Dataset for CDS BCL2L1 of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5PQJ0_BCL2L1-      atgtcac---gaaacagagaactggtgcttttctacattaagtttaaact
M4A558_BCL2L1-01        atggcctacagcaacagagaactggtggagttctacataagctacaaatt
                        *** *     * ***************   ******** *  *  *** *

A0A3B5PQJ0_BCL2L1-      gtctcagaggaactatccgatccaacacatattgcccaacgagcccccgg
M4A558_BCL2L1-01        gtctcagagaaactattcaagctctctgctgaggtccgaggttgccgggg
                        ********* ****** * * *   *   *   * ** * *   **  **

A0A3B5PQJ0_BCL2L1-      acggcacc-------------gctgccggggacgtggggatggacgacga
M4A558_BCL2L1-01        gcaggaccaattgggaaggggacagccgggtccctagcaatggccggctg
                         * * ***              * ******  * * *  **** ** *  

A0A3B5PQJ0_BCL2L1-      gcagacgttagagacacacgctaatgggacttttaacgggacgagtccag
M4A558_BCL2L1-01        gtcaacagccgggccgggccc---------------ccggggaagcccag
                        *   **    * * *   * *               * **   ** ****

A0A3B5PQJ0_BCL2L1-      gatcccctaggcggcaccaggcggcgtcggcgtcaacgatggacgcggtg
M4A558_BCL2L1-01        gggcccaatggc---------cggtgttgaggtc-------------gtc
                        *  ***   ***         *** ** *  ***             ** 

A0A3B5PQJ0_BCL2L1-      aaagtggccctgcgcgacacggcccgtgagtttgagctgcgctactcccg
M4A558_BCL2L1-01        aaatcagttctgaaggacgcggcggaggagtttgagcgcctctacaccca
                        ***   *  ***   *** ****    **********  * **** *** 

A0A3B5PQJ0_BCL2L1-      cgccttcaacgacct-tcacagcacgctgcacatcacaccggccaccgcc
M4A558_BCL2L1-01        aagctttaaacacctctccttgca-gctggacatcacccccgacacggcc
                           *** **  **** **   *** **** ******* ** * *** ***

A0A3B5PQJ0_BCL2L1-      taccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaa
M4A558_BCL2L1-01        taccacagcttcaagaccgtgctggacgagttgttcaagggcggggtcaa
                        ***** ****** *** **** ******** *****  ** *** *****

A0A3B5PQJ0_BCL2L1-      ctggggccgcatcgtggggctcttcgcgtttggtggcgcgctgtgcgtgg
M4A558_BCL2L1-01        ctgggggcgggtggtggccatgtttaccttcggggggattctgtgtgtgg
                        ****** **  * ****   * **  * ** ** **    ***** ****

A0A3B5PQJ0_BCL2L1-      agtgcgtggagaaggagatgagccacctggtagccaggattgtagagtgg
M4A558_BCL2L1-01        actgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatgg
                        * *****  ***** * *****  * *****  ** * ****  ** ***

A0A3B5PQJ0_BCL2L1-      atgaccgtctacctggatgagcagattgaaccttgggtagaaagccaagg
M4A558_BCL2L1-01        atgaccacttacctggatgagcagctcagtccctggatccagagccaggg
                        ******   *************** *    ** *** *  * ***** **

A0A3B5PQJ0_BCL2L1-      aggatgggagcgcttcgctgagatcttcgggggcaacgcggcggcagaga
M4A558_BCL2L1-01        aggatgggaccgctttgctaacctgtacggccaggacgccgctgcagagg
                        ********* ***** *** *  * * ***     **** ** ****** 

A0A3B5PQJ0_BCL2L1-      gcagaagatctcaggagagcttcaaaaactggctgctgctggggatgagc
M4A558_BCL2L1-01        gccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggct
                        ** * ** * ** ***** *** ** ** ********  * **  **   

A0A3B5PQJ0_BCL2L1-      gtggtgac---ggccttcatagccgggtccatcttcgcccagaagcgcct
M4A558_BCL2L1-01        ctgctgaccggagctctgctcgtcgtgt---tcgtcgctaagaaacg---
                         ** ****    **  *  * * ** **   ** ****  **** **   

A0A3B5PQJ0_BCL2L1-      gtga
M4A558_BCL2L1-01        atga
                         ***

© 1998-2019