccc----------------------------------
A0A2K6CIX3_BCL2-01      acccctggggccgccc----------------------------------
A0A096MPU7_BCL2-01      acccctggggccgccc----------------------------------
H2NWH5_BCL2-01          cccccgggggccgcca----------------------------------
G3QES9_BCL2-01          cccccgggggccgccc----------------------------------
A0A2I3GZF9_BCL2-01      cccccgggggccgccc----------------------------------
A9QXG9_BCL2-01          cccccgggggccgccc----------------------------------
A0A2R9APW6_BCL2-01      ccc-----------------------------------------------
H2QEM8_BCL2-01          cccccgggggccgccc----------------------------------
U3KEW4_BCL2-01          gcctccaggtctctctgctcctgctgctgctgcggttgc-----------
H0YUX3_BCL2-01          gcctccagatcactccgcttctgctgctgctgcgattgctgctgctgcga
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          gcccccggccccggctcccgctgctgctcccgctgcggt-----------
Q00709_BCL2-02          gcccccggccccggctcccgctgctgctcccgctgcggt-----------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          ---tgacaggaggctccaggctccctcagccggagggggaaacaactctg
Q564A4_BCL2-01          ---tgacaggaggcttcaggctccctcagccggcggagggaacaactctg
A0A1X9JZA1_BCL2-01      ---ctccaccgagtttggtccgccggtgccgtggagccagcaccgggccc
B9ZYL7_BCL2-01          ---ctgctattagtaattattctgatgatggagaaatgcctgctgcttcc
F7BXJ7_BCL2-01          ---ctgctattagtaattattctgatgatggagaaatgcctgctgcttcc
A0A287APJ6_BCL2-01      ---ccaagtagagaatgtcataaaacaagcacaggagaaa----------
A0A0U3DHY6_BCL2-01      ---ctacacccaacacccccgaagtttttgcacggaggtcccagcccacc
H9GPE7_BCL2-01          ------------aattctgatcctgtga----------------------
W5N4F7_BCL2-01          ------tggtgggcccctccgcctcgggtccgggg-------ctgcaggc
F6YNL8_BCL2-01          ---ctgctgttggaatcttctctacccagccacgaaacacaccattgcct
G3WZW9_BCL2-01          ---ctgctgttggaatcttctctaaccagccaagacatacacctctgcct
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          ---ctgctgctgggaccccatctgaccatgctgggctggtgtctttgccg
K7F5Y4_BCL2-01          ---ctgctgctgggaccccatctgaccatgctgggctggtgtctttgccg
K7F5Y4_BCL2-03          ---ctgctg-----------------------------------------
H0W1T3_BCL2-01          ----------------------------actgggtcgcaactccccgctt
F1LNV0_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaaccggacgccc
P49950_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaaccgaacgccc
P10417_BCL2-02          ---ccacccctggcatcttctccttccagcctgagagcaacccaatgccc
P10417_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaacccaatgccc
Q7TSN8_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaacccaatgccc
Q6R755_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaacccaacgccc
Q9JJV8_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaacccaacgccc
Q923R6_BCL2-01          ---ccacccctggcatcttctccttccagcctgagagcaacccaacgccc
G3ULB7_BCL2-01          ---ccgcgccgggcgtcctctcttctccgcc------------------c
G3ULB7_BCL2-02          --------------------------------------------------
F6R2C4_BCL2-01          ---ccgcgccgggcatcctgtcctcccagccgggccgcacacccgcgccc
O02718_BCL2-01          ---ccgcgccgggcatcctgtcctcccagccgggccgcacacccgccccc
A0A076FU27_BCL2-01      ---ccgcgccgggcatcctgtcctcccagccgggccgcacacccgcgccc
A0A076FZV9_BCL2-01      ---ccgcgccgggcatcctgtcctcccagccgggccgcacacccgcgccc
G1TW27_BCL2-01          ---ccgcgccgggcgtcttctcctcccagcccgcg------------ccc
I3MVK9_BCL2-01          ---ccgggccgggcatcttctcttcccaaccggggagc------------
M3YYK3_BCL2-01          ---cccccccaccccccctctcccgccaccgc-----------------c
G1LID1_BCL2-01          -------------------------------------------------c
F7CDX6_BCL2-01          ---ccgtgccgggcatcttctcctcccagcccgggcgcacccccgcgccc
A0A287APJ6_BCL2-03      ---ccgcaccgggcatcttctcctcccagcccgggcgaacccccgctccc
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          ---ccgcgccgggcatcttctcctcccagcccgggcgcacccctgcgccc
J9NXG3_BCL2-01          ---ccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnn
J9NXG3_BCL2-02          ---ccgcgccgggcatctccgcct--------------------------
Q75SV7_BCL2-01          ---ccgcgccgggcatcttctcctcgcagcccggccgcgcccccgcgccc
H0WKI0_BCL2-01          ---ctgcgccgggcgtcttctcctcccagcccgggcgcacccctactccc
A0A2K6G3I7_BCL2-01      ---ccacgccgggcatcttctcctcccagcccgggcgcaacccccctccc
A0A1D5QRF2_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K5EB04_BCL2-01      ---ccgcgccgggcatcttctcctcccagcctggacacacgcccggtccc
A0A2K6UEL3_BCL2-01      ---ccgcgccgggcatcttctcctcccagcccgggcacacgcccggtccc
A0A2R8MY14_BCL2-01      ---ccgcggagggcatcttctcttcccagcccgggcacacgcccggtccc
A0A2K6R2I6_BCL2-02      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K5HK49_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K6KHG1_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K6R2I6_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K5XRD4_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K5NZS5_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A0D9S017_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K5UDI5_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A2K6CIX3_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
A0A096MPU7_BCL2-01      ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatccc
H2NWH5_BCL2-01          ---ccgcacccggcatcttctcctcccagcccgggcacacgcctcatcca
G3QES9_BCL2-01          ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatcca
A0A2I3GZF9_BCL2-01      ---ccgcaccgggcatcttctcctcccagccggggcacacgccccatcca
A9QXG9_BCL2-01          ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatcca
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          ---ccgcaccgggcatcttctcctcccagcccgggcacacgccccatcca
U3KEW4_BCL2-01          -tgctgctgctgggacttcctctgatcacactgggccggtgtctccgcac
H0YUX3_BCL2-01          ttgctgctgctgggact---tctgatcacactgggctggtgtctccgcac
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          -ggctgctgctggagcctcctcccaccac------------------cgc
Q00709_BCL2-02          -ggctgctgctggagcctcctcccaccac------------------cg-
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          aatgc---------------------------------------------
Q564A4_BCL2-01          aatgc---------------------------------------------
A0A1X9JZA1_BCL2-01      gaca-----------------------------------gcgagagcatc
B9ZYL7_BCL2-01          gcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctc
F7BXJ7_BCL2-01          gcagattcacgtggaccacctcaatcttcactcgcatctgctgctgcttc
A0A287APJ6_BCL2-01      ---------ctgggcccagtggacatgcttgtaaactgtgcaggaatgtc
A0A0U3DHY6_BCL2-01      gccgcggtcgaggacac---------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
W5N4F7_BCL2-01          gcggcggctccaggct-----------------------gccggggccga
F6YNL8_BCL2-01          gctgaaccccaggactcggccacttctactactgctgctgctagaaactc
G3WZW9_BCL2-01          gctgcaccccaggacttggccacttctactactgctgctgctagaaactc
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          cctgaaccccctggttcggct------------------gctgcta----
K7F5Y4_BCL2-01          cctgaaccccctggttcggct------------------gctgcta----
K7F5Y4_BCL2-03          ----------ctggttcggct------------------gctgcta----
H0W1T3_BCL2-01          ggtgtgccccgggacccggcc------------------gccaggacctc
F1LNV0_BCL2-01          gctgtgcaccgagacacggct------------------gccaggacgtc
P49950_BCL2-01          gctgtgcaccgagacacggct------------------gccaggacgtc
P10417_BCL2-02          gctgtgcaccgggacatggct------------------gccaggacgtc
P10417_BCL2-01          gctgtgcaccgggacatggct------------------gccaggacgtc
Q7TSN8_BCL2-01          gctgtgcaccgggacatggct------------------gccaggacgtc
Q6R755_BCL2-01          gctgtgcaccgggacatggct------------------gccaggacatc
Q9JJV8_BCL2-01          gctgtgcaccgggacatggct------------------gccaggacatc
Q923R6_BCL2-01          gctgtgcaccgggacatggct------------------gccaggacatc
G3ULB7_BCL2-01          gcggcgccccggggcccggac------------------accaggacctc
G3ULB7_BCL2-02          ------------------gac------------------accaggacctc
F6R2C4_BCL2-01          t---------------------------------------ccaggacctc
O02718_BCL2-01          t---------------------------------------ccaggacctc
A0A076FU27_BCL2-01      t---------------------------------------ccaggacctc
A0A076FZV9_BCL2-01      t---------------------------------------ccaggacctc
G1TW27_BCL2-01          gctgcgccccgggacccggcc------------------gccaggacctc
I3MVK9_BCL2-01          ---------cataccccggcc------------------gccaggacctc
M3YYK3_BCL2-01          g---------------------------------------cccgcagctc
G1LID1_BCL2-01          g---------------------------------------ccaag-----
F7CDX6_BCL2-01          g---------------------------------------ccaggacctc
A0A287APJ6_BCL2-03      g---------------------------------------ccaggacctc
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          g---------------------------------------ccaggacctc
J9NXG3_BCL2-01          nnnnnnnnnnnnnnnnnnnnn------------------nnnnnnnnnnn
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          gccaggacctcgccgcccccg------------------ccccccgccgc
H0WKI0_BCL2-01          gctgcgccccgggacccggcc------------------gccaggacctc
A0A2K6G3I7_BCL2-01      gctgcgcctcgggacccggcc------------------gccaggacctc
A0A1D5QRF2_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K5EB04_BCL2-01      gccgcgccccgggacccggtc------------------tccaggacctc
A0A2K6UEL3_BCL2-01      gctgcgccccgggaccctgtc------------------gccaggaccnn
A0A2R8MY14_BCL2-01      gccgcgccccgggacccggtc------------------gccaggacctc
A0A2K6R2I6_BCL2-02      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K5HK49_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K6KHG1_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K6R2I6_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K5XRD4_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K5NZS5_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A0D9S017_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K5UDI5_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A2K6CIX3_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
A0A096MPU7_BCL2-01      gccgcgtcccgggacccggtc------------------gccaggacctc
H2NWH5_BCL2-01          gccgcatcccgggacccg---------------------gccaggacctc
G3QES9_BCL2-01          gccgcatcccgggaccgggtc------------------gccaggacctc
A0A2I3GZF9_BCL2-01      gctgcatcccgggacccggtc------------------gccaggacctc
A9QXG9_BCL2-01          gccgcatcccgggacccggtc------------------gccaggacctc
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          gccgcatcccgggacccggtc------------------gccaggacctc
U3KEW4_BCL2-01          cccgagccccccggctcggct------------------gctgctagccc
H0YUX3_BCL2-01          cccgagccccccggctcggct------------------actgctagcca
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          cccgagccccccggctcggct------------------gctgctagtga
Q00709_BCL2-02          cccgagccccccggctcggct------------------gctgctagtga
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      cc------------------------------------------------
B9ZYL7_BCL2-01          ag-atgaggaaaccccaagtaatactccaataacctttgtgggcaatgca
F7BXJ7_BCL2-01          ------------------------ctc-----------------------
A0A287APJ6_BCL2-01      actttcaggaaaatt----------------------tgaagatcttgaa
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
W5N4F7_BCL2-01          gcgcggagctgtccc-----------------------------------
F6YNL8_BCL2-01          ac-ctttgcctcttc------------------ctcctcctgctgttgct
G3WZW9_BCL2-01          ac-ctttgcctcctc------------------ctcctgctgttgctgct
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          gc-caccgccacccc------------------tggccggcc--------
F1LNV0_BCL2-01          gc-ctctacggcccc-----------------------------------
P49950_BCL2-01          gc-ctctacggcccc-----------------------------------
P10417_BCL2-02          tc-ctctcaggcccc-----------------------------------
P10417_BCL2-01          tc-ctctcaggcccc-----------------------------------
Q7TSN8_BCL2-01          tc-ctctcaggcccc-----------------------------------
Q6R755_BCL2-01          gc-cactaaggccca-----------------------------------
Q9JJV8_BCL2-01          gc-cactaaggccca-----------------------------------
Q923R6_BCL2-01          gc-cactaaggccca-----------------------------------
G3ULB7_BCL2-01          gc-cgctccagg--------------------------------------
G3ULB7_BCL2-02          gc-cgctccagg--------------------------------------
F6R2C4_BCL2-01          cc-cgccgccgcccc-----------------------------------
O02718_BCL2-01          cc-cgccgccgcccc-----------------------------------
A0A076FU27_BCL2-01      cc-cgccgccgcccc-----------------------------------
A0A076FZV9_BCL2-01      cc-cgccgccgcccc-----------------------------------
G1TW27_BCL2-01          gc-cgccg-------------------------ccgccgccg--------
I3MVK9_BCL2-01          gc-caccgccacccc------------------cggctgccc--------
M3YYK3_BCL2-01          ac-ctccccggccaccg----------------ccctcgccg--------
G1LID1_BCL2-01          -------------------------------------cgccg--------
F7CDX6_BCL2-01          cc-cgctgctacccc------------------cggccgccc--------
A0A287APJ6_BCL2-03      gc-cgccgccgaccccgaccgcccccgccgccaccgccgccg--------
G1LID1_BCL2-02          -----------------------------g---cccccgccg--------
M3X1R9_BCL2-01          cc-cgccgccgcccccggtcgcccccgccg---ccgccgccg--------
J9NXG3_BCL2-01          nn-nnnnnnnnnnnn------------------nnnnnnnnn--------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          cc-ccgctgccgccg------------------ccgccgccg--------
H0WKI0_BCL2-01          gc-ccccggccgccc------------------ccgccg-----------
A0A2K6G3I7_BCL2-01      gc-ccccgc-----------------------------------------
A0A1D5QRF2_BCL2-01      gc-cgctgccgaccc------------------cggctgccc---ccgcc
A0A2K5EB04_BCL2-01      gc-cgccgccgcccc------------------cggccgccc------cc
A0A2K6UEL3_BCL2-01      nn-nnnnnnnnnnnn------------------nnnnnnnnn--------
A0A2R8MY14_BCL2-01      gc-cgccgccgcccc------------------cagccgccc------cc
A0A2K6R2I6_BCL2-02      gc-cgctgccgaccc------------------cggctgccc--------
A0A2K5HK49_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A2K6KHG1_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A2K6R2I6_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A2K5XRD4_BCL2-01      gc-cactgccgaccc------------------cggctgccc--------
A0A2K5NZS5_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A0D9S017_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A2K5UDI5_BCL2-01      gc-cgctgccgaccc------------------cggctgcccccgccgcc
A0A2K6CIX3_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A0A096MPU7_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
H2NWH5_BCL2-01          gc-cgctgccgaccc------------------cggctgccc--------
G3QES9_BCL2-01          gc-cgctgcagaccc------------------cggctgccc--------
A0A2I3GZF9_BCL2-01      gc-cgctgccgaccc------------------cggctgccc--------
A9QXG9_BCL2-01          gc-cgctgcagaccc------------------cggctgccc--------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          gc-cgctgcagaccc------------------cggctgccc--------
U3KEW4_BCL2-01          c-------------------------------------------------
H0YUX3_BCL2-01          c-------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          g-------------------------------------------------
Q00709_BCL2-02          g-------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          -ctgatagcaaaccgggtcaca----------------------------
Q564A4_BCL2-01          -ctgatagc---ccgggtcact----------------------------
A0A1X9JZA1_BCL2-01      -ccacctctgcacacggctcc-----------------------------
B9ZYL7_BCL2-01          cctgctgttcccaggaggtctgcatctgctgtttcacccttagctgaatt
F7BXJ7_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-01      gttagtacttttgagaggctca----------------------------
A0A0U3DHY6_BCL2-01      -cgactctcctttccaaaacag----------------------------
H9GPE7_BCL2-01          -gtaccaatgcccccagggaag----------------------------
W5N4F7_BCL2-01          -ggtcccccgccggaccccccc----------------------------
F6YNL8_BCL2-01          gctgctgctgctgctggaccta----------------------------
G3WZW9_BCL2-01          gctactgttgctgctggaccag----------------------------
G3WZW9_BCL2-02          -----tgttgctgctggaccag----------------------------
K7F5Y4_BCL2-02          -gtaatgtgccccttggtgatg----------------------------
K7F5Y4_BCL2-01          -gtaatgtgccccttggtgatg----------------------------
K7F5Y4_BCL2-03          -gtaatgtgccccttggtgatg----------------------------
H0W1T3_BCL2-01          -tcgccgtcgcccaggggcctg----------------------------
F1LNV0_BCL2-01          -ttgtcgccaccgctgggcctg----------------------------
P49950_BCL2-01          -ttgtcgccaacgctgggcctg----------------------------
P10417_BCL2-02          -tcgttgccaccgctgggcctg----------------------------
P10417_BCL2-01          -tcgttgccaccgctgggcctg----------------------------
Q7TSN8_BCL2-01          -tcgttgccaccgctgggcctg----------------------------
Q6R755_BCL2-01          -tagtcgccaccactgggccta----------------------------
Q9JJV8_BCL2-01          -tagtcgccaccactgggccta----------------------------
Q923R6_BCL2-01          -tagtcgccaccactgggccta----------------------------
G3ULB7_BCL2-01          -ctgacccggccgcgcagccgg----------------------------
G3ULB7_BCL2-02          -ctgacccggccgcgcagccgg----------------------------
F6R2C4_BCL2-01          -cggccgccgccgccgggcctg----------------------------
O02718_BCL2-01          -cggccgccgccgccgggcctg----------------------------
A0A076FU27_BCL2-01      -cggccgccgccgccgggcctg----------------------------
A0A076FZV9_BCL2-01      -cggccgccgccgccgggcctg----------------------------
G1TW27_BCL2-01          ------gccgccgcggggcccg----------------------------
I3MVK9_BCL2-01          -ccgctgccgccgcggggcccg----------------------------
M3YYK3_BCL2-01          -ccgctgccgccgcgggccctg----------------------------
G1LID1_BCL2-01          -ccgccgccgccgcgggccctg----------------------------
F7CDX6_BCL2-01          -ccgccggcgccgcgggacctg----------------------------
A0A287APJ6_BCL2-03      -ccgccgccgccgcggggcctg----------------------------
G1LID1_BCL2-02          -ccgccgccgccgcgggccctg----------------------------
M3X1R9_BCL2-01          -ccgccgccgccgcgggccctg----------------------------
J9NXG3_BCL2-01          -nnn----------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          -ccgccgacgccgcgggccccg----------------------------
H0WKI0_BCL2-01          -ccgccgccgccgcggagcctc----------------------------
A0A2K6G3I7_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A1D5QRF2_BCL2-01      gccgccgccgccgcggggcctg----------------------------
A0A2K5EB04_BCL2-01      gccgccgccgccacggggcctg----------------------------
A0A2K6UEL3_BCL2-01      -nnnnnnnnnnnnnnnnnnnnn----------------------------
A0A2R8MY14_BCL2-01      gccgccgccgccacggggccta----------------------------
A0A2K6R2I6_BCL2-02      -ccgccgccgccgcggggcctg----------------------------
A0A2K5HK49_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A2K6KHG1_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A2K6R2I6_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A2K5XRD4_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A2K5NZS5_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A0D9S017_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A2K5UDI5_BCL2-01      gccgccgccgccgcggggcctg----------------------------
A0A2K6CIX3_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
A0A096MPU7_BCL2-01      -ccgccgccgccgcggggcctg----------------------------
H2NWH5_BCL2-01          -ctggcgccgccgtggggcctg----------------------------
G3QES9_BCL2-01          -ccggcgccgccgcggggcctg----------------------------
A0A2I3GZF9_BCL2-01      -ccggcgccgccgcggggcctg----------------------------
A9QXG9_BCL2-01          -ccggcgccgccgcggggcctg----------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          -ccggcgccgccgcggggcctg----------------------------
U3KEW4_BCL2-01          -gcgcccccggccgaggggctg----------------------------
H0YUX3_BCL2-01          -acgcccccagccgaggggctg----------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          -gtgcccccggctgaggggctg----------------------------
Q00709_BCL2-02          -gtgcccccggctgaggggctg----------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          gaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctg
F7BXJ7_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-01          --------------------------------------------------
G3WZW9_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          --------------------------------------------------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
P10417_BCL2-02          --------------------------------------------------
P10417_BCL2-01          --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-01          --------------------------------------------------
G3ULB7_BCL2-02          --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
G1TW27_BCL2-01          --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
G1LID1_BCL2-01          --------------------------------------------------
F7CDX6_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
G1LID1_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-01          --------------------------------------------------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
H2NWH5_BCL2-01          --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
U3KEW4_BCL2-01          --------------------------------------------------
H0YUX3_BCL2-01          --------------------------------------------------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          -----------------------------------------------cgt
Q564A4_BCL2-01          -----------------------------------------------cgt
A0A1X9JZA1_BCL2-01      ------------------------------------------cccagt--
B9ZYL7_BCL2-01          cagatggtgataataatgatgctgatggtggtgatgaagctgttatgcag
F7BXJ7_BCL2-01          -------------------------------------agcagctatgcag
A0A287APJ6_BCL2-01      -------------------------------------tgagtgtcaacta
A0A0U3DHY6_BCL2-01      -------------------------------------ga---gtccgcaa
H9GPE7_BCL2-01          -------------------------------------aa---cctgac--
W5N4F7_BCL2-01          -------------------------------------gc---ccgacc--
F6YNL8_BCL2-01          -------------------------------------cc---gtcagt--
G3WZW9_BCL2-01          -------------------------------------ct---gtcagt--
G3WZW9_BCL2-02          -------------------------------------ct---gtcagt--
K7F5Y4_BCL2-02          -------------------------------------gg---ctgcgc--
K7F5Y4_BCL2-01          -------------------------------------gg---ctgcgc--
K7F5Y4_BCL2-03          -------------------------------------gg---ctgcgc--
H0W1T3_BCL2-01          -------------------------------------cg---ctcagc--
F1LNV0_BCL2-01          -------------------------------------cg---ctcagc--
P49950_BCL2-01          -------------------------------------cg---ctcagc--
P10417_BCL2-02          -------------------------------------cg---ctcagc--
P10417_BCL2-01          -------------------------------------cg---ctcagc--
Q7TSN8_BCL2-01          -------------------------------------cg---ctcagc--
Q6R755_BCL2-01          -------------------------------------cc---cttagc--
Q9JJV8_BCL2-01          -------------------------------------cc---cttagc--
Q923R6_BCL2-01          -------------------------------------cc---cttagc--
G3ULB7_BCL2-01          -------------------------------------cg---ctcagc--
G3ULB7_BCL2-02          -------------------------------------cg---ctcagc--
F6R2C4_BCL2-01          -------------------------------------cg---cccagc--
O02718_BCL2-01          -------------------------------------cg---cccagc--
A0A076FU27_BCL2-01      -------------------------------------cg---cccagc--
A0A076FZV9_BCL2-01      -------------------------------------cg---cccagc--
G1TW27_BCL2-01          -------------------------------------cg---ctcagc--
I3MVK9_BCL2-01          -------------------------------------tg---ctcagc--
M3YYK3_BCL2-01          -------------------------------------cg---ctcagc--
G1LID1_BCL2-01          -------------------------------------cg---ctcagc--
F7CDX6_BCL2-01          -------------------------------------cc---ctcagc--
A0A287APJ6_BCL2-03      -------------------------------------ta---ctcagc--
G1LID1_BCL2-02          -------------------------------------cg---ctcagc--
M3X1R9_BCL2-01          -------------------------------------cg---ctcagc--
J9NXG3_BCL2-01          -------------------------------------nn---nncagc--
J9NXG3_BCL2-02          -------------------------------------cg---cncagc--
Q75SV7_BCL2-01          -------------------------------------cg---cccagc--
H0WKI0_BCL2-01          -------------------------------------tg---ctcagc--
A0A2K6G3I7_BCL2-01      -------------------------------------cg---cccagc--
A0A1D5QRF2_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K5EB04_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K6UEL3_BCL2-01      -------------------------------------nn---nncagc--
A0A2R8MY14_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K6R2I6_BCL2-02      -------------------------------------cg---ctcagc--
A0A2K5HK49_BCL2-01      -------------------------------------cg---cttagc--
A0A2K6KHG1_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K6R2I6_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K5XRD4_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K5NZS5_BCL2-01      -------------------------------------cg---ctcagc--
A0A0D9S017_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K5UDI5_BCL2-01      -------------------------------------cg---ctcagc--
A0A2K6CIX3_BCL2-01      -------------------------------------cg---ctcagc--
A0A096MPU7_BCL2-01      -------------------------------------cg---ctcagc--
H2NWH5_BCL2-01          -------------------------------------cg---ctcagc--
G3QES9_BCL2-01          -------------------------------------cg---ctcagc--
A0A2I3GZF9_BCL2-01      -------------------------------------cg---ctcagc--
A9QXG9_BCL2-01          -------------------------------------cg---ctcagc--
A0A2R9APW6_BCL2-01      ------------------------------------------ctcagc--
H2QEM8_BCL2-01          -------------------------------------cg---ctcagc--
U3KEW4_BCL2-01          -------------------------------------c--------gc--
H0YUX3_BCL2-01          -------------------------------------c--------gc--
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          -------------------------------------c--------gc--
Q00709_BCL2-02          -------------------------------------c--------g---
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          tcagacccttattcgaggatctaccgatcgttacgcgaggctggagacca
Q564A4_BCL2-01          tcagaccctcatttgaggctctaccgggtgttacgggatgctggagatga
A0A1X9JZA1_BCL2-01      -ccgacccgcatgccgccatccacagagtcctacgcgaggctggagacga
B9ZYL7_BCL2-01          ccagtcccttcggc---agtgctacagaccttgagtcgagctggagatga
F7BXJ7_BCL2-01          ccggtccctccagc---agtgctacagaccttaagtcgagctggagatga
A0A287APJ6_BCL2-01      cctgggcagcgtgt--------acccga------gccgagc-ggtgatca
A0A0U3DHY6_BCL2-01      ccggacccacatgtcaggctccacagggtcctgcgcgaggcgggggacga
H9GPE7_BCL2-01          ccggtgccacaggt---tgtccatacaacattacgccaagccggagatga
W5N4F7_BCL2-01          cccacgccgctc-------tccacaaggtgctgcgggaggctggggacga
F6YNL8_BCL2-01          ccagtgccacctgt---ggtccacctgactcttcgtcaagctggagatga
G3WZW9_BCL2-01          ccagtgccacctgt---ggtccacctgactcttcgtcaagctggagatga
G3WZW9_BCL2-02          ccagtgccacctgt---ggtccacctgactcttcgtcaagctggagatga
K7F5Y4_BCL2-02          tcagcaccacaggc---tgttcacttgactctgtgccaagccggagatga
K7F5Y4_BCL2-01          tcagcaccacaggc---tgttcacttgactctgtgccaagccggagatga
K7F5Y4_BCL2-03          tcagcaccacaggc---tgttcacttgactctgtgccaagccggagatga
H0W1T3_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgatga
F1LNV0_BCL2-01          cctgtgccacctgt---ggtccacctgaccctccgccgggctggggatga
P49950_BCL2-01          cctgtgccacctgt---ggtccacctgaccctccgccgggctggggatga
P10417_BCL2-02          cctgtgccacctgt---ggtccatctgaccctccgccgggctggggatga
P10417_BCL2-01          cctgtgccacctgt---ggtccatctgaccctccgccgggctggggatga
Q7TSN8_BCL2-01          cctgtgccacctgt---ggtccatctgaccctccgccgggctggggatga
Q6R755_BCL2-01          cccgtgccacctgt---ggtccacctgaccctccgccgggctggggatga
Q9JJV8_BCL2-01          cccgtgccacctgt---ggtccacctgaccctccgccgggctggggatga
Q923R6_BCL2-01          cccgtgccacctgt---ggtccacctgaccctccgccgggctggggatga
G3ULB7_BCL2-01          ccggtgccacctgt---agttcacctgaccttgcgccaggccggcgacga
G3ULB7_BCL2-02          ccggtgccacctgt---agttcacctgaccttgcgccaggccggcgacga
F6R2C4_BCL2-01          ccggtgccgcctgt---ggtgcacctgaccctgcgccaggccggcgatga
O02718_BCL2-01          ccggtgccgcctgt---ggtgcacctgaccctgcgccaggccggcgatga
A0A076FU27_BCL2-01      ccggtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
A0A076FZV9_BCL2-01      ccggtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
G1TW27_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggcgggcgacga
I3MVK9_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgatga
M3YYK3_BCL2-01          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgacga
G1LID1_BCL2-01          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
F7CDX6_BCL2-01          cctgtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
A0A287APJ6_BCL2-03      ccggtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
G1LID1_BCL2-02          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
M3X1R9_BCL2-01          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgatga
J9NXG3_BCL2-01          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgacga
J9NXG3_BCL2-02          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgacga
Q75SV7_BCL2-01          cccgtgccacctgt---ggtccacctgaccctgcgccaggccggcgacga
H0WKI0_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggcgggcgatga
A0A2K6G3I7_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggcgggcgatga
A0A1D5QRF2_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K5EB04_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggggacga
A0A2K6UEL3_BCL2-01      ccagtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
A0A2R8MY14_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
A0A2K6R2I6_BCL2-02      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K5HK49_BCL2-01      ccagtgccacctgt---ggtccaccttaccctccgccaggccggtgacga
A0A2K6KHG1_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K6R2I6_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K5XRD4_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K5NZS5_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A0D9S017_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K5UDI5_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A2K6CIX3_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
A0A096MPU7_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggtgacga
H2NWH5_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
G3QES9_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
A0A2I3GZF9_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgatga
A9QXG9_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
A0A2R9APW6_BCL2-01      ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
H2QEM8_BCL2-01          ccggtgccacctgt---ggtccacctgaccctccgccaggccggcgacga
U3KEW4_BCL2-01          cccgcaccccaggt---cgtccacctggtcctgcgccaggcgggcgacga
H0YUX3_BCL2-01          cctgcaccccaggc---cgtccacctcgtcctgcgccaggcgggggatga
U3II49_BCL2-01          ------------gg---actccacctcgccctgcgccaggccggggacga
Q00709_BCL2-01          cccgcgcctcccgg---cgtccacctcgccctgcgccaggccggggacga
Q00709_BCL2-02          -ccgcgcctcccgg---cgtccacctcgccctgcgccaggccggggacga
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          gatagaa-------aggatg-----------taccagcgtgaatttgagg
Q564A4_BCL2-01          aatagaa-------aggatt-----------taccaacgcgaatttgagg
A0A1X9JZA1_BCL2-01      acttgaa-------agactg-----------taccagccggacttcacgg
B9ZYL7_BCL2-01          gttctct-------cgccta-----------tatcagcaagatttcagac
F7BXJ7_BCL2-01          gttctct-------cgcctc-----------tatcagcaagattttagac
A0A287APJ6_BCL2-01      ccaccatgaaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcag
A0A0U3DHY6_BCL2-01      gattgaa-------agaatg-----------tatctgcgggactttgcag
H9GPE7_BCL2-01          gttctcc-------cgacgc-----------tatcggagggactttgctc
W5N4F7_BCL2-01          gatcgag-------aggatg-----------taccaccgggacttcgcgg
F6YNL8_BCL2-01          tttctct-------agaagg-----------taccggagagactttgatg
G3WZW9_BCL2-01          tttctct-------cgaaga-----------tatcgaagagatttcgatg
G3WZW9_BCL2-02          tttctct-------cgaaga-----------tatcgaagagatttcgatg
K7F5Y4_BCL2-02          attttcc-------cgccgc-----------tatcacagagattttgccc
K7F5Y4_BCL2-01          attttcc-------cgccgc-----------tatcacagagattttgccc
K7F5Y4_BCL2-03          attttcc-------cgccgc-----------tatcacagagattttgccc
H0W1T3_BCL2-01          cttctcc-------cgccgc-----------tatcgccaagacttcgctg
F1LNV0_BCL2-01          cttctct-------cgtcgc-----------taccgtcgcgactttgcag
P49950_BCL2-01          cttctct-------cgtcgc-----------taccgtcgcgactttgcag
P10417_BCL2-02          cttctct-------cgtcgc-----------taccgtcgtgacttcgcag
P10417_BCL2-01          cttctct-------cgtcgc-----------taccgtcgtgacttcgcag
Q7TSN8_BCL2-01          cttctct-------cgtcgc-----------taccgtcgtgacttcgcag
Q6R755_BCL2-01          cttctcc-------cgtcgc-----------taccgtcgcgacttcgcgg
Q9JJV8_BCL2-01          cttctcc-------cgtcgc-----------taccgtcgcgacttcgcgg
Q923R6_BCL2-01          cttctcc-------cgtcgc-----------taccgtcgcgacttcgcgg
G3ULB7_BCL2-01          cttctcc-------aggcgc-----------taccgccgcgacttcgccg
G3ULB7_BCL2-02          cttctcc-------aggcgc-----------taccgccgcgacttcgccg
F6R2C4_BCL2-01          cttctct-------cggcgc-----------taccgccgcgacttcgccg
O02718_BCL2-01          cttctct-------cggcgc-----------taccgccgcgacttcgccg
A0A076FU27_BCL2-01      cttctct-------cggcgc-----------taccgccgcgacttcgccg
A0A076FZV9_BCL2-01      cttctct-------cggcgc-----------taccgccgcgacttcgccg
G1TW27_BCL2-01          cttctcc-------cggcgc-----------taccgccgcgacttcgcgg
I3MVK9_BCL2-01          cttctct-------cgtcgc-----------tatcgtcgcgacttcgccg
M3YYK3_BCL2-01          cttctcc-------cgtcgc-----------taccgccgcgacttcgcgg
G1LID1_BCL2-01          cttctcc-------cgtcgc-----------taccgccgcgacttcgcgg
F7CDX6_BCL2-01          cttctcc-------cgtcgc-----------taccgccgcgactttgccg
A0A287APJ6_BCL2-03      cttctct-------cgtcgc-----------taccgccgcgactttgccg
G1LID1_BCL2-02          cttctcc-------cgtcgc-----------taccgccgcgacttcgcgg
M3X1R9_BCL2-01          cttctcc-------cgtcgc-----------taccgccgcgacttcgcgg
J9NXG3_BCL2-01          cttctcc-------cgccgc-----------taccggcg---tttcgccg
J9NXG3_BCL2-02          cttctcc-------cgccgc-----------taccggcg---tttcgccg
Q75SV7_BCL2-01          cttctcc-------cgccgc-----------taccgccgcgacttcgccg
H0WKI0_BCL2-01          cttctct-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6G3I7_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A1D5QRF2_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K5EB04_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6UEL3_BCL2-01      cttctcc-------cgccgc-----------tatcgccgcgacttcgccg
A0A2R8MY14_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6R2I6_BCL2-02      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K5HK49_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6KHG1_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6R2I6_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K5XRD4_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K5NZS5_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A0D9S017_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K5UDI5_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2K6CIX3_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A096MPU7_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
H2NWH5_BCL2-01          cttctcc-------cgccgc-----------taccgccgcgacttcgccg
G3QES9_BCL2-01          cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2I3GZF9_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A9QXG9_BCL2-01          cttctcc-------cgccgc-----------taccgccgcgacttcgccg
A0A2R9APW6_BCL2-01      cttctcc-------cgccgc-----------taccgccgcgacttcgccg
H2QEM8_BCL2-01          cttctcc-------cgccgc-----------taccgccgcgacttcgccg
U3KEW4_BCL2-01          gttctcc-------cggcgc-----------taccagagggactttgccc
H0YUX3_BCL2-01          gttctcc-------cgacgc-----------taccagagagacttttccc
U3II49_BCL2-01          gttctcc-------cgtcgc-----------taccagcgggacttcgccc
Q00709_BCL2-01          gttctcg-------cgccgc-----------taccagagggacttcgccc
Q00709_BCL2-02          gttctcg-------cgccgc-----------taccagagggacttcgccc
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          agatgtcccaccagatgacattcagtcccagtgcagca------------
Q564A4_BCL2-01          aaatgtcccaacaaatggtgttcaacccaaattctgcg------------
A0A1X9JZA1_BCL2-01      agatgtcgcggcagctgtatctcacctccaccacggcg------------
B9ZYL7_BCL2-01          agatctcagggctcctccatttaaccccatccacagtt------------
F7BXJ7_BCL2-01          agatctcagggctcctccatttaaccccatccacagtt------------
A0A287APJ6_BCL2-01      g-----ccgggcagctgggcctgttcggcttcacagcctactcttcctca
A0A0U3DHY6_BCL2-01      agatgtcggggcaattgcattttacgcccagcacggca------------
H9GPE7_BCL2-01          aaatgtctggccagctgcatttgacccccagcactgcc------------
W5N4F7_BCL2-01          agatgtcggatcagttgcacttcacccccaacaccgcc------------
F6YNL8_BCL2-01          aaatgtcaggtcaactgcacctgacccctgttactgct------------
G3WZW9_BCL2-01          aaatgtcaggtcagctgcacctgacccctgttactgct------------
G3WZW9_BCL2-02          aaatgtcaggtcagctgcacctgacccctgttactgct------------
K7F5Y4_BCL2-02          agatgtctgggcagctgcacttgaccccattcacggcc------------
K7F5Y4_BCL2-01          agatgtctgggcagctgcacttgaccccattcacggcc------------
K7F5Y4_BCL2-03          agatgtctgggcagctgcacttgaccccattcacggcc------------
H0W1T3_BCL2-01          agatgtccagccagctgcacctgacgcctttcaccgcg------------
F1LNV0_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
P49950_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
P10417_BCL2-02          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
P10417_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
Q7TSN8_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
Q6R755_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
Q9JJV8_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
Q923R6_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
G3ULB7_BCL2-01          agatgtcgagccagctgcacctgactcccttcaccgcg------------
G3ULB7_BCL2-02          agatgtcgagccagctgcacctgactcccttcaccgcg------------
F6R2C4_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
O02718_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgcg------------
A0A076FU27_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A076FZV9_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
G1TW27_BCL2-01          agatgtccagccagctgcacctgacgccctttcacgcg------------
I3MVK9_BCL2-01          agatgtccagtcagctgcacctgacgcccttcaccgca------------
M3YYK3_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
G1LID1_BCL2-01          agatgtccagccagctgcacctgacacccttcaccgca------------
F7CDX6_BCL2-01          agatgtccagccagctgcacctgacgcctttcaccgca------------
A0A287APJ6_BCL2-03      agatgtccagccagctgcacctgactcccttcaccgcg------------
G1LID1_BCL2-02          agatgtccagccagctgcacctgacacccttcaccgca------------
M3X1R9_BCL2-01          agatgtccagccagctgcacctgacaccctttaccgca------------
J9NXG3_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
J9NXG3_BCL2-02          agatgtccagccagctgcacctgacgcccttcaccgcg------------
Q75SV7_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
H0WKI0_BCL2-01          agatgtccagccagttgcacctgacgcccttcaccgcg------------
A0A2K6G3I7_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A1D5QRF2_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K5EB04_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K6UEL3_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2R8MY14_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K6R2I6_BCL2-02      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K5HK49_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K6KHG1_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K6R2I6_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K5XRD4_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K5NZS5_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A0D9S017_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K5UDI5_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2K6CIX3_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A096MPU7_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
H2NWH5_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
G3QES9_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2I3GZF9_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
A9QXG9_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
A0A2R9APW6_BCL2-01      agatgtccagccagctgcacctgacgcccttcaccgcg------------
H2QEM8_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcg------------
U3KEW4_BCL2-01          aaatgtctggccagctgcacctgacgcccttcacggcc------------
H0YUX3_BCL2-01          aaatgtctggccagctgcacctgacgccctttacagcc------------
U3II49_BCL2-01          agatgtccggccagctgcacctgacaccnnnnacggcc------------
Q00709_BCL2-01          agatgtcgggccagctgcacctgacgcccttcacggcc------------
Q00709_BCL2-02          agatgtcgggccagctgcacctgacgcccttcacggcc------------
G1MZW1_BCL2-01          --------------------------------------------------
                                                                          

X4ZGI8_BCL2-01          --------------------caacgcagcttcttagctgtggctgaagag
Q564A4_BCL2-01          --------------------caacgcagctttctaaccgtggccgaagag
A0A1X9JZA1_BCL2-01      --------------------cagaggagattcgccgacgtgatagacgaa
B9ZYL7_BCL2-01          --------------------agggtgcgctttgcaacagtggtggaggag
F7BXJ7_BCL2-01          --------------------agggtgcgctttgcaacagtagtggaggag
A0A287APJ6_BCL2-01      aagtttgccatcaggggattggcagaagctctgca--gatggaggtgaag
A0A0U3DHY6_BCL2-01      --------------------caganaaggtttaccgctgtaatagatgag
H9GPE7_BCL2-01          --------------------agaagtcgttttgtggccgtggtggaagag
W5N4F7_BCL2-01          --------------------cggaggaagttcaccgcggtggtggaggag
F6YNL8_BCL2-01          --------------------aggggacgctttgccacagtggtagaggag
G3WZW9_BCL2-01          --------------------aggggacgctttgccacagtagtggaagag
G3WZW9_BCL2-02          --------------------aggggacgctttgccacagtagtggaagag
K7F5Y4_BCL2-02          --------------------agggggcgctttgtggcggtggtggaggag
K7F5Y4_BCL2-01          --------------------agggggcgctttgtggcggtggtggaggag
K7F5Y4_BCL2-03          --------------------agggggcgctttgtggcggtggtggaggag
H0W1T3_BCL2-01          --------------------aggggacgctttgccacg------------
F1LNV0_BCL2-01          --------------------aggggacgctttgccacggtggtggaggaa
P49950_BCL2-01          --------------------aggggacgctttgccacggtggtggaggaa
P10417_BCL2-02          --------------------aggggacgctttgccacggtggtggaggaa
P10417_BCL2-01          --------------------aggggacgctttgccacggtggtggaggaa
Q7TSN8_BCL2-01          --------------------aggggacgctttgccacggtggtggaggaa
Q6R755_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
Q9JJV8_BCL2-01          --------------------aggggacgctttgctacggtggtggaggaa
Q923R6_BCL2-01          --------------------aggggacgctttgctacggtggtggaggaa
G3ULB7_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
G3ULB7_BCL2-02          --------------------aggggacgctttgccacggtggtggaggag
F6R2C4_BCL2-01          --------------------aggggacgcttcgccacggtggtggaggag
O02718_BCL2-01          --------------------agggaacgcttcgccacggtggtggaggag
A0A076FU27_BCL2-01      --------------------aggggacgcttcgccacggtggtggaggag
A0A076FZV9_BCL2-01      --------------------aggggacgcttcgccacggtggtggaggag
G1TW27_BCL2-01          --------------------agggggcgctttgccacggtggtggaggag
I3MVK9_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
M3YYK3_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
G1LID1_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
F7CDX6_BCL2-01          --------------------aggggacgctttgccacggtagtggaggag
A0A287APJ6_BCL2-03      --------------------aggggacgctttgccacggtggtggaggag
G1LID1_BCL2-02          --------------------aggggacgctttgccacggtggtggaggag
M3X1R9_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
J9NXG3_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
J9NXG3_BCL2-02          --------------------aggggacgctttgccacggtggtggaggag
Q75SV7_BCL2-01          --------------------aggggacgctttgccacggtggtggaggag
H0WKI0_BCL2-01          --------------------agaggacgctttgccacggtggtggaggag
A0A2K6G3I7_BCL2-01      --------------------aggggacgctttgccacggtggtggaggag
A0A1D5QRF2_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K5EB04_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K6UEL3_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2R8MY14_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K6R2I6_BCL2-02      --------------------cggggacgctttgccacggtggtggaggag
A0A2K5HK49_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K6KHG1_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K6R2I6_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K5XRD4_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K5NZS5_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A0D9S017_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K5UDI5_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A2K6CIX3_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A0A096MPU7_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
H2NWH5_BCL2-01          --------------------cggggacgctttgccacggtggtggaggag
G3QES9_BCL2-01          --------------------cggggacgctttgccacggtggtggaggag
A0A2I3GZF9_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
A9QXG9_BCL2-01          --------------------cggggacgctttgccacggtggtggaggag
A0A2R9APW6_BCL2-01      --------------------cggggacgctttgccacggtggtggaggag
H2QEM8_BCL2-01          --------------------cggggacgctttgccacggtggtggaggag
U3KEW4_BCL2-01          --------------------aggagccgcttcgtggccgtggtggaggag
H0YUX3_BCL2-01          --------------------aggagccgcttcgtggcggtggtggaggag
U3II49_BCL2-01          --------------------agaggccgcttcgtggccgtggtggaggag
Q00709_BCL2-01          --------------------cacggccgcttcgtggccgtggtggaggag
Q00709_BCL2-02          --------------------cacggccgcttcgtggccgtggtggaggag
G1MZW1_BCL2-01          -----------------------------------------gtggaggag
                                                                          

X4ZGI8_BCL2-01          -----------------------------ctcttcagagacggagtgaac
Q564A4_BCL2-01          -----------------------------ctctttagagacggagtgaac
A0A1X9JZA1_BCL2-01      -----------------------------ctgttccgggacggggtgaac
B9ZYL7_BCL2-01          -----------------------------ctctttcatgatggggtaaac
F7BXJ7_BCL2-01          -----------------------------ctctttcatgatggggtcaac
A0A287APJ6_BCL2-01      ccatataatgtttatgtcacagtggcctaccctccagacacagacacccc
A0A0U3DHY6_BCL2-01      -----------------------------ctcttcagcgacggggtaaac
H9GPE7_BCL2-01          -----------------------------ctcttccaggacggtgtgaac
W5N4F7_BCL2-01          -----------------------------ctgtttcgggacggagtcaac
F6YNL8_BCL2-01          -----------------------------ctgttcagggatggggtgaac
G3WZW9_BCL2-01          -----------------------------ctgttcagggatggggtgaac
G3WZW9_BCL2-02          -----------------------------ctgttcagggatggggtgaac
K7F5Y4_BCL2-02          -----------------------------ctattccgagatgggattaac
K7F5Y4_BCL2-01          -----------------------------ctattccgagatgggattaac
K7F5Y4_BCL2-03          -----------------------------ctattccgagatgggattaac
H0W1T3_BCL2-01          -----------------------------ctcttcagggatggggtgaac
F1LNV0_BCL2-01          -----------------------------ctcttcagggatggggtgaac
P49950_BCL2-01          -----------------------------ctcttcagggatggggtgaac
P10417_BCL2-02          -----------------------------ctcttcagggatggggtgaac
P10417_BCL2-01          -----------------------------ctcttcagggatggggtgaac
Q7TSN8_BCL2-01          -----------------------------ctcttcagggatggggtgaac
Q6R755_BCL2-01          -----------------------------ctcttcagggatggggtgaac
Q9JJV8_BCL2-01          -----------------------------ctcttcagggatggggtgaac
Q923R6_BCL2-01          -----------------------------ctcttcagggatggggtgaac
G3ULB7_BCL2-01          -----------------------------ctcttcagggacggggtgaac
G3ULB7_BCL2-02          -----------------------------ctcttcagggacggggtgaac
F6R2C4_BCL2-01          -----------------------------ctcttcagggacggggtgaac
O02718_BCL2-01          -----------------------------ctcttcagggacggggtgaac
A0A076FU27_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A076FZV9_BCL2-01      -----------------------------ctcttcagggacggggtgaac
G1TW27_BCL2-01          -----------------------------ctcttcagggatggggtgaac
I3MVK9_BCL2-01          -----------------------------ctcttcagggatggggtgaac
M3YYK3_BCL2-01          -----------------------------ctcttcagggatggggtgaac
G1LID1_BCL2-01          -----------------------------ctcttcagggatggggtgaac
F7CDX6_BCL2-01          -----------------------------ctcttcagggatggggtgaac
A0A287APJ6_BCL2-03      -----------------------------ctcttcagggatggggtgaac
G1LID1_BCL2-02          -----------------------------ctcttcagggatggggtgaac
M3X1R9_BCL2-01          -----------------------------ctcttcagggatggagtgaac
J9NXG3_BCL2-01          -----------------------------ctcttcagggatggggtgaac
J9NXG3_BCL2-02          -----------------------------ctcttcagggatggggtgaac
Q75SV7_BCL2-01          -----------------------------ctcttcagggatggggtgaac
H0WKI0_BCL2-01          -----------------------------ctcttcagggatggggtgaac
A0A2K6G3I7_BCL2-01      -----------------------------ctcttcagggatggggtgaac
A0A1D5QRF2_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K5EB04_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K6UEL3_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2R8MY14_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K6R2I6_BCL2-02      -----------------------------ctcttcagggacggggtgaac
A0A2K5HK49_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K6KHG1_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K6R2I6_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K5XRD4_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K5NZS5_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A0D9S017_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K5UDI5_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A2K6CIX3_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A0A096MPU7_BCL2-01      -----------------------------ctcttcagggacggggtgaac
H2NWH5_BCL2-01          -----------------------------ctcttcagggacggggtgaac
G3QES9_BCL2-01          -----------------------------ctcttcagggacggggtgaac
A0A2I3GZF9_BCL2-01      -----------------------------ctcttcagggacggggtgaac
A9QXG9_BCL2-01          -----------------------------ctcttcagggacggggtgaac
A0A2R9APW6_BCL2-01      -----------------------------ctcttcagggacggggtgaac
H2QEM8_BCL2-01          -----------------------------ctcttcagggacggggtgaac
U3KEW4_BCL2-01          -----------------------------ctcttccgagacggggttaac
H0YUX3_BCL2-01          -----------------------------ctcttccgagatggggttaac
U3II49_BCL2-01          -----------------------------ctcttccgagacggggtgaac
Q00709_BCL2-01          -----------------------------ctcttccgtgatggggtcaac
Q00709_BCL2-02          -----------------------------ctcttccgtgatggggtcaac
G1MZW1_BCL2-01          -----------------------------cttttccgtgatggggtcaat
                                                     *  *      *  *       

X4ZGI8_BCL2-01          tggg------ggcgga---------------tcgtcgctttctttgagtt
Q564A4_BCL2-01          tggg------ggcgga---------------tcattgcattcttcgagtt
A0A1X9JZA1_BCL2-01      tggg------gccgga---------------ttatcgctttcttcgagtt
B9ZYL7_BCL2-01          tggg------gaagga---------------ttgttgcttttttcgagtt
F7BXJ7_BCL2-01          tggg------gaagga---------------ttgttgcttttttcgagtt
A0A287APJ6_BCL2-01      tgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttattt
A0A0U3DHY6_BCL2-01      tggg------gtcgga---------------ttgtggctttctttgagtt
H9GPE7_BCL2-01          tggg------ggagga---------------ttgtggcgttctttgaatt
W5N4F7_BCL2-01          tggg------ggcgga---------------ttgtcgctttcttcgagtt
F6YNL8_BCL2-01          tggg------ggagga---------------tcgtggccttctttgagtt
G3WZW9_BCL2-01          tggg------ggcgga---------------ttgtggccttctttgaatt
G3WZW9_BCL2-02          tggg------ggcgga---------------ttgtggccttctttgaatt
K7F5Y4_BCL2-02          tggg------gaagga---------------tcgtggccttctttgaatt
K7F5Y4_BCL2-01          tggg------gaagga---------------tcgtggccttctttgaatt
K7F5Y4_BCL2-03          tggg------gaagga---------------tcgtggccttctttgaatt
H0W1T3_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
F1LNV0_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
P49950_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
P10417_BCL2-02          tggg------ggagga---------------ttgtggccttctttgagtt
P10417_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
Q7TSN8_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
Q6R755_BCL2-01          tggg------ggagga---------------tcgtggccttctttgagtt
Q9JJV8_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
Q923R6_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
G3ULB7_BCL2-01          tggg------ggcgga---------------ttgtggccttctttgagtt
G3ULB7_BCL2-02          tggg------ggcgga---------------ttgtggccttctttgagtt
F6R2C4_BCL2-01          tggg------ggcgca---------------tcgtggccttctttgagtt
O02718_BCL2-01          tggg------ggcgca---------------tcgtggccttctttgagtt
A0A076FU27_BCL2-01      tggg------ggcgca---------------tcgtggccttctttgagtt
A0A076FZV9_BCL2-01      tggg------ggcgca---------------tcgtggccttctttgagtt
G1TW27_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
I3MVK9_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
M3YYK3_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
G1LID1_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
F7CDX6_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
A0A287APJ6_BCL2-03      tggg------ggagga---------------ttgtggccttctttgagtt
G1LID1_BCL2-02          tggg------ggagga---------------ttgtggccttctttgagtt
M3X1R9_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
J9NXG3_BCL2-01          tggg------ggagga---------------tcgtggccttctttgagtt
J9NXG3_BCL2-02          tggg------ggagga---------------tcgtggccttctttgagtt
Q75SV7_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
H0WKI0_BCL2-01          tggg------ggagga---------------tcgtggccttctttgagtt
A0A2K6G3I7_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A1D5QRF2_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A2K5EB04_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K6UEL3_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2R8MY14_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K6R2I6_BCL2-02      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K5HK49_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K6KHG1_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K6R2I6_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A0A2K5XRD4_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A2K5NZS5_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A0D9S017_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A2K5UDI5_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A2K6CIX3_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
A0A096MPU7_BCL2-01      tggg------ggagga---------------tcgtggccttctttgagtt
H2NWH5_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
G3QES9_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
A0A2I3GZF9_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
A9QXG9_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
A0A2R9APW6_BCL2-01      tggg------ggagga---------------ttgtggccttctttgagtt
H2QEM8_BCL2-01          tggg------ggagga---------------ttgtggccttctttgagtt
U3KEW4_BCL2-01          tggg------gcagaa---------------tcgtggccttcttcgagtt
H0YUX3_BCL2-01          tggg------gcagaa---------------ttgtggccttcttcgagtt
U3II49_BCL2-01          tggg------gccgga---------------tcgtggccttcttcgagtt
Q00709_BCL2-01          tggg------gccgga---------------tcgtcgccttcttcgagtt
Q00709_BCL2-02          tggg------gccgga---------------tcgtcgccttcttcgagtt
G1MZW1_BCL2-01          tggg------gccgga---------------tcgtcgccttctttgagtt
                        ****      *  * *               *    *  *  *   * **

X4ZGI8_BCL2-01          tggtgggaccatgtgtgtggagagc----------ttcaaccg-------
Q564A4_BCL2-01          tggtgggaccatgtgcgtggaaagc----------gtcaaccg-------
A0A1X9JZA1_BCL2-01      cgggggcacggtgtgcgtggagtgc-------gtggcgaagga-------
B9ZYL7_BCL2-01          tggtggggtcatgtgcgtggagatt----------gttaaccg-------
F7BXJ7_BCL2-01          tggtggggtcatgtgcgtggaaagt----------gttaatcg-------
A0A287APJ6_BCL2-01      cagagaccacatctgtttgcaaaccagagcaagtggccaaacaaattgtt
A0A0U3DHY6_BCL2-01      tggagggacaatgtgcgtggagagc----------gtcaaccg-------
H9GPE7_BCL2-01          tggtggcatgctgtgcgtggagagt----------gtcagccg-------
W5N4F7_BCL2-01          cggcgggacgatgtgcgtggagagc----------gtgaaccg-------
F6YNL8_BCL2-01          tggtggtgttatgtgtgtggagagc----------gtcaaccg-------
G3WZW9_BCL2-01          tggtggtgttatgtgtgtggagagc----------gtcaaccg-------
G3WZW9_BCL2-02          tggtggtgttatgtgtgtggagagc----------gtcaaccg-------
K7F5Y4_BCL2-02          tggtggcgtgatgtgtgtggagagt----------gtcaaccg-------
K7F5Y4_BCL2-01          tggtggcgtgatgtgtgtggagagt----------gtcaaccg-------
K7F5Y4_BCL2-03          tggtggcgtgatgtgtgtggagagt----------gtcaaccg-------
H0W1T3_BCL2-01          cggtggggtcatgtgtgtggagagt----------gtcaaccg-------
F1LNV0_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
P49950_BCL2-01          cggtggggtcatgtgtgtggggagc----------gtcaacag-------
P10417_BCL2-02          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
P10417_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
Q7TSN8_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
Q6R755_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
Q9JJV8_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
Q923R6_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaacag-------
G3ULB7_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
G3ULB7_BCL2-02          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
F6R2C4_BCL2-01          cggaggggtcatgtgtgtggagagc----------gtcaaccg-------
O02718_BCL2-01          cggaggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A076FU27_BCL2-01      cggaggggtcatatgtgtggagagc----------gtcaaccg-------
A0A076FZV9_BCL2-01      cggaggggtcatgtgtgtggagagc----------gtcaaccg-------
G1TW27_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
I3MVK9_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
M3YYK3_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
G1LID1_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
F7CDX6_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A287APJ6_BCL2-03      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
G1LID1_BCL2-02          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
M3X1R9_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
J9NXG3_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
J9NXG3_BCL2-02          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
Q75SV7_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
H0WKI0_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6G3I7_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A1D5QRF2_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K5EB04_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6UEL3_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2R8MY14_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6R2I6_BCL2-02      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K5HK49_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6KHG1_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6R2I6_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K5XRD4_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K5NZS5_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A0D9S017_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K5UDI5_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2K6CIX3_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A096MPU7_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
H2NWH5_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
G3QES9_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2I3GZF9_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A9QXG9_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
A0A2R9APW6_BCL2-01      cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
H2QEM8_BCL2-01          cggtggggtcatgtgtgtggagagc----------gtcaaccg-------
U3KEW4_BCL2-01          tggcggcgtgatgtgcgtggagagc----------gtcaacag-------
H0YUX3_BCL2-01          tggcggtgtgatgtgtgtggagagc----------gtcaacag-------
U3II49_BCL2-01          cggcggcgtcatgtgcgtggagagc----------gtcaaccg-------
Q00709_BCL2-01          cggcggcgtgatgtgcgtcgagagc----------gtcaaccg-------
Q00709_BCL2-02          cggcggcgtgatgtgcgtcgagagc----------gtcaaccg-------
G1MZW1_BCL2-01          cggcggcgtgatgtgcgtcgagagc----------gtcaaccg-------
                          * *      * **  *                    *           

X4ZGI8_BCL2-01          ggagatggcgtcccaggtag--ataatattgcacactggatgacagacta
Q564A4_BCL2-01          ggagatggcgtcccaggtag--ataatattgcacactggatgactgacta
A0A1X9JZA1_BCL2-01      ggagatggcagcgcaggtga--acaacatcgcggagtggatgactgagta
B9ZYL7_BCL2-01          cgaaatgtctcctctggtgg--actccattgtgggttggatgacagagta
F7BXJ7_BCL2-01          agaaatgtctcctctggtgg--attccattgtgggttggatgacagagta
A0A287APJ6_BCL2-01      aaagatgccatacaaggaaatttcaatagttccatcggctcagatgggta
A0A0U3DHY6_BCL2-01      ggagatgacgtcccaggtgg--acaacatcgctctttggatgacggagta
H9GPE7_BCL2-01          ggagatgtccccccttgtgg--acaatattgctacgtggatgactgagta
W5N4F7_BCL2-01          ggagatgacgtcccaggtgg--acaacattgccaactggatgacggagta
F6YNL8_BCL2-01          ggagatgtcgcccctggtgg--acagcattgccctatggatgactgagta
G3WZW9_BCL2-01          ggagatgtcgcctctggtgg--acagcatagccctgtggatgactgagta
G3WZW9_BCL2-02          ggagatgtcgcctctggtgg--acagcatagccctgtggatgactgagta
K7F5Y4_BCL2-02          ggagatgtcgcctcttgtgg--acagtattgctgtgtggatgactgagta
K7F5Y4_BCL2-01          ggagatgtcgcctcttgtgg--acagtattgctgtgtggatgactgagta
K7F5Y4_BCL2-03          ggagatgtcgcctcttgtgg--acagtattgctgtgtggatgactgagta
H0W1T3_BCL2-01          ggagatgtcacctctggtgg--acaacatcgccctctggatgactgagta
F1LNV0_BCL2-01          ggagatgtcacccctggtgg--acaacatcgctctgtggatgactgagta
P49950_BCL2-01          ggagatgtcacccctggtgg--acaacatcgctctgtggatgactgagta
P10417_BCL2-02          ggagatgtcacccctggtgg--acaacatcgccctgtggatgactgagta
P10417_BCL2-01          ggagatgtcacccctggtgg--acaacatcgccctgtggatgactgagta
Q7TSN8_BCL2-01          ggagatgtcacccctggtgg--acaacatcgccctgtggatgactgagta
Q6R755_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
Q9JJV8_BCL2-01          ggagatgtcacccctggtgg--acaacatcgccctgtggatgaccgagta
Q923R6_BCL2-01          ggagatgtcacccctggtgg--acaacatcgccctgtggatgaccgagta
G3ULB7_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctctggatgactgagta
G3ULB7_BCL2-02          ggagatgtcgcccctggtgg--acaacatcgccctctggatgactgagta
F6R2C4_BCL2-01          ggagatgtcgcccctggtgg--acagcatcgccctgtggatgaccgagta
O02718_BCL2-01          ggagatgtcgcccctggtgg--acagcatcgccctgtggatgaccgagta
A0A076FU27_BCL2-01      ggagatgtcgcccctggtgg--acagcatcgccctgtggatgaccgagta
A0A076FZV9_BCL2-01      ggagatgtcgcccctggtgg--acagcatcgccctgtggatgaccgagta
G1TW27_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
I3MVK9_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
M3YYK3_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctatggatgactgagta
G1LID1_BCL2-01          ggagatgtcgcccctggtgg--acaacattgccctgtggatgactgagta
F7CDX6_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgaata
A0A287APJ6_BCL2-03      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
G1LID1_BCL2-02          ggagatgtcgcccctggtgg--acaacattgccctgtggatgactgagta
M3X1R9_BCL2-01          agagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
J9NXG3_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
J9NXG3_BCL2-02          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
Q75SV7_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
H0WKI0_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K6G3I7_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A1D5QRF2_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K5EB04_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgcgctgtggatgaccgagta
A0A2K6UEL3_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgaccgagta
A0A2R8MY14_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgaccgagta
A0A2K6R2I6_BCL2-02      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K5HK49_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K6KHG1_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K6R2I6_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K5XRD4_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K5NZS5_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A0D9S017_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K5UDI5_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2K6CIX3_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A096MPU7_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
H2NWH5_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
G3QES9_BCL2-01          ggagatgtctcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2I3GZF9_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A9QXG9_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
A0A2R9APW6_BCL2-01      ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
H2QEM8_BCL2-01          ggagatgtcgcccctggtgg--acaacatcgccctgtggatgactgagta
U3KEW4_BCL2-01          ggagatgtctccgctggtgg--acagcatcgccgcctggatgaccgagta
H0YUX3_BCL2-01          ggagatgtttcccctcgtgg--acaacattgccacctggatgactgagta
U3II49_BCL2-01          ggagatgtctcccctggtgg--acagcatcgccgcctggatgaccgagta
Q00709_BCL2-01          ggagatgtcgccgctggtgg--acaacattgccacctggatgaccgagta
Q00709_BCL2-02          ggagatgtcgccgctggtgg--acaacattgccacctggatgaccgagta
G1MZW1_BCL2-01          ggagatgtcgccgctggtgg--acaacattgccacctggatgaccgaata
                          * ***         *          *         *       *  **

X4ZGI8_BCL2-01          cctgaacgggc-------cactggaaaactggatcgagga--------aa
Q564A4_BCL2-01          cctgaacgggc-------cactggaaaactggatcgagga--------aa
A0A1X9JZA1_BCL2-01      tttaaatggac-------ctctgaacagctggatacaaga--------ta
B9ZYL7_BCL2-01          cctaaaccgtc-------acttacaaaattggatccagga----------
F7BXJ7_BCL2-01          cctaaacagtc-------acttgcaaaattggatccagga----------
A0A287APJ6_BCL2-01      catg--ctgtcctccctgacctgtggaa-tggctccagtaacttccatca
A0A0U3DHY6_BCL2-01      cctgaacggac-------ccctacagaactggatccagga--------ga
H9GPE7_BCL2-01          tctgaaccagt-------acctgcgcaactggatccagga--------ga
W5N4F7_BCL2-01          tctcaacgggc-------cccttcagaactggatccagga--------ga
F6YNL8_BCL2-01          cctgaaccggc-------acctgcacacttggatccagga--------ta
G3WZW9_BCL2-01          cctgaaccggc-------acctgcacaactggatccagga--------ta
G3WZW9_BCL2-02          cctgaaccggc-------acctgcacaactggatccagga--------ta
K7F5Y4_BCL2-02          cctgaacagac-------acttgcacaactggatccagga--------ca
K7F5Y4_BCL2-01          cctgaacagac-------acttgcacaactggatccagga--------ca
K7F5Y4_BCL2-03          cctgaacagac-------acttgcacaactggatccagga--------ca
H0W1T3_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
F1LNV0_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
P49950_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
P10417_BCL2-02          cctgaaccggc-------atctgcacacctggatccagga--------ta
P10417_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
Q7TSN8_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
Q6R755_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ca
Q9JJV8_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
Q923R6_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ta
G3ULB7_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
G3ULB7_BCL2-02          cctgaaccggc-------acctgcacacctggatccagga--------ta
F6R2C4_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ca
O02718_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ca
A0A076FU27_BCL2-01      cctgaaccggc-------acctgcacgcctggatccagga--------ca
A0A076FZV9_BCL2-01      cctgaaccggc-------acctgcacgcctggatccagga--------ca
G1TW27_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
I3MVK9_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
M3YYK3_BCL2-01          cctgaaccggc-------acttgcacacctggatccagga--------ca
G1LID1_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ca
F7CDX6_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A287APJ6_BCL2-03      cctgaaccggc-------acctgcacacctggatccagga--------ta
G1LID1_BCL2-02          cctgaaccggc-------acctgcacacctggatccagga--------ca
M3X1R9_BCL2-01          cctgaaccggc-------acctgcacacctggatccaaga--------ca
J9NXG3_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ca
J9NXG3_BCL2-02          cctgaaccggc-------atctgcacacctggatccagga--------ca
Q75SV7_BCL2-01          cctgaaccggc-------atctgcacacctggatccagga--------ca
H0WKI0_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K6G3I7_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A1D5QRF2_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K5EB04_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K6UEL3_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2R8MY14_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K6R2I6_BCL2-02      cctgaaccggc-------acctgcacacttggatccagga--------ta
A0A2K5HK49_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K6KHG1_BCL2-01      cctgaaccggc-------acctgcacacttggatccagga--------ta
A0A2K6R2I6_BCL2-01      cctgaaccggc-------acctgcacacttggatccagga--------ta
A0A2K5XRD4_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K5NZS5_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A0D9S017_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K5UDI5_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2K6CIX3_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A096MPU7_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
H2NWH5_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
G3QES9_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2I3GZF9_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
A9QXG9_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
A0A2R9APW6_BCL2-01      cctgaaccggc-------acctgcacacctggatccagga--------ta
H2QEM8_BCL2-01          cctgaaccggc-------acctgcacacctggatccagga--------ta
U3KEW4_BCL2-01          cctgaaccggc-------acctgcacaactggatccagga--------ca
H0YUX3_BCL2-01          cctgaaccggc-------acctgcacaactggatccagga--------ca
U3II49_BCL2-01          cctgaaccggc-------acctgcacaactggatccagga--------ca
Q00709_BCL2-01          cctgaaccggc-------acctgcacaactggatccagga--------ca
Q00709_BCL2-02          cctgaaccggc-------acctgcacaactggatccagga--------ca
G1MZW1_BCL2-01          cctgaacaggc-------acctgcacaactggatccagga--------ca
                          *                  *       *** *  *  *          

X4ZGI8_BCL2-01          atggagg---ctgg---gacgcctttgtggagtta---------tacagt
Q564A4_BCL2-01          atggagg---ttgg---gatgccttcgtggagatg---------tacggt
A0A1X9JZA1_BCL2-01      acggggg---atgg---gatgcctttgtggagctg---------tatgac
B9ZYL7_BCL2-01          ----------acag---gatgcatttgtggagctg---------tacaac
F7BXJ7_BCL2-01          ----------acag---g--------------------------------
A0A287APJ6_BCL2-01      ctgaagggctccagcaggatgcctttgtggagctg---------tatggg
A0A0U3DHY6_BCL2-01      atggtgg---ctgg---gacgcctttgtggagatc---------tatga-
H9GPE7_BCL2-01          acggagg---ctgg------------------------------------
W5N4F7_BCL2-01          acggagg---ctgg---gacgcctttgtggagctc---------tatggg
F6YNL8_BCL2-01          acggagg---atgg---gatgcctttgtggaattg---------tatggc
G3WZW9_BCL2-01          acggagg---atgg---ggtaccaaagc-aatttg---------catgg-
G3WZW9_BCL2-02          acggagg---atgg---g----------------------------tag-
K7F5Y4_BCL2-02          atggagg---ttgg---g--------------------------------
K7F5Y4_BCL2-01          atggagg---ttgg---gatgcctttgtggaattg---------tatggc
K7F5Y4_BCL2-03          atggagg---ttgg------------------------------------
H0W1T3_BCL2-01          acggagg---atgg------------------------------------
F1LNV0_BCL2-01          acggagg---ctgg---gatgcctttgtggaacta---------tatggc
P49950_BCL2-01          acggagg---ctgg---gatgcctttgtggaacta---------tatggc
P10417_BCL2-02          acggagg---ctgg---g--------------------------------
P10417_BCL2-01          acggagg---ctgg---gatgcctttgtggaacta---------tatggc
Q7TSN8_BCL2-01          acggagg---ctgg---gatgcctttgtggaacta---------tatggc
Q6R755_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
Q9JJV8_BCL2-01          acggagg---ctgg---gacgcatttgtggaactg---------tacggc
Q923R6_BCL2-01          acggagg---ctgg---gacgcatttgtggaactg---------tacggc
G3ULB7_BCL2-01          acggagg---atgg---gatgcctttgtggaactg---------tatggc
G3ULB7_BCL2-02          acggagg---atgggtaggtgcatgtgtgg--------------------
F6R2C4_BCL2-01          acggagg---ctgg---gacgcctttgtggagctg---------tatggc
O02718_BCL2-01          acggagg---ctgg---gacgcctttgtggagctg---------tatggc
A0A076FU27_BCL2-01      acggagg---ctgg---gacgcctttgtggagctg---------tacggc
A0A076FZV9_BCL2-01      acggagg---ctgg---gacgcctttgtggagctg---------tacggc
G1TW27_BCL2-01          atggagg---ctgg---gatgccttcgtggaactg---------tacggc
I3MVK9_BCL2-01          acggagg---ctgggtaggtgcacgtcggg--------------------
M3YYK3_BCL2-01          acggagg---ctgg---cctgcccccgccccccat---------gaaggt
G1LID1_BCL2-01          acggagg---ctgg---gatgcctttgtggagttg---------tacggc
F7CDX6_BCL2-01          acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A287APJ6_BCL2-03      acggagg---ctgg---gatgcctttgtggagctg---------tatggg
G1LID1_BCL2-02          acggagg---ctgg--------------gtaggtg---------cacgtc
M3X1R9_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
J9NXG3_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
J9NXG3_BCL2-02          acggagg---ctgg------------------------------------
Q75SV7_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
H0WKI0_BCL2-01          acggagg---ctgg---gacgcctttgtggaattg---------tatggc
A0A2K6G3I7_BCL2-01      acggagg---ctgg---gacgcctttgtggaattg---------tatggt
A0A1D5QRF2_BCL2-01      acggagg---ctgggtaggtgcacttggtgatgtgagtctgggctggggc
A0A2K5EB04_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tatggc
A0A2K6UEL3_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tatggc
A0A2R8MY14_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tatggc
A0A2K6R2I6_BCL2-02      acggagg---ctgg---cgtac---------aatg---------t-----
A0A2K5HK49_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A0A2K6KHG1_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A0A2K6R2I6_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A0A2K5XRD4_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A2K5NZS5_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A0D9S017_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A2K5UDI5_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A2K6CIX3_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
A0A096MPU7_BCL2-01      acggagg---ctgg---gacgcctttgtggaactg---------tacggc
H2NWH5_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
G3QES9_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A0A2I3GZF9_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A9QXG9_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
A0A2R9APW6_BCL2-01      acggagg---ctgg---gatgcctttgtggaactg---------tacggc
H2QEM8_BCL2-01          acggagg---ctgg---gatgcctttgtggaactg---------tacggc
U3KEW4_BCL2-01          acggagg---ctgg---gatgcctttgtggagttg---------tatggc
H0YUX3_BCL2-01          acggagg---ctgg---gatgcctttgtggagttg---------tatggc
U3II49_BCL2-01          acggagg---ctgg------------------------------------
Q00709_BCL2-01          acggagg---atgg---gatgcctttgtggaattg---------tacggc
Q00709_BCL2-02          acggagg---atgg---gatgcctttgtggaattg---------tacggc
G1MZW1_BCL2-01          acggagg---atgg---gatgccttcgtggaattg---------tacggc
                                     *                                    

X4ZGI8_BCL2-01          cagca---gagagaccctatgttcca---cccattgtcgtac--------
Q564A4_BCL2-01          cagca---gagagactctgtgttcca---cccgttttcatac--------
A0A1X9JZA1_BCL2-01      agaca---gagggactccgtcttcagttgctcctggccctcc--------
B9ZYL7_BCL2-01          agcaa---tatccagccaccgtttgaccagagctggttatcc--------
F7BXJ7_BCL2-01          --------------------------------------------------
A0A287APJ6_BCL2-01      cccag---catgcggcctctatttgatttctcctggctgtct--------
A0A0U3DHY6_BCL2-01      -acag---cagaggatctct-------cactcctggccgtac--------
H9GPE7_BCL2-01          --------------------------------------------------
W5N4F7_BCL2-01          agaca---gagaggctccatgttcagctgttcatggccatct--------
F6YNL8_BCL2-01          aacag---catgaggcctttgttcgatttctcctggctgtct--------
G3WZW9_BCL2-01          ----g---caccagtggtccatt---------------------------
G3WZW9_BCL2-02          ----g--------------tgtt---------------------------
K7F5Y4_BCL2-02          --------------------------------------------------
K7F5Y4_BCL2-01          agcaa---catgaggcctttgtttgatttctcctggatctct--------
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          cccag---catgcgacctctgtttgatttctcctggctgtct--------
P49950_BCL2-01          cccag---catgcgacctctgtttgatttctcctggctgtct--------
P10417_BCL2-02          --------------------------------------------------
P10417_BCL2-01          cccag---catgcgacctctgtttgatttctcctggctgtct--------
Q7TSN8_BCL2-01          cccag---catgcgacctctgtttgatttctcctggctgtct--------
Q6R755_BCL2-01          cccac---catgcagcctctgtttgatttctcctggctgtct--------
Q9JJV8_BCL2-01          cccag---tgtgaggcctctgtttgatttctcttggctgtct--------
Q923R6_BCL2-01          cccag---tgtgaggcctctgtttgatttctcttggctgtct--------
G3ULB7_BCL2-01          cccaa---catgcgacctctgtttgatttctcctggctgtct--------
G3ULB7_BCL2-02          --------------------------------------------------
F6R2C4_BCL2-01          cctag---catgcggcccctgtttgatttctcctggctgtct--------
O02718_BCL2-01          cctag---catgcggcccctgtttgatttctcctggctgtct--------
A0A076FU27_BCL2-01      cctag---catgcggcccctgtttgatttctcctggctgtct--------
A0A076FZV9_BCL2-01      cctag---catgcggcccctgtttgatttctcctggctgtct--------
G1TW27_BCL2-01          cccag---cgtgcggcctctgtcagacttctcctgggtgtct--------
I3MVK9_BCL2-01          --------------------------------------------------
M3YYK3_BCL2-01          ccagc---tgccagacctattgttgatgattcct-actggcc--------
G1LID1_BCL2-01          cccag---catgcagcctctgtttgacttctcctggctgtct--------
F7CDX6_BCL2-01          cccag---catgcggccgctgtttgatttctcctggctgtct--------
A0A287APJ6_BCL2-03      cccag---catgcggcctctatttgatttctcctggctgtct--------
G1LID1_BCL2-02          c-------------------------------------------------
M3X1R9_BCL2-01          cccag---catgcagcctctgtttgatttctcctggctgtcc--------
J9NXG3_BCL2-01          cccac---catgcagcctctgtttgacttctcctggctgtct--------
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          cccac---catgcagcctctgtttgacttctcctggctgtct--------
H0WKI0_BCL2-01          cccag---catgcggcctctgtttgacttctcctggctgtct--------
A0A2K6G3I7_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A1D5QRF2_BCL2-01      cacaggttcgaggtgcgggggttggagtgcgggtgggctcctggggcaag
A0A2K5EB04_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K6UEL3_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2R8MY14_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K6R2I6_BCL2-02      ----g---cacgtggt-------------------gccgctt--------
A0A2K5HK49_BCL2-01      cccag---catgtggcctctgtttgatttctcctggctgtct--------
A0A2K6KHG1_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K6R2I6_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K5XRD4_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K5NZS5_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A0D9S017_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K5UDI5_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2K6CIX3_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A096MPU7_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
H2NWH5_BCL2-01          cccag---catgcggcctctgtttgatttctcctggctgtct--------
G3QES9_BCL2-01          cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2I3GZF9_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
A9QXG9_BCL2-01          cccag---catgcggcctctgtttgatttctcctggctgtct--------
A0A2R9APW6_BCL2-01      cccag---catgcggcctctgtttgatttctcctggctgtct--------
H2QEM8_BCL2-01          cccag---catgcggcctctgtttgatttctcctggctgtct--------
U3KEW4_BCL2-01          aacag---tatgaggcctttgttcgatttctcctggatctct--------
H0YUX3_BCL2-01          aacaa---tatgaggcctttgtttgatttctcctggatctct--------
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          aacag---tatgaggcctttgttcgatttctcctggatctct--------
Q00709_BCL2-02          aacag---tatgaggcctttgttcgatttctcctggatctct--------
G1MZW1_BCL2-01          accag---tatgaggcctttgtttgatttctcctggatctct--------
                                                                          

X4ZGI8_BCL2-01          ------ctaacgaaagtgcttggattggcagcactaggcttggcaggagt
Q564A4_BCL2-01          ------ctaacaaaagtgctcggcttggcggcgctgggcttggcaggagt
A0A1X9JZA1_BCL2-01      ------attaagacggtcttcggtgtggctgcgcttggagcagctagcct
B9ZYL7_BCL2-01          ------atcaagacaatattaagcctt---gctgtggttggagcctgcat
F7BXJ7_BCL2-01          ---------------------------------gaggatgg---------
A0A287APJ6_BCL2-01      ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
A0A0U3DHY6_BCL2-01      ------ctaaagacagtgttcggcctggccgccctgggagccgtcggagt
H9GPE7_BCL2-01          --------------------------------------------------
W5N4F7_BCL2-01          ------ttgaagactttctttggtctagctgctctgggcgcagcaggcct
F6YNL8_BCL2-01          ------ctgaagactcttctcagcctg---gctctggtgggagcttgtgt
G3WZW9_BCL2-01          -------------------tcaggtaa---gttaa---------------
G3WZW9_BCL2-02          -------------------tcggct-------------------------
K7F5Y4_BCL2-02          -------------------------ct---ggtgcagtgagcgttctc--
K7F5Y4_BCL2-01          ------ttgaagactatcctcagtctt---gctctggtgggagcttgcat
K7F5Y4_BCL2-03          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
F1LNV0_BCL2-01          ------ctgaagacgctgctcagcctg---gccctggtgggggcctgcat
P49950_BCL2-01          ------ctgaagacgctgctcagcctg---gccctggtgggggcctgcat
P10417_BCL2-02          --------------------------------------------------
P10417_BCL2-01          ------ctgaagaccctgctcagcctg---gccctggtcggggcctgcat
Q7TSN8_BCL2-01          ------ctgaagaccctgctcagcctg---gccctggtcggggcctgcat
Q6R755_BCL2-01          ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
Q9JJV8_BCL2-01          ------ctgaagaccctgctcagcctg---gccctggtcggggcctgcat
Q923R6_BCL2-01          ------ctgaanaccctgctcaacctg---gccctggtcggggcctgcat
G3ULB7_BCL2-01          ------ctgaagacactgctcagtctg---gccctggtgggagcttgcat
G3ULB7_BCL2-02          ------ttgaa---------------------------------------
F6R2C4_BCL2-01          ------ctgaaggcactgctcagtctg---gccctggtgggcgcttgcat
O02718_BCL2-01          ------ctgaaggcactgctcagtctg---gccctggtgggcgcttgcat
A0A076FU27_BCL2-01      ------ctgaaggcactgctcagtctg---gccctggtgggcgcttgcat
A0A076FZV9_BCL2-01      ------ctgaaggcactgctcagtctg---gccctggtgggcgcttgcat
G1TW27_BCL2-01          ------ctgaagactttgttcagcctg---gccctgataggagcttgcat
I3MVK9_BCL2-01          ------ttgaa---------------------------------------
M3YYK3_BCL2-01          ------caaagtgttttcctt---------------------gcttgcc-
G1LID1_BCL2-01          ------ctgaaggccctgctcagtctg---gccctggtgggagcttgcat
F7CDX6_BCL2-01          ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
A0A287APJ6_BCL2-03      ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
G1LID1_BCL2-02          ------------------------------------------gcttgaa-
M3X1R9_BCL2-01          ------ctgaaggccctgctcagtctg---gccctggtgggggcttgcat
J9NXG3_BCL2-01          ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
J9NXG3_BCL2-02          --------------------------------------------------
Q75SV7_BCL2-01          ------ctgaaggcgctgctcagtctg---gccctggtgggagcttgcat
H0WKI0_BCL2-01          ------ctgaagaccctgctcagcctg---gccctggtgggagcttgcat
A0A2K6G3I7_BCL2-01      ------ctgaagactctgctcagcctg---gccctggtgggagcttgcat
A0A1D5QRF2_BCL2-01      gggaggctgtggagccggcgaaataaa---atcagggttgttgctt----
A0A2K5EB04_BCL2-01      ------ctgaagactctgctcagcttg---gccctggtgggagcttgcat
A0A2K6UEL3_BCL2-01      ------ctgaagactctgctcagcttg---gccctggtgggagcttgcat
A0A2R8MY14_BCL2-01      ------ctgaagactctgctcagcttg---gtcctggtgggagcttgcat
A0A2K6R2I6_BCL2-02      ------cag-----------------------------------------
A0A2K5HK49_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K6KHG1_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K6R2I6_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K5XRD4_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K5NZS5_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A0D9S017_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K5UDI5_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2K6CIX3_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A096MPU7_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
H2NWH5_BCL2-01          ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
G3QES9_BCL2-01          ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2I3GZF9_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A9QXG9_BCL2-01          ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
A0A2R9APW6_BCL2-01      ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
H2QEM8_BCL2-01          ------ctgaagactctgctcagtttg---gccctggtgggagcttgcat
U3KEW4_BCL2-01          ------ctgaagactatcctgagtctg---gttctggtgggagcttgcat
H0YUX3_BCL2-01          ------ctgaagactatcctgagtctg---gttctggtgggagcttgcat
U3II49_BCL2-01          --------------------------------------------------
Q00709_BCL2-01          ------ctgaagaccatcctgagcctg---gttctggtgggagcttgcat
Q00709_BCL2-02          ------ctgaagaccatcctgagcctg---gttctggtgggagcttgcat
G1MZW1_BCL2-01          ------ctgaagaccatcctgagcctg---gttctggtgggagcttgcat
                                                                          

X4ZGI8_BCL2-01          gaccatcggagcc--tttttcgctcagaag-tga-
Q564A4_BCL2-01          gaccatcggagcc--ttttttgctcagaag-tga-
A0A1X9JZA1_BCL2-01      caccatcggagcg--taccttacacagaag-tga-
B9ZYL7_BCL2-01          cacaatagggggcatatccttggccaccaaataa-
F7BXJ7_BCL2-01          -----------------------------------
A0A287APJ6_BCL2-01      caccctgggtgcc--tatctgggccataag-tga-
A0A0U3DHY6_BCL2-01      caccatcggagcc--ttgttcacccagaag-tga-
H9GPE7_BCL2-01          -----------------------------------
W5N4F7_BCL2-01          gaccgttggagcc--tactttacacaaaaa-tga-
F6YNL8_BCL2-01          cactcttggtgcc--tacctgggacacaaa-tga-
G3WZW9_BCL2-01          -----------------------------------
G3WZW9_BCL2-02          -----------------------------------
K7F5Y4_BCL2-02          -----------------------------------
K7F5Y4_BCL2-01          cacccttggagct--tatctgggacataag-tga-
K7F5Y4_BCL2-03          -----------------------------------
H0W1T3_BCL2-01          ----gtaggtgca--tgtttgag--------tgag
F1LNV0_BCL2-01          cactctgggtgca--tacctgggccacaag-tga-
P49950_BCL2-01          cactctgggtgca--tacctgggccacaag-tga-
P10417_BCL2-02          -----taggtgca--tgtctggt---tgaa-tga-
P10417_BCL2-01          cactctgggtgca--tacctgggccacaag-tga-
Q7TSN8_BCL2-01          cactctgggtgca--tacctgggccacaag-tga-
Q6R755_BCL2-01          caccctgggtgcc--tatctgggccataag-tga-
Q9JJV8_BCL2-01          cactctgggtacc--tacctgggccacaag-tga-
Q923R6_BCL2-01          cactctgggtacc--tacctgggccacaag-tga-
G3ULB7_BCL2-01          caccctgggtgct--tacctggggcacaag-tga-
G3ULB7_BCL2-02          -----------------------------------
F6R2C4_BCL2-01          caccctgggtgcc--tatctgggccataag-tga-
O02718_BCL2-01          caccctgggtgcc--tatctgggccataag-----
A0A076FU27_BCL2-01      caccctgggtgcc--tatctgggccataag-tga-
A0A076FZV9_BCL2-01      caccctgggtgcc--tatctgggccataag-tga-
G1TW27_BCL2-01          caccctcggtgcc--tacctgggccacaag-tga-
I3MVK9_BCL2-01          -------------------------------tga-
M3YYK3_BCL2-01          -----------------------------------
G1LID1_BCL2-01          caccctgggtgcc--tacctgggccacaag-----
F7CDX6_BCL2-01          caccctgggtgcc--tatctgggccacaag-tga-
A0A287APJ6_BCL2-03      caccctgggtgcc--tatctgggccataag-tga-
G1LID1_BCL2-02          -----------------------------------
M3X1R9_BCL2-01          caccctgggtgcc--tatctgggccacaag-tga-
J9NXG3_BCL2-01          caccctgggtgcc--tatctgggccataag-tga-
J9NXG3_BCL2-02          -----------------------------------
Q75SV7_BCL2-01          caccctgggtgcc--tatctgggccataag-tga-
H0WKI0_BCL2-01          caccctgggtgcc--tacctgggccacaag-tga-
A0A2K6G3I7_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A1D5QRF2_BCL2-01      --cccggcgtccc--tacctcttcctctggataa-
A0A2K5EB04_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K6UEL3_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2R8MY14_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K6R2I6_BCL2-02      --------------------gggatgtgat-tga-
A0A2K5HK49_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K6KHG1_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K6R2I6_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K5XRD4_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K5NZS5_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A0D9S017_BCL2-01      caccctgggtgcc--tatctgggccacaag-----
A0A2K5UDI5_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A2K6CIX3_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A0A096MPU7_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
H2NWH5_BCL2-01          caccctgggtgcc--tatctgggccacaag-tga-
G3QES9_BCL2-01          caccctgggtgcc--tatctgggccacaag-tga-
A0A2I3GZF9_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
A9QXG9_BCL2-01          caccctgggtgcc--tatctgagccacaag-tga-
A0A2R9APW6_BCL2-01      caccctgggtgcc--tatctgggccacaag-tga-
H2QEM8_BCL2-01          caccctgggtgcc--tatctgggccacaag-tga-
U3KEW4_BCL2-01          cactcttggcgct--tatctcggacataag-tag-
H0YUX3_BCL2-01          cactcttggcgct--tatcttggacataag-tag-
U3II49_BCL2-01          -----------------------------------
Q00709_BCL2-01          cactcttggcgct--tatcttggacataag-tag-
Q00709_BCL2-02          cactcttggcgct--tatcttggacataag-tag-
G1MZW1_BCL2-01          cactcttggcgct--tatcttggacataag-----
                                                           

© 1998-2018