Dataset for CDS BCL2A1 of organism Ursus maritimus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452U2H8_BCL2A1-      atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccc
A0A452U2H8_BCL2A1-      atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccc
                        **************************************************

A0A452U2H8_BCL2A1-      cagccccgccggcgctcgcctcatttggccnnnnnnnnnnnnnnnnnnnn
A0A452U2H8_BCL2A1-      cagccccgccggcgctcgcctcatttggccnnnnnnnnnnnnnnnnnnnn
                        **************************************************

A0A452U2H8_BCL2A1-      nnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacacc
A0A452U2H8_BCL2A1-      nnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacacc
                        **************************************************

A0A452U2H8_BCL2A1-      ctgacgctggcccaggactacgtgaagcacgtcctgcagatcccgcagcc
A0A452U2H8_BCL2A1-      ctgacgctggcccaggactacgtgaagcacgtcctgcagatcccgcagcc
                        **************************************************

A0A452U2H8_BCL2A1-      gggctcagccccgagcagggcgtcccaggtgctgcgggacgtggcctcct
A0A452U2H8_BCL2A1-      gggctcagccccgagcagggcgtcccaggtgctgcgggacgtggcctcct
                        **************************************************

A0A452U2H8_BCL2A1-      ccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttc
A0A452U2H8_BCL2A1-      ccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttc
                        **************************************************

A0A452U2H8_BCL2A1-      gatgtggtgtccgtcgactccgccagaaccatattcaatcaggtcatgga
A0A452U2H8_BCL2A1-      gatgtggtgtccgtcgactccgccagaaccatattcaatcaggtcatgga
                        **************************************************

A0A452U2H8_BCL2A1-      aaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
A0A452U2H8_BCL2A1-      aaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
                        **************************************************

A0A452U2H8_BCL2A1-      ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctcc
A0A452U2H8_BCL2A1-      ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctcc
                        **************************************************

A0A452U2H8_BCL2A1-      ccggatgtggacgcttctaggatttcttacttcgtggcggagttcatcac
A0A452U2H8_BCL2A1-      ccggatgtggacgcttctaggatttcttacttcgtggcggagttcatcac
                        **************************************************

A0A452U2H8_BCL2A1-      gacaaacatgagagagtggataaggcagaacggaggctggtccctcctcc
A0A452U2H8_BCL2A1-      gacaaacatgagagagtggataaggcagaacggaggctggg---------
                        ****************************************          

A0A452U2H8_BCL2A1-      cgccctctgccagtgtgaagggctgcaagcggagggc-------------
A0A452U2H8_BCL2A1-      ---aagatggctttgtaaagaagttcgaacccaagtctggctggctgact
                               ** *  *** ***   * * * *  * * *             

A0A452U2H8_BCL2A1-      -ccccggcaggtctgagaggagagctgc----tgccaccttttcagctgg
A0A452U2H8_BCL2A1-      tttctggaagttatg-gggaagatctgtgaaatgttctctctcctgaag-
                           * ** ** * ** * * *** ***     **    ** * * *  * 

A0A452U2H8_BCL2A1-      ctccagcgttcgtgagtag
A0A452U2H8_BCL2A1-      ---caatactactga----
                           **    *  ***    

© 1998-2019