Dataset for CDS BCL-2-like of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2RNY4_MCL1-01        gacagcccgaagcggcccagcaagctctccgtgatcgcacccaaggtttg
H2U5I3_BCL2L1-01      ---atgtcgtataacaacagagagctggtggagcac----------ttct
H2U5I3_BCL2L1-02      ---atgtcgtataacaacagagagctggtggagcac----------ttct
H2SNZ9_BCL2L1-02      -------c---ttgaaacagca----------------------------
H2SNZ9_BCL2L1-01      ---atgtc---tcaaaacagagaactggtcattttc----------tata
H2SNZ9_BCL2L1-03      ---atgtc---tcaaaacagagaactggtcattttc----------tata
                             *         ***                              

H2RNY4_MCL1-01        cgtggcgaaggccatccaggaggacagccaggacaccgaccaccggtcgg
H2U5I3_BCL2L1-01      taagatacaagctgtctcagagga-----actaccc----aacttctctg
H2U5I3_BCL2L1-02      taagatacaagctgtctcagagga-----actaccc----aacttctctg
H2SNZ9_BCL2L1-02      --------aggcttgaccaagaca-----a----------gagcagaatc
H2SNZ9_BCL2L1-01      ttaagtacaaactctcccaaagaa-----attaccctttcaatcacaatg
H2SNZ9_BCL2L1-03      ttaagtacaaactctcccaaagaa-----attaccctttcaatcacaatg
                              *  *           *     *           *        

H2RNY4_MCL1-01        cgccgtgtacgccggag-------atgaactcggtgaacgggttgga---
H2U5I3_BCL2L1-01      --ctg---agaccagag---------gatactgatggaaggacagaggga
H2U5I3_BCL2L1-02      --ctg---agaccagag---------gatactgatgga------------
H2SNZ9_BCL2L1-02      acccc---agagcaaag--tcaaaaagcgactgatggg------------
H2SNZ9_BCL2L1-01      gactc---atattagagcctccaagtaggactgatggg------------
H2SNZ9_BCL2L1-03      gactc---atattagagcctccaa--------------------------
                        *     *      **                                 

H2RNY4_MCL1-01        ---------cgtgtccgggcgcccagcggaggacgaggcggcgttagaca
H2U5I3_BCL2L1-01      gaaaagaggagccccggtgcttccaatggcctgctggtccgcagcaggaa
H2U5I3_BCL2L1-02      ---------------------------------------------aggaa
H2SNZ9_BCL2L1-02      ---------cagtttgtaactactcagttcaatggaacttttaatggtgc
H2SNZ9_BCL2L1-01      ---------cagtttgtaactactcagttcaatggaacttttaatggtgc
H2SNZ9_BCL2L1-03      --------------------------------------------------
                                                                        

H2RNY4_MCL1-01        acgacacgaggcagctcc----tcagctgcttcatggcggacttttgcgg
H2U5I3_BCL2L1-01      caggggtggagcgtctccatccgcaggtgct-----------------gg
H2U5I3_BCL2L1-02      caggggtggagcgtctccatccgcaggtgct-----------------gg
H2SNZ9_BCL2L1-02      aagccctggaacacccccagcaacaagt-ct-----------------gg
H2SNZ9_BCL2L1-01      aagccctggaacacccccagcaacaagt-ct-----------------gg
H2SNZ9_BCL2L1-03      --------------------------------------------------
                                                                        

H2RNY4_MCL1-01        catcggttcacatcagtggagggagagcggagcgctgtcgaccatgaagc
H2U5I3_BCL2L1-01      cataga-----ggctg-------tgaacgcagctcttcgggactcg----
H2U5I3_BCL2L1-02      cataga-----ggctg-------tgaacgcagctcttcgggactcg----
H2SNZ9_BCL2L1-02      caacaa-----gtctggatacagtaaaggaagccctccgggacaca----
H2SNZ9_BCL2L1-01      caacaa-----gtctggatacagtaaaggaagccctccgggacaca----
H2SNZ9_BCL2L1-03      -----------------------taaaggaagccctccgggacaca----
                                               *  * *** **   *  *       

H2RNY4_MCL1-01        gagtggtggcgaacctgatggaaaagcaccgatac------gtgtacaat
H2U5I3_BCL2L1-01      ----gcagaagagtttg-------agaagctctttgctcaagcattcagc
H2U5I3_BCL2L1-02      ----gcagaagagtttg-------agaagctctttgctcaagcattcagc
H2SNZ9_BCL2L1-02      ----ggcaatgaatttg-------agctgcgatacacttgtgctttcagt
H2SNZ9_BCL2L1-01      ----ggcaatgaatttg-------agctgcgatacacttgtgctttcagt
H2SNZ9_BCL2L1-03      ----ggcaatgaatttg-------agctgcgatacacttgtgctttcagt
                          *     **   **       **   *  *        *  * **  

H2RNY4_MCL1-01        gggatgaccaaacagttgaccctggacgacagaggagacgatgt------
H2U5I3_BCL2L1-01      gacctctcctcacag------ctcgacatcactcctgacacagcttacca
H2U5I3_BCL2L1-02      gacctctcctcacag------ctcgacatcactcctgacacagcttacca
H2SNZ9_BCL2L1-02      gacctgcacaaccag------ctacacatcaccccagctactgcttacca
H2SNZ9_BCL2L1-01      gacctgcacaaccag------ctacacatcaccccagctactgcttacca
H2SNZ9_BCL2L1-03      gacctgcacaaccag------ctacacatcaccccagctactgcttacca
                      *   *   *   ***      **  **  **     *     *       

H2RNY4_MCL1-01        gagcttcgtcagctcggtagccaaaagcatattcgcagacggggtcacca
H2U5I3_BCL2L1-01      gagctttaagaatgtgatggacgag---gtgttcaaggacggagt---ca
H2U5I3_BCL2L1-02      gagctttaagaatgtgatggacgag---gtgttcaaggacggagt---ca
H2SNZ9_BCL2L1-02      aagttttgagaatgttatggatgag---gtatttagggatggagt---ca
H2SNZ9_BCL2L1-01      aagttttgagaatgttatggatgag---gtatttagggatggagt---ca
H2SNZ9_BCL2L1-03      aagttttgagaatgttatggatgag---gtatttagggatggagt---ca
                       ** **    *      * *   *     * **    ** ** **   **

H2RNY4_MCL1-01        actgggggcgcatcgccagcctagtggcctttggagccgtg------gtg
H2U5I3_BCL2L1-01      actggggacgagttgtgggactatttgcctttggcggggtactatgtgtg
H2U5I3_BCL2L1-02      actggggacgagttgtgggactatttgcctttggcggggtactatgtgtg
H2SNZ9_BCL2L1-02      actgggggcggatagtggggctttttgcatttggtggtgctctctgtgtg
H2SNZ9_BCL2L1-01      actgggggcggatagtggggctttttgcatttggtggtgctctctgtgtg
H2SNZ9_BCL2L1-03      actgggggcggatagtggggctttttgcatttggtggtgctctctgtgtg
                      ******* **  * *   * **  * ** ***** *  *        ***

H2RNY4_MCL1-01        gcccagcacatgaaggacaatggtcggagggactgcgtggagccggtggc
H2U5I3_BCL2L1-01      gaatgtgtcgagaaggatgcgagcc-----aactg-gtttgccgcattgc
H2U5I3_BCL2L1-02      gaatgtgtcgagaaggatgcgagcc-----aactg-gtttgccgcattgc
H2SNZ9_BCL2L1-02      gagtgtgttgagaaggagatgagtc-----ccctg-gtgggccggattat
H2SNZ9_BCL2L1-01      gagtgtgttgagaaggagatgagtc-----ccctg-gtgggccggattat
H2SNZ9_BCL2L1-03      gagtgtgttgagaaggagatgagtc-----ccctg-gtgggccggattat
                      *          ******     * *       *** **    *   *   

H2RNY4_MCL1-01        gcaggagatctccacgtacctgttgacgg--------accggcgggactg
H2U5I3_BCL2L1-01      agactggatgaccatttacc--tggatgagcatattaacccgtggatcca
H2U5I3_BCL2L1-02      agactggatgaccatttacc--tggatgagcatattaacccgtggatcca
H2SNZ9_BCL2L1-02      agagtggatgacagtctatc--ttgacaaccacattcaaccatggatcca
H2SNZ9_BCL2L1-01      agagtggatgacagtctatc--ttgacaaccacattcaaccatggatcca
H2SNZ9_BCL2L1-03      agagtggatgacagtctatc--ttgacaaccacattcaaccatggatcca
                        *   ***  *    ** *  * **           * *   **  *  

H2RNY4_MCL1-01        gctgatcaaaaacaacggctgggaaggatttgtggagtttttc---caag
H2U5I3_BCL2L1-01      g--agtcaagga----ggatgggattgcttcgcgaagatttttggggacg
H2U5I3_BCL2L1-02      g--agtcaagga----ggatgggattgcttcgcgaagatttttggggacg
H2SNZ9_BCL2L1-02      g--agtcaagga----ggatgggtccgttttgctgaactctttgggcagg
H2SNZ9_BCL2L1-01      g--agtcaagga----ggatgggtccgttttgctgaactctttgggcagg
H2SNZ9_BCL2L1-03      g--agtcaagga----ggatgggtccgttttgctgaactctttgggcagg
                      *    ****  *    ** ****   * ** *   *  * **     * *

H2RNY4_MCL1-01        tatcggacccagag-----------tcgtcag----tcaggaacatgctg
H2U5I3_BCL2L1-01      acgccgcggcagaggggaggagagctcgcgagaacctgagtagatggatg
H2U5I3_BCL2L1-02      acgccgcggcagaggggaggagagctcgcgagaacctgagtagatggatg
H2SNZ9_BCL2L1-02      atgcagcagcagaaagcaggagatctcaggagagattcagaaacggactc
H2SNZ9_BCL2L1-01      atgcagcagcagaaagcaggagatctcaggagagattcagaaacggactc
H2SNZ9_BCL2L1-03      atgcagcagcagaaagcaggagatctcaggagagattcagaaacggactc
                         * *   ****            **   **    * ** *      * 

H2RNY4_MCL1-01        atggccgtcgcgggggttgccgggctcggggccacgctggccctgttgat
H2U5I3_BCL2L1-01      ctgggcgg-attggcgctgctga--tgggagttttggtcggcgctttcat
H2U5I3_BCL2L1-02      ctgggcgg-attggcgctgctga--tgggagttttggtcggcgctttcat
H2SNZ9_BCL2L1-02      ctggtggg-gatgagcctggcag--cagggatcgcaatcgggtcgttcat
H2SNZ9_BCL2L1-01      ctggtggg-gatgagcctggcag--cagggatcgcaatcgggtcgttcat
H2SNZ9_BCL2L1-03      ctggtggg-gatgagcctggcag--cagggatcgcaatcgggtcgttcat
                       ***  *     *    **        **        * *     ** **

H2RNY4_MCL1-01        c------------cggtga
H2U5I3_BCL2L1-01      cgtcaagaaa---cattga
H2U5I3_BCL2L1-02      cgtcaagaaa---cattga
H2SNZ9_BCL2L1-02      agtgaggaaa---------
H2SNZ9_BCL2L1-01      agtgaggaaactcctgtga
H2SNZ9_BCL2L1-03      agtgaggaaa---------
                                         

© 1998-2018