Dataset for CDS BCL-2-like of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H2SNZ8_BCL2L1-02      atgtc---tcaaaacagagaactggt----cattttctatattaagtaca
H2SNZ8_BCL2L1-01      atgtc---tcaaaacagagaactggt----cattttctatattaagtaca
H2U5I3_BCL2L1-01      atgtcgtataacaacagagagctggtggagcacttctta----agataca
H2U5I3_BCL2L1-02      atgtcgtataacaacagagagctggtggagcacttctta----agataca
                      *****   * * ******** *****    ** **  **    *  ****

H2SNZ8_BCL2L1-02      aactctcccaaagaaattaccctttcaatcacaatggactcatattagag
H2SNZ8_BCL2L1-01      aactctcccaaagaaattaccctttcaatcacaatggactcatattagag
H2U5I3_BCL2L1-01      agctgtctcagaggaactacc----caacttctctg--ctgagaccagag
H2U5I3_BCL2L1-02      agctgtctcagaggaactacc----caacttctctg--ctgagaccagag
                      * ** ** ** ** ** ****    ***   *  **  ** * *  ****

H2SNZ8_BCL2L1-02      cctccaagt---aggactgatgg-gcagtttgtaactactcagttcaatg
H2SNZ8_BCL2L1-01      cctccaagt---aggactgatgg-gcagtttgtaactactcagttcaatg
H2U5I3_BCL2L1-01      gatactgatggaaggacagagggagaaaagaggagcccc----------g
H2U5I3_BCL2L1-02      gatactgatggaaggacagagggagaaaagaggagcccc----------g
                        * *   *   ***** ** ** * *    * * *  *          *

H2SNZ8_BCL2L1-02      gaacttttaatgg--tgcaagccc----------------tggaacaccc
H2SNZ8_BCL2L1-01      gaacttttaatgg--tgcaagccc----------------tggaacaccc
H2U5I3_BCL2L1-01      gtgcttccaatggcctgctggtccgcagcaggaacaggggtggagcgtct
H2U5I3_BCL2L1-02      gtgcttccaatggcctgctggtccgcagcaggaacaggggtggagcgtct
                      *  ***  *****  ***  * **                **** *  * 

H2SNZ8_BCL2L1-02      ccagcaacaagt-ctggcaacaagtctggatacagtaaaggaagccctcc
H2SNZ8_BCL2L1-01      ccagcaacaagt-ctggcaacaagtctggatacagtaaaggaagccctcc
H2U5I3_BCL2L1-01      ccatccgcaggtgctggca-------tagaggctgtgaacgcagctcttc
H2U5I3_BCL2L1-02      ccatccgcaggtgctggca-------tagaggctgtgaacgcagctcttc
                      *** *  ** ** ******       * **  * ** ** * *** ** *

H2SNZ8_BCL2L1-02      gggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgac
H2SNZ8_BCL2L1-01      gggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgac
H2U5I3_BCL2L1-01      gggactcggcagaagagtttgagaagctctttgctcaagcattcagcgac
H2U5I3_BCL2L1-02      gggactcggcagaagagtttgagaagctctttgctcaagcattcagcgac
                      ***** * *   * ** ******  **  *   **   ** ***** ***

H2SNZ8_BCL2L1-02      ctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
H2SNZ8_BCL2L1-01      ctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
H2U5I3_BCL2L1-01      ctctcctcacagctcgacatcactcctgacacagcttaccagagctttaa
H2U5I3_BCL2L1-02      ctctcctcacagctcgacatcactcctgacacagcttaccagagctttaa
                      **   *   *****  ******* ** *  ** ******** ** *** *

H2SNZ8_BCL2L1-02      gaatgttatggatgaggtatttagggatggagtcaactgggggcggatag
H2SNZ8_BCL2L1-01      gaatgttatggatgaggtatttagggatggagtcaactgggggcggatag
H2U5I3_BCL2L1-01      gaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttg
H2U5I3_BCL2L1-02      gaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttg
                      ****** ***** ***** ** * *** ************** **  * *

H2SNZ8_BCL2L1-02      tggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaag
H2SNZ8_BCL2L1-01      tggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaag
H2U5I3_BCL2L1-01      tgggactatttgcctttggcggggtactatgtgtggaatgtgtcgagaag
H2U5I3_BCL2L1-02      tgggactatttgcctttggcggggtactatgtgtggaatgtgtcgagaag
                      **** ** ***** ***** ** *  ** ******** ***** ******

H2SNZ8_BCL2L1-02      gagatgagtcccctggtgggccggattatagagtggatgacagtctatct
H2SNZ8_BCL2L1-01      gagatgagtcccctggtgggccggattatagagtggatgacagtctatct
H2U5I3_BCL2L1-01      gatgcgagccaactggtttgccgcattgcagactggatgaccatttacct
H2U5I3_BCL2L1-02      gatgcgagccaactggtttgccgcattgcagactggatgaccatttacct
                      **   *** *  *****  **** ***  *** ********  * ** **

H2SNZ8_BCL2L1-02      tgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtt
H2SNZ8_BCL2L1-01      tgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtt
H2U5I3_BCL2L1-01      ggatgagcatattaacccgtggatccagagtcaaggaggatgggattgct
H2U5I3_BCL2L1-02      ggatgagcatattaacccgtggatccagagtcaaggaggatgggattgct
                       **  * ** *** * ** *************************   * *

H2SNZ8_BCL2L1-02      ttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcag
H2SNZ8_BCL2L1-01      ttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcag
H2U5I3_BCL2L1-01      tcgcgaagatttttggggacgacgccgcggcagaggggaggagagctcgc
H2U5I3_BCL2L1-02      tcgcgaagatttttggggacgacgccgcggcagaggggaggagagctcgc
                      * **  *  * ****** * ** ** ** *****  * ****** ***  

H2SNZ8_BCL2L1-02      gagagattcagaaacggactcctggtggggatgagcctggcagcagggat
H2SNZ8_BCL2L1-01      gagagattcagaaacggactcctggtggggatgagcctggcagcagggat
H2U5I3_BCL2L1-01      gagaacctgagtagatggatgctgggcggattggcgctgctgatgggagt
H2U5I3_BCL2L1-02      gagaacctgagtagatggatgctgggcggattggcgctgctgatgggagt
                      ****   * ** *   *  * ****  **  **   ***      **  *

H2SNZ8_BCL2L1-02      cgcaatcgggtcgttcatagtgaggaaactcctgtga
H2SNZ8_BCL2L1-01      cgcaatcgggtcgttcatagtgaggaaactcctgtga
H2U5I3_BCL2L1-01      tttggtcggcgctttcatcgtcaagaaacat---tga
H2U5I3_BCL2L1-02      tttggtcggcgctttcatcgtcaagaaacat---tga
                           ****  * ***** ** * *****     ***

© 1998-2019