Dataset for CDS BCL-2-like of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5K6B9_BCL2L1-      ----------------------------------------atgtc---tc
A0A3B5K6B9_BCL2L1-      ----------------------------------------atgtc---tc
A0A3B5KD08_BCL2L10      ----------------------------------------atgtcgtgc-
H2U5I3_BCL2L1-01        ----------------------------------------atgtcgtata
H2U5I3_BCL2L1-02        ----------------------------------------atgtcgtata
A0A3B5K5B3_MCL1-01      atgaatattattgcgaatcacaccgcgttgagaatcatgaatgtggtgtt
                                                                ****      

A0A3B5K6B9_BCL2L1-      aaaacagagaactg------------gtcattttctatattaagtac---
A0A3B5K6B9_BCL2L1-      aaaacagagaactg------------gtcattttctatattaagtac---
A0A3B5KD08_BCL2L10      --------gggctgtggaaaga--------------------gaccc---
H2U5I3_BCL2L1-01        acaacagagagctg--------gtggagcacttcttaa----gatac---
H2U5I3_BCL2L1-02        acaacagagagctg--------gtggagcacttcttaa----gatac---
A0A3B5K5B3_MCL1-01      ccaaaatggagtcgtggacggagcggggcattcctccccgctgatcccga
                                *    *                                *   

A0A3B5K6B9_BCL2L1-      ----------aaactctcccaaaga--------------aattaccc---
A0A3B5K6B9_BCL2L1-      ----------aaactctcccaaaga--------------aattaccc---
A0A3B5KD08_BCL2L10      ----------tggctcttgcagagg---------------actacct---
H2U5I3_BCL2L1-01        ----------aagctgtctcagagg--------------aactacccaac
H2U5I3_BCL2L1-02        ----------aagctgtctcagagg--------------aactacccaac
A0A3B5K5B3_MCL1-01      tggcttccagaggctccctcagcggcaacgacagcccgaagcggcccagc
                                     **    **  *                    **    

A0A3B5K6B9_BCL2L1-      -----tttc-------aatcacaatggactcatattagagcctccaagta
A0A3B5K6B9_BCL2L1-      -----tttc-------aatcacaatggactcatattagagcctccaagta
A0A3B5KD08_BCL2L10      -----gtccctg-----------------tgcagcacaagccagtg----
H2U5I3_BCL2L1-01        -----ttctctgctgagaccagaggatactgatg-gaaggacag--aggg
H2U5I3_BCL2L1-02        -----ttctctgctgagaccagaggatactgatg-gaaggacag--aggg
A0A3B5K5B3_MCL1-01      aagctctccgtgatcgcacccaaggtttgcgtggcgaaggccatccagga
                              *                                * *        

A0A3B5K6B9_BCL2L1-      gga--------------------ctgatgggcagtttgt-----------
A0A3B5K6B9_BCL2L1-      gga--------------------ctgatgggcagtttgt-----------
A0A3B5KD08_BCL2L10      -------------tccagcccctccacctcccagcgagtcggccactg--
H2U5I3_BCL2L1-01        agaaaagaggagccccggtgcttccaatggcctgctggtccgcagcag--
H2U5I3_BCL2L1-02        agaaaagaggagccccggtgcttccaatggcctgctggtccgcagcag--
A0A3B5K5B3_MCL1-01      ggacagccaggacaccg--accaccggtcggcgccgtgtacgccggagat
                                               *       *     **           

A0A3B5K6B9_BCL2L1-      -aactactcagttcaatggaacttttaatggtg--caagccctggaaca-
A0A3B5K6B9_BCL2L1-      -aactactcagttcaatggaacttttaatggtg--caagccctggaaca-
A0A3B5KD08_BCL2L10      ccatgaggcacctgggt------------------caggacatggagaag
H2U5I3_BCL2L1-01        gaac-------aggggtggagcgtctccatccg--caggtgctggcatag
H2U5I3_BCL2L1-02        gaac-------aggggtggagcgtctccatccg--caggtgctggcatag
A0A3B5K5B3_MCL1-01      gaactcggtgaacgggttggacgtgtccgggcgcccagcggaggacgagg
                          *             *                  **      *      

A0A3B5K6B9_BCL2L1-      ---cccccagcaacaagtctggcaacaagtctggatacagtaaaggaagc
A0A3B5K6B9_BCL2L1-      ---cccccagcaacaagtctggcaacaagtctggatacagtaaaggaagc
A0A3B5KD08_BCL2L10      cagcaccaggc------tcggttcaactccctagct---------cagac
H2U5I3_BCL2L1-01        aggctgtgaac-----------gcagctcttcg-------------ggac
H2U5I3_BCL2L1-02        aggctgtgaac-----------gcagctcttcg-------------ggac
A0A3B5K5B3_MCL1-01      cggcgttagacaacgacacgaggcagctcctcagctgcttcatggcggac
                           *      *             *                        *

A0A3B5K6B9_BCL2L1-      cctccggg---------acacaggcaatgaatttgagctgcg---ataca
A0A3B5K6B9_BCL2L1-      cctccggg---------acacaggcaatgaatttgagctgcg---ataca
A0A3B5KD08_BCL2L10      cttcctg--------------------agacagtgcgggccggacctctg
H2U5I3_BCL2L1-01        t----cggca---------------gaagagtttgagaagct---ctttg
H2U5I3_BCL2L1-02        t----cggca---------------gaagagtttgagaagct---ctttg
A0A3B5K5B3_MCL1-01      ttttgcggcatcggttcacatcagtggagggagagcggagcg---ctg--
                              *                     *     * *   *     *   

A0A3B5K6B9_BCL2L1-      cttgtgctttcagtgacctgc------acaaccagctacacatcacccca
A0A3B5K6B9_BCL2L1-      cttgtgctttcagtgacctgc------acaaccagctacacatcacccca
A0A3B5KD08_BCL2L10      ctccagcctcaggaaagtgatggaggagctggtgg---------------
H2U5I3_BCL2L1-01        ctcaagcattcagcgacctct------cctcacagctcgacatcactcc-
H2U5I3_BCL2L1-02        ctcaagcattcagcgacctct------cctcacagctcgacatcactcc-
A0A3B5K5B3_MCL1-01      -tcgaccatgaagcgagtggtggcgaacctgatggaaaagcaccgatacg
                         *    * *   *  *            *     *               

A0A3B5K6B9_BCL2L1-      gct----------------actgcttacca--------------------
A0A3B5K6B9_BCL2L1-      gct----------------actgcttacca--------------------
A0A3B5KD08_BCL2L10      --------gagatgg----acacttgaactggggaagggttgtatccctt
H2U5I3_BCL2L1-01        ------------tgac---acagcttacca--------------------
H2U5I3_BCL2L1-02        ------------tgac---acagcttacca--------------------
A0A3B5K5B3_MCL1-01      tgtacaatgggatgaccaaacagttgaccctggacgacagaggagacgat
                                           **   * * *                     

A0A3B5K6B9_BCL2L1-      --aagttttgagaatgttatggatgag---gtatttagggatggagt---
A0A3B5K6B9_BCL2L1-      --aagttttgagaatgttatggatgag---gtatttagggatggagt---
A0A3B5KD08_BCL2L10      ttcacctttactggggtgctggccagactgatgcaggagcagaagagcac
H2U5I3_BCL2L1-01        --gagctttaagaatgtgatggacgag---gtgttcaaggacggagt---
H2U5I3_BCL2L1-02        --gagctttaagaatgtgatggacgag---gtgttcaaggacggagt---
A0A3B5K5B3_MCL1-01      gtgagcttcgtcagctcggtagccaaaagcatattcgcagacggggtcac
                           *  **           * *         *        *         

A0A3B5K6B9_BCL2L1-      caactgggggcggatagtggggctttttgcatttggtggtgctctctgtg
A0A3B5K6B9_BCL2L1-      caactgggggcggatagtggggctttttgcatttggtggtgctctctgtg
A0A3B5KD08_BCL2L10      aaagccggggc---------------tggaccctggacaagagcagcaac
H2U5I3_BCL2L1-01        caactggggacgagttgtgggactatttgcctttggcggggtactatgtg
H2U5I3_BCL2L1-02        caactggggacgagttgtgggactatttgcctttggcggggtactatgtg
A0A3B5K5B3_MCL1-01      caactgggggcgcatcgccagcctagtggcctttggagccgtg------g
                         **   *** *               * *    ***    *         

A0A3B5K6B9_BCL2L1-      tggagtgtgttgagaaggagatgagtcccctggtgggc------cggatt
A0A3B5K6B9_BCL2L1-      tggagtgtgttgagaaggagatgagtcccctggtgggc------cggatt
A0A3B5KD08_BCL2L10      tgggacaggt------gcccgaaaactgcaggggactcgcggagaccata
H2U5I3_BCL2L1-01        tggaatgtgtcgagaaggatgcgagccaactggtttgc------cgcatt
H2U5I3_BCL2L1-02        tggaatgtgtcgagaaggatgcgagccaactggtttgc------cgcatt
A0A3B5K5B3_MCL1-01      tggcccagcacatgaaggacaatggtcggagggactgcgtggagccggtg
                        ***             *              **    *          * 

A0A3B5K6B9_BCL2L1-      atagagtggatgacagtctatctt--gacaaccacattcaaccatggatc
A0A3B5K6B9_BCL2L1-      atagagtggatgacagtctatctt--gacaaccacattcaaccatggatc
A0A3B5KD08_BCL2L10      gcagac------------tatcta--ggagag------gagaagaaagac
H2U5I3_BCL2L1-01        gcagactggatgaccatttacctg--gatgagcatattaacccgtggatc
H2U5I3_BCL2L1-02        gcagactggatgaccatttacctg--gatgagcatattaacccgtggatc
A0A3B5K5B3_MCL1-01      gcgcaggagatctccacgtacctgttgacg--------gaccggcgggac
                            *             ** **   *            *         *

A0A3B5K6B9_BCL2L1-      cag--agtcaagga----ggatgggtccgttttgctgaactctttgggca
A0A3B5K6B9_BCL2L1-      cag--agtcaagga----ggatgggtccgttttgctgaactctttgggca
A0A3B5KD08_BCL2L10      tggctgctggagaatggcggatgggaggggttctgtaagtactc------
H2U5I3_BCL2L1-01        cag--agtcaagga----ggatgggattgcttcgcgaagatttttgggga
H2U5I3_BCL2L1-02        cag--agtcaagga----ggatgggattgcttcgcgaagatttttgggga
A0A3B5K5B3_MCL1-01      tggctgatcaaaaacaacggctgggaaggatttgtggagttttt------
                          *    *  *  *    ** ****   * **     *    *       

A0A3B5K6B9_BCL2L1-      ggatgcagcag---cagaaagcaggag---atctca-----ggagagatt
A0A3B5K6B9_BCL2L1-      ggatgcagcag---cagaaagcaggag---atctca-----ggagagatt
A0A3B5KD08_BCL2L10      -----cctcgctgccagggaggtgaatcacgactcgtccatgaagaccgc
H2U5I3_BCL2L1-01        cgacgccgcgg---cagaggggaggag---agctcg-----cgagaacct
H2U5I3_BCL2L1-02        cgacgccgcgg---cagaggggaggag---agctcg-----cgagaacct
A0A3B5K5B3_MCL1-01      ccaagtatcggacccagag--------------tcgtcagtcaggaacat
                                *     ***                **         **    

A0A3B5K6B9_BCL2L1-      cagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcg
A0A3B5K6B9_BCL2L1-      cagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcg
A0A3B5KD08_BCL2L10      --actgttcgccgctgccggggtcggtctcgc-----------cgggctc
H2U5I3_BCL2L1-01        gagtagatggatgctgggcggattggcgctgctgatgggagttttggtcg
H2U5I3_BCL2L1-02        gagtagatggatgctgggcggattggcgctgctgatgggagttttggtcg
A0A3B5K5B3_MCL1-01      --gctgatggccgtcgcgggggttgcc-----------gggctcggggcc
                                       *   **   *                         

A0A3B5K6B9_BCL2L1-      ggtcgttcatagtgaggaaactcctgtga
A0A3B5K6B9_BCL2L1-      ggtcgttcatagtgaggaaactcctgtga
A0A3B5KD08_BCL2L10      acgttcctcct-----gg---tgcgctag
H2U5I3_BCL2L1-01        gcgctttcatcgtcaaga---aacattga
H2U5I3_BCL2L1-02        gcgctttcatcgtcaaga---aacattga
A0A3B5K5B3_MCL1-01      acgctggccctgtt--ga---tccggtga
                                        *      *  *  

© 1998-2019