Dataset for CDS BCL-2-like of organism Xenopus tropicalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6TEC3_BCL2L2-01      cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagca
Q5XGJ4_BCL2L2-01      --------------------------------------------------
F7BXJ7_BCL2-01        -------------------------------------atggctcatccta
F7ETY1_MCL1-01        -------------------------------------atgatgcgc--ca
Q6GLI5_BCL2L1-01      -------------------------------------atggagggcagca
                                                                        

F6TEC3_BCL2L2-01      tgcga-------cgggaaatatcatcttccgggggagccccgataagtac
Q5XGJ4_BCL2L2-01      --------------------------------------------------
F7BXJ7_BCL2-01        ggaga--------ggaggctatgatcacc---------------------
F7ETY1_MCL1-01        gtcgg----------------tcattgcc---------------------
Q6GLI5_BCL2L1-01      gtagagatctggtggagaagtttgtttgc---------------------
                                                                        

F6TEC3_BCL2L2-01      ctgacggagcaaggctggatggcgcaatctgaactaggatcc----cggg
Q5XGJ4_BCL2L2-01      ------------------atggcgcaatctgaactaggatcc----cggg
F7BXJ7_BCL2-01        ------------------gggacatagtggtaaaatatatccattataaa
F7ETY1_MCL1-01        ------------------aagcagc------------gtacctctgcggg
Q6GLI5_BCL2L1-01      ------------------aagaaactgtcccagaaaggagcctgcgggga
                                          *                   **        

F6TEC3_BCL2L2-01      ctttggtagag--------------------------------gattttg
Q5XGJ4_BCL2L2-01      ctttggtagag--------------------------------gattttg
F7BXJ7_BCL2-01        ctgtctcaaaag-------------------------------gggtatg
F7ETY1_MCL1-01        cttcctcatcccctgccagttctactgctcgggtggcggcggcgggaacg
Q6GLI5_BCL2L1-01      gttctccagcaactcccagcccaa-------------------gggcgtg
                       *     *                                   *     *

F6TEC3_BCL2L2-01      tgcgatacaagtt-----atgccagcgtagtctagttccggagcctgcag
Q5XGJ4_BCL2L2-01      tgcgatacaagtt-----atgccagcgtagtctagttccggagcctgcag
F7BXJ7_BCL2-01        aatgggaagag-----gggcggcagcaggtctctgctgagca--------
F7ETY1_MCL1-01        cctcagagaaggcagtgaatgaccgaggggcttctccgtgggacgccgat
Q6GLI5_BCL2L1-01      tctaatggaagtt--cggagggccccggggccacacagggcattgtgggg
                               **         * *                *          

F6TEC3_BCL2L2-01      gagcagcatcctgttctttgcattcagccatgcgtgctgcag-gggatga
Q5XGJ4_BCL2L2-01      gagcagcatcctgttctttgcattcagccatgcgtgctgcag-gggatga
F7BXJ7_BCL2-01        -------------ccctcaagcttctgctgc-----------------ta
F7ETY1_MCL1-01        atggag------gcgcatagggataagctggacaggccgcagctgaatgg
Q6GLI5_BCL2L1-01      gaggaa------gtccttcaggcgctgctggacgcgtcggag------ga
                                     *          **                      

F6TEC3_BCL2L2-01      atttgaagagagattcagacaagcattcagtgagatctccac--------
Q5XGJ4_BCL2L2-01      atttgaagagagattcagacaagcattcagtgagatctccac--------
F7BXJ7_BCL2-01        ttagtaattattctgatgatgga-----gaaatgcctgctgcttcc----
F7ETY1_MCL1-01        cttcgggtt----taacagtggg-----gggagccttactgcctcccagg
Q6GLI5_BCL2L1-01      gtttgagttgagataccagcgtgccttcagcgacctgaccgcc-------
                       *           *                        *  *        

F6TEC3_BCL2L2-01      ----------------acagatccatgtgaccc-----------------
Q5XGJ4_BCL2L2-01      ----------------acagatccatgtgaccc-----------------
F7BXJ7_BCL2-01        ----------------gcagattcacgtggaccacctcaatcttcactcg
F7ETY1_MCL1-01        agggagaattggatgaggatattgatggcggctcccagggttctagctcc
Q6GLI5_BCL2L1-01      ----------------------------cagctgc----------acctc
                                                     *                  

F6TEC3_BCL2L2-01      -------------ctg-----------------------------gcaca
Q5XGJ4_BCL2L2-01      -------------ctg-----------------------------gcaca
F7BXJ7_BCL2-01        catctg-------ctg-----------------------ctgcttcctca
F7ETY1_MCL1-01        cccccggacagccctgtgtgcccgaaggatggattatatatggacaccca
Q6GLI5_BCL2L1-01      acccaggaca---ctg------------------------------ccca
                                   ***                              * **

F6TEC3_BCL2L2-01      gca------tatgcacgctttgcagaagtagcaggtagcctgttccaagg
Q5XGJ4_BCL2L2-01      gca------tatgcacgctttgcagaagtagcaggtagcctgttccaagg
F7BXJ7_BCL2-01        gcagctatgcagccggtccctccagcagtg-----------ctaca----
F7ETY1_MCL1-01        gcagctcatcctggctttcttccggggata-----------ctgcgggga
Q6GLI5_BCL2L1-01      gcaaagcttccagcaggtggtgggggagtt-----------gttcaggga
                      ***                 *   *   *             * *     

F6TEC3_BCL2L2-01      tggggtgaattggggtcgtatagttgcattttttgttttt----------
Q5XGJ4_BCL2L2-01      tggggtgaattggggtcgtatagttgcattttttgttttt----------
F7BXJ7_BCL2-01        -gaccttaagtcgagctgg--agatgagttctctcgcctctatc------
F7ETY1_MCL1-01        ggaaacca------gcggcttaaaggcctccttcctcctccatcatggcg
Q6GLI5_BCL2L1-01      cggcaccaactggggcagaatcgtggccttcttctccttt-----gggcg
                       *     *      *  *       *  *  *      *           

F6TEC3_BCL2L2-01      -----------------ggtgccgcactgtgtgctgagagtgtcaacaag
Q5XGJ4_BCL2L2-01      -----------------ggtgccgcactgtgtgctgagagtgtcaacaag
F7BXJ7_BCL2-01        ------------------------------------agcaagattttaga
F7ETY1_MCL1-01        cccaccccaaggccctggagaccctgcagcgggtcgggggagacattata
Q6GLI5_BCL2L1-01      ----------ggccct------------gtgcgtggagagtgccaacaag
                                                           *   *     *  

F6TEC3_BCL2L2-01      gaga---------------tgtcccctcttctgccacgg------attca
Q5XGJ4_BCL2L2-01      gaga---------------tgtcccctcttctgccacgg------attca
F7BXJ7_BCL2-01        caga---------------tctcagggctcctccattta-accccatcca
F7ETY1_MCL1-01        gagaagcaccatatggcctttactggcatgctgcaaaggttgtctataca
Q6GLI5_BCL2L1-01      gaga---------------tgactgagctgctccccagg----------a
                       ***               *  *     * ** *               *

F6TEC3_BCL2L2-01      -----ggactggatggtgacatatct----ggagacaaacctgagagact
Q5XGJ4_BCL2L2-01      -----ggactggatggtgacatatct----ggagacaaacctgagagact
F7BXJ7_BCL2-01        cagttagggtgcgctttgcaacagtagt--ggag--------gagctctt
F7ETY1_MCL1-01        tag-tagagaggac-ttgcagaaactttccgaagttcccgctttggtctt
Q6GLI5_BCL2L1-01      tcg-tgcaatggatggtgcagtacct----ggagcatacgctgcagccct
                                *     **    *       * **               *

F6TEC3_BCL2L2-01      ggattcagagc-----aatggaggctggaatgg----atttctaactcta
Q5XGJ4_BCL2L2-01      ggattcagagc-----aatggaggctggaatgg----atttctaactcta
F7BXJ7_BCL2-01        tcatgatggggtc---aactggggaaggattgttgcttttttcgagtttg
F7ETY1_MCL1-01        taatgatggagttacaaactggggccggattgttaccgtcataagctttg
Q6GLI5_BCL2L1-01      ggatgctggag-----aacggaggctggg-------------aagctttt
                        **   *        **  * **  **                  * * 

F6TEC3_BCL2L2-01      tatggggatggtgccatagaagaggccaggaggcagcg----tgagggga
Q5XGJ4_BCL2L2-01      tatggggatggtgccatagaagaggccaggaggcagcg----tgagggga
F7BXJ7_BCL2-01        gtggggtcatgtgcgtggaaag--------------------tgtta---
F7ETY1_MCL1-01        gtgcg----tttgt-tgcaaagcatctaaagagcatagaccttgaag---
Q6GLI5_BCL2L1-01      gtcgg----tctgtacggaaag-------ggagc--------tgccg---
                          *      **      ***                    **      

F6TEC3_BCL2L2-01      attgggcatcactgaagactgtcttaactggagcagtagctctgggtgct
Q5XGJ4_BCL2L2-01      attgggcatcactgaagactgtcttaactggagcagtagctctgggtgct
F7BXJ7_BCL2-01        ----------atcgagaaatgtctcctctggtggattccattgtgggtt-
F7ETY1_MCL1-01        ----------actgtatcatggctttggcggagcacttcacactattcc-
Q6GLI5_BCL2L1-01      ----------cccagagcagggaagggccggagcggtttggccggtggc-
                                          *        ** *   *             

F6TEC3_BCL2L2-01      ttaatgac------------------------------------------
Q5XGJ4_BCL2L2-01      ttaatgac------------------------------------------
F7BXJ7_BCL2-01        -ggatgac------------------------------------------
F7ETY1_MCL1-01        -taatgacaagcaaaaaagactggataatccaggaaaagggatgggaggg
Q6GLI5_BCL2L1-01      -taatggc------------------------------------------
                         *** *                                          

F6TEC3_BCL2L2-01      ------------------agtag---------------------gagcct
Q5XGJ4_BCL2L2-01      ------------------agtag---------------------gagcct
F7BXJ7_BCL2-01        ---------------------agagtacctaaacagtcacttgcaaa---
F7ETY1_MCL1-01        ctttgtggacttttttcacatagaagactatgaaagtggactcagaactg
Q6GLI5_BCL2L1-01      ------------------catag-tgactgtgactgctgc-----aacct
                                           **                      *    

F6TEC3_BCL2L2-01      tgtttgcc-----------------------------------agca---
Q5XGJ4_BCL2L2-01      tgtttgcc-----------------------------------agca---
F7BXJ7_BCL2-01        -attggatccaggaacag-------------------------ggag---
F7ETY1_MCL1-01        ttttgatggctttctcaagtgttgcggttcttggggctggcttggcgttc
Q6GLI5_BCL2L1-01      tattggtctcctacctga-------------------------ggcgt--
                        **                                        *     

F6TEC3_BCL2L2-01      -------agtga
Q5XGJ4_BCL2L2-01      -------agtga
F7BXJ7_BCL2-01        -------gatgg
F7ETY1_MCL1-01        atgatccggtga
Q6GLI5_BCL2L1-01      ------cgatag
                               *  

© 1998-2018