Dataset for CDS BCL2L2 of organism Xenopus tropicalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6TEC3_BCL2L2-01      cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagca
Q5XGJ4_BCL2L2-01      --------------------------------------------------
                                                                        

F6TEC3_BCL2L2-01      tgcgacgggaaatatcatcttccgggggagccccgataagtacctgacgg
Q5XGJ4_BCL2L2-01      --------------------------------------------------
                                                                        

F6TEC3_BCL2L2-01      agcaaggctggatggcgcaatctgaactaggatcccgggctttggtagag
Q5XGJ4_BCL2L2-01      -----------atggcgcaatctgaactaggatcccgggctttggtagag
                                 ***************************************

F6TEC3_BCL2L2-01      gattttgtgcgatacaagttatgccagcgtagtctagttccggagcctgc
Q5XGJ4_BCL2L2-01      gattttgtgcgatacaagttatgccagcgtagtctagttccggagcctgc
                      **************************************************

F6TEC3_BCL2L2-01      aggagcagcatcctgttctttgcattcagccatgcgtgctgcaggggatg
Q5XGJ4_BCL2L2-01      aggagcagcatcctgttctttgcattcagccatgcgtgctgcaggggatg
                      **************************************************

F6TEC3_BCL2L2-01      aatttgaagagagattcagacaagcattcagtgagatctccacacagatc
Q5XGJ4_BCL2L2-01      aatttgaagagagattcagacaagcattcagtgagatctccacacagatc
                      **************************************************

F6TEC3_BCL2L2-01      catgtgacccctggcacagcatatgcacgctttgcagaagtagcaggtag
Q5XGJ4_BCL2L2-01      catgtgacccctggcacagcatatgcacgctttgcagaagtagcaggtag
                      **************************************************

F6TEC3_BCL2L2-01      cctgttccaaggtggggtgaattggggtcgtatagttgcattttttgttt
Q5XGJ4_BCL2L2-01      cctgttccaaggtggggtgaattggggtcgtatagttgcattttttgttt
                      **************************************************

F6TEC3_BCL2L2-01      ttggtgccgcactgtgtgctgagagtgtcaacaaggagatgtcccctctt
Q5XGJ4_BCL2L2-01      ttggtgccgcactgtgtgctgagagtgtcaacaaggagatgtcccctctt
                      **************************************************

F6TEC3_BCL2L2-01      ctgccacggattcaggactggatggtgacatatctggagacaaacctgag
Q5XGJ4_BCL2L2-01      ctgccacggattcaggactggatggtgacatatctggagacaaacctgag
                      **************************************************

F6TEC3_BCL2L2-01      agactggattcagagcaatggaggctggaatggatttctaactctatatg
Q5XGJ4_BCL2L2-01      agactggattcagagcaatggaggctggaatggatttctaactctatatg
                      **************************************************

F6TEC3_BCL2L2-01      gggatggtgccatagaagaggccaggaggcagcgtgaggggaattgggca
Q5XGJ4_BCL2L2-01      gggatggtgccatagaagaggccaggaggcagcgtgaggggaattgggca
                      **************************************************

F6TEC3_BCL2L2-01      tcactgaagactgtcttaactggagcagtagctctgggtgctttaatgac
Q5XGJ4_BCL2L2-01      tcactgaagactgtcttaactggagcagtagctctgggtgctttaatgac
                      **************************************************

F6TEC3_BCL2L2-01      agtaggagccttgtttgccagcaagtga
Q5XGJ4_BCL2L2-01      agtaggagccttgtttgccagcaagtga
                      ****************************

© 1998-2018