Dataset for CDS BCL-2-like of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M4A558_BCL2L1-01       atggcctacag-----caacagagaactggtggagttctacataagctac
M4AUW7_BCL2L10-01      atgtcctgtgggctgtggaaagagacc--gtgg-----------------
                       *** ***   *       * ***** *  ****                 

M4A558_BCL2L1-01       aaattgtctcagagaaac-tattcaagctctctgctgaggtccgaggttg
M4AUW7_BCL2L10-01      ---ttgttgcagaggattacatccgcctgcgctgctcaagccc-------
                          ****  ***** *    ** *     * ***** * * **       

M4A558_BCL2L1-01       ccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggc
M4AUW7_BCL2L10-01      ---------------------------acacccag--cccctccacctcc
                                                  *** ** *  ***   **    *

M4A558_BCL2L1-01       cggctggtcaacagccgggccgggcccccggggaagcccaggggcccaat
M4AUW7_BCL2L10-01      cagcgagccggccgccg---------ccatgaggcgcct---ggcccag-
                       * **  * *  * ****         **  * *  ***    ******  

M4A558_BCL2L1-01       ggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggaggagt
M4AUW7_BCL2L10-01      ----gacgtggaggcc---------------aagcaccaggc--------
                           *  ** **** *               *** **  ***        

M4A558_BCL2L1-01       ttgagcgcctctac------acccaaagcttt---aaacacctctccttg
M4AUW7_BCL2L10-01      ----tcgctttcactccctggcccagggcttcctgaagcac-------tg
                            *** *  **       ****  ****    ** ***       **

M4A558_BCL2L1-01       cagct-ggacatcacccccgacacggcctaccacagcttcaagaccgtgc
M4AUW7_BCL2L10-01      cgggtcggacct---------------ctgctccaacctcagaaaggtga
                       * * * **** *               ** *  ** * ***  *  *** 

M4A558_BCL2L1-01       tggacgagttgttcaagggcggg---gtcaactgggggcgggtggtggcc
M4AUW7_BCL2L10-01      tggatgagatggtgggggacggacactttaactgggggagggtggtgtcc
                       **** *** ** *   ** ***     * ********* ******** **

M4A558_BCL2L1-01       atgtttaccttcggggggattctg----------tgtgtggactgcgtcc
M4AUW7_BCL2L10-01      ctcttcgccttcgccggcgtgctggccagacagctgcgggaa-------c
                        * **  ******  **  * ***          ** * * *       *

M4A558_BCL2L1-01       agaagaatatgagt---gagctggtctcccgca-----------------
M4AUW7_BCL2L10-01      agacgggcaagaacccggtgccggactccgggaagcagcaggaactgcaa
                       *** *   * **     * ** ** **** * *                 

M4A558_BCL2L1-01       --------------ttgccgaatg-----gatgaccac------ttacct
M4AUW7_BCL2L10-01      caagagcccgtaagctgccgggcgctggcggagaccattgctgattacct
                                      *****   *     *  *****       ******

M4A558_BCL2L1-01       ggatgagcagctcagtccctggatccagagccagggaggatgggaccgct
M4AUW7_BCL2L10-01      ggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggt
                       ***  ****    *    **** * ***    *    ********  * *

M4A558_BCL2L1-01       ttgctaacctgtacggccaggacgccgctgcagagggccggaggtttcgg
M4AUW7_BCL2L10-01      tttgtagc---tatgcccgcaacgccagagaagcaag---------tcag
                       **  ** *   ** * **   *****   * **   *         ** *

M4A558_BCL2L1-01       gagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagc
M4AUW7_BCL2L10-01      gactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgc
                       **  ***  *  **   *  *** **** *** **   * *   *   **

M4A558_BCL2L1-01       tctgctcgtcgtgttcgtcgctaagaaacgatga
M4AUW7_BCL2L10-01      tggactcaccttcctcct------ggtgcgctag
                       *   ***  * *  ** *      *   ** *  

© 1998-2019