Dataset for CDS BCL2L1 of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M4A558_BCL2L1-01      ------atggcctacagcaacagagaactggtggagttctacataagcta
M4AQF9_BCL2L1-01      caaaaaatgtcac---gaaacagagaactggtgcttttctacattaagtt
                            *** *     * ***************   ******** *  * 

M4A558_BCL2L1-01      caaattgtctcagagaaactattcaagctctctgctgaggtccgaggttg
M4AQF9_BCL2L1-01      taaactgtctcagaggaactatccgatccaacacatattgcccaacgagc
                       *** ********** ****** * * *   *   *   * ** * *   

M4A558_BCL2L1-01      ccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggc
M4AQF9_BCL2L1-01      ccccggacggcacc-------------gctgccggggacgtggggatgga
                      **  ** * * ***              * ******  * * *  **** 

M4A558_BCL2L1-01      cggctggtcaacagccgggccgggccc---------------ccggggaa
M4AQF9_BCL2L1-01      cgacgagcagacgttagagacacacgctaatgggacttttaacgggacga
                      ** *  *   **    * * *   * *               * **   *

M4A558_BCL2L1-01      gcccaggggcccaatggc---------cggtgttgaggtc----------
M4AQF9_BCL2L1-01      gtccaggatcccctaggcggcaccaggcggcgtcggcgtcaacgatggac
                      * *****  ***   ***         *** ** *  ***          

M4A558_BCL2L1-01      ---gtcaaatcagttctgaaggacgcggcggaggagtttgagcgcctcta
M4AQF9_BCL2L1-01      gcggtgaaagtggccctgcgcgacacggcccgtgagtttgagctgcgcta
                         ** ***   *  ***   *** ****    **********  * ***

M4A558_BCL2L1-01      cacccaaagctttaaacacctctccttgca-gctggacatcacccccgac
M4AQF9_BCL2L1-01      ctcccgcgccttcaacgacct-tcacagcacgctgcacatcacaccggcc
                      * ***    *** **  **** **   *** **** ******* ** * *

M4A558_BCL2L1-01      acggcctaccacagcttcaagaccgtgctggacgagttgttcaagggcgg
M4AQF9_BCL2L1-01      accgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacgg
                      ** ******** ****** *** **** ******** *****  ** ***

M4A558_BCL2L1-01      ggtcaactgggggcgggtggtggccatgtttaccttcggggggattctgt
M4AQF9_BCL2L1-01      cgtcaactggggccgcatcgtggggctcttcgcgtttggtggcgcgctgt
                       *********** **  * ****   * **  * ** ** **    ****

M4A558_BCL2L1-01      gtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgcc
M4AQF9_BCL2L1-01      gcgtggagtgcgtggagaaggagatgagccacctggtagccaggattgta
                      * ***** *****  ***** * *****  * *****  ** * ****  

M4A558_BCL2L1-01      gaatggatgaccacttacctggatgagcagctcagtccctggatccagag
M4AQF9_BCL2L1-01      gagtggatgaccgtctacctggatgagcagattgaaccttgggtagaaag
                      ** *********   *************** *    ** *** *  * **

M4A558_BCL2L1-01      ccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctg
M4AQF9_BCL2L1-01      ccaaggaggatgg------------------------ctgaagactgctg
                      *** *********                        * * *  * ****

M4A558_BCL2L1-01      cagagggccggaggtttcgggagaccttgaacaaatggctgctagttggt
M4AQF9_BCL2L1-01      t---------------------tatatttaaccaaggaatgagaataga-
                                             *  ** *** ** *  **  * * *  

M4A558_BCL2L1-01      gtggctctgctgaccggagctctgctcgtcgtgttcgtcgctaagaaacg
M4AQF9_BCL2L1-01      -----------aaccagaaattggcatg----------agccagacaagc
                                  *** **  *  **  *           ** *   **  

M4A558_BCL2L1-01      atga
M4AQF9_BCL2L1-01      gt--
                       *  

© 1998-2018