Dataset for CDS BCL-2-like of organism Tetraodon nigroviridis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H3CH49_BCL2L1-01      -cgaa-gtcaccccggagcaaagt-caaaaggcgcatctacgcagaggat
Q4SW32_MCL1-01        atgagcgttatcgcgaaccgcaccgcgatagaca---ccatgaatgttat
                        **  ** * * ** * *  *   * * ** *    * * * *    **

H3CH49_BCL2L1-01      gtctctaaacagag-------aactggtcattttctacattaaat----a
Q4SW32_MCL1-01        gtttcaaaatggagtcggggacgcggatctttcttcctcgcagatcccga
                      ** ** ***  ***         * * ** ** *       * **    *

H3CH49_BCL2L1-01      caaactttcccaaagaaact----------------------accctttg
Q4SW32_MCL1-01        tgggctctcccagggacgctttcaacgggaacgtcggcgacagcccgaag
                          ** *****  **  **                       ***   *

H3CH49_BCL2L1-01      agtcaca-----------------------------------ttgtagag
Q4SW32_MCL1-01        cggcccagcaagctgacggtggtcaaacccaaggtctgcctgtcgaagac
                       * * **                                   * * *** 

H3CH49_BCL2L1-01      ccttcaagtaggactg-aagggcagtttggaaccacccagtccaatggaa
Q4SW32_MCL1-01        cattcagg-aggacagcgaggacggctcg---ctgccgtgtacgccggag
                      * **** * ***** *  *** * * * *   *  **  ** *   *** 

H3CH49_BCL2L1-01      cttttaatggggcaa-gtcctggaacccccccagcacc------------
Q4SW32_MCL1-01        -tcgcactcgggcgacgtgctggacgtgtccgggcgtccggcgggggacg
                       *   * * **** * ** *****     **  **  *            

H3CH49_BCL2L1-01      ------ctcccagcaccagca----gtcattgacaagtc---------tg
Q4SW32_MCL1-01        aggcggctctcgacagcgacacgaggcagctggtgagccgtttaatggcg
                            *** *  ** *  **    *    **   ** *          *

H3CH49_BCL2L1-01      gacg--------------------cagtcaaggaagccctccgggacacc
Q4SW32_MCL1-01        gacgttaccggcatcagcagagcccagtggagggaga---gcagagcgct
                      ****                    ****  *** **     * *  * * 

H3CH49_BCL2L1-01      ggcaatga--atttgagctgcggtacacctg-----------------cg
Q4SW32_MCL1-01        ggcgacgacgaagcgagtggtgggagacctgatggagaagcaccgataca
                      *** * **  *   ***  * ** * *****                 * 

H3CH49_BCL2L1-01      cgttcagtgacctgcacaaccagctccacat-------cacgccagccac
Q4SW32_MCL1-01        cgtacagaggtatgatcaacaaattgttcatggaggaccgagtaggcgac
                      *** *** *   **  **** *  *   ***       *  *   ** **

H3CH49_BCL2L1-01      ggcttaccaaagttttgagaacgttatggatgag---gtgtttcgggatg
Q4SW32_MCL1-01        gt-------gagctttgtcggcgccgtggctaagagcacgttcgaggacg
                      *         ** ****    **   *** * **     ***   *** *

H3CH49_BCL2L1-01      ga---gtcaactgggggcggatagtgggcctttttgccttcg-----gtg
Q4SW32_MCL1-01        ggaacaccaactggggtcgcgtggccagcctgctggccttcgcagccgtg
                      *      ********* **  * *   ****  * *******     ***

H3CH49_BCL2L1-01      gt-gccctgtgtgt------------------ggagtgtgtggagaagga
Q4SW32_MCL1-01        gtggcccagtacttgaacgaccacggtcagagggactgcgtggagcaggt
                      ** **** **   *                  *** ** ****** *** 

H3CH49_BCL2L1-01      g----atgaatcctctggttggccggatcatagagtggatgacggtctat
Q4SW32_MCL1-01        ggcccaggaaatctccacctacctgt-------------tgacggaccag
                      *    * ***  ***    *  * *              ****** * * 

H3CH49_BCL2L1-01      -----ctggacaaccacatccagccctggatccagagtcaaggaggatgg
Q4SW32_MCL1-01        cgcgactggctgatcaaaaacaacgcc--------------------tgg
                           ****   * ** *  ** * *                     ***

H3CH49_BCL2L1-01      gaacgttttgctgaactcttc---gggcaggacgcggctgcagaaagccg
Q4SW32_MCL1-01        gacggatttgtggagtttttccaagtgccggacccgg--------agtcg
                      **  * ****  **  * ***   * ** **** ***        ** **

H3CH49_BCL2L1-01      caggtcccaggagcgattccgaaacgggctgtt--tctgggcatgagtct
Q4SW32_MCL1-01        acgg-------------tccggaccgtgctgatggccgtggcaggagt--
                        **             **** * ** **** *   *  **** ****  

H3CH49_BCL2L1-01      ggcggcagggatc-gccctcggct--ccttcatcgtcatgagg
Q4SW32_MCL1-01        ---ggctgggatcggcgccaagctggcgctgctgatcaggtga
                         *** ****** ** *   ***  *  *  *  *** * * 

© 1998-2019