Dataset for CDS BCL-2-like of organism Xiphophorus couchianus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5MGS2_BCL2L1-      atggcctacag-----caacagagaactggtggagttctacataagctac
A0A3B5MJ12_BCL2L10      atgtcctgtgggctgtggaaagagacc--gtgg-----------------
                        *** ***   *       * ***** *  ****                 

A0A3B5MGS2_BCL2L1-      aaattgtctcagagaaac-tattcaagctctctgctgaggtccgaggttg
A0A3B5MJ12_BCL2L10      ---ttgttgcagaggattacatccgcctgcgctgctcaagccc-------
                           ****  ***** *    ** *     * ***** * * **       

A0A3B5MGS2_BCL2L1-      ccgggggcaggaccaattgggaaggggacagccgggtccctcgcaatggc
A0A3B5MJ12_BCL2L10      ---------------------------acacccagcccctccac------
                                                   *** ** *  **  * *      

A0A3B5MGS2_BCL2L1-      ccgctggtcaacagctgggccgggcacccggggaaacccaggggccctcc
A0A3B5MJ12_BCL2L10      -------ctcccagc-gagccggccgcc--------gccatgaggcgcct
                                   **** * ***** * **         *** * * *  * 

A0A3B5MGS2_BCL2L1-      ggcc---ggcgtcgaggtcgtcaaatcggttctgaaggacgcggcggagg
A0A3B5MJ12_BCL2L10      ggcccaggacgtggaggcc---------------aagcaccaggc-----
                        ****   * *** **** *               *** **  ***     

A0A3B5MGS2_BCL2L1-      agtttgagcgcctctac------acccaaagcttt---aaacacctctcc
A0A3B5MJ12_BCL2L10      -------tcgctttcactccctggcccagggcttcctgaagcac------
                                *** *  **       ****  ****    ** ***      

A0A3B5MGS2_BCL2L1-      ttgcagct-ggacatcacccccgacacggcctaccacagcttcaagaccg
A0A3B5MJ12_BCL2L10      -tgcgggtcggacct---------------ctgctccaacctcagaaagg
                         *** * * **** *               ** *  ** * ***  *  *

A0A3B5MGS2_BCL2L1-      tgctggacgagttgttcaagggcggg---gtcaactgggggcgggtggtg
A0A3B5MJ12_BCL2L10      tgatggatgagatggtgggggacggacactttaactgggggagggtggtg
                        ** **** *** ** *   ** ***     * ********* ********

A0A3B5MGS2_BCL2L1-      gccatgtttaccttcggggggattctg----------tgtgtggactgcg
A0A3B5MJ12_BCL2L10      tccctcttcgccttcgccggcgtgctggccagacagctgcgggaa-----
                         ** * **  ******  **  * ***          ** * * *     

A0A3B5MGS2_BCL2L1-      tccagaagaatatgagt---gagctggtctcccgca--------------
A0A3B5MJ12_BCL2L10      --cagacgggcaagaacccggtgccggactccgggaagcagcaggaactg
                          **** *   * **     * ** ** **** * *              

A0A3B5MGS2_BCL2L1-      -----------------ttgccgaatg-----gatgaccac------tta
A0A3B5MJ12_BCL2L10      caacaagagcccgtaagctgccgggcgctggcggagaccattgctgatta
                                          *****   *     *  *****       ***

A0A3B5MGS2_BCL2L1-      cctggacgagcagctcagtccctggatccagagccagggaggatgggacc
A0A3B5MJ12_BCL2L10      cctggagaagcacaaaaaggactggctacaggaaaataatggatgggaag
                        ******  ****    *    **** * ***    *    ********  

A0A3B5MGS2_BCL2L1-      gctttgctaacctgtacggccaggacgccgctgcagagggccggaggttt
A0A3B5MJ12_BCL2L10      ggttttgtagc---tatgcccgcaacgccagagaagcaag---------t
                        * ***  ** *   ** * **   *****   * **   *         *

A0A3B5MGS2_BCL2L1-      cgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccgg
A0A3B5MJ12_BCL2L10      caggactcctccatgaagacggcgctggttgctgtcgccggggtcggcat
                        * ***  ***  *  **   *  *** **** *** **   * *   *  

A0A3B5MGS2_BCL2L1-      agctctgctcgtcgtgttcgtcgctaagaaacgatga
A0A3B5MJ12_BCL2L10      cgctggactcaccttcctcct------ggtgcgctag
                         ***   ***  * *  ** *      *   ** *  

© 1998-2019