Dataset for CDS BCL2L1 of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2U5I3_BCL2L1-01      atgtcgtataacaacagagagctggtggagcacttcttaagatacaagct
H2U5I3_BCL2L1-02      atgtcgtataacaacagagagctggtggagcacttcttaagatacaagct
H2SNZ9_BCL2L1-02      ----c---ttgaaacagca--------------------------aggct
H2SNZ9_BCL2L1-01      atgtc---tcaaaacagagaactggtcattttctatattaagtacaaact
H2SNZ9_BCL2L1-03      atgtc---tcaaaacagagaactggtcattttctatattaagtacaaact
                          *   *   *****                            *  **

H2U5I3_BCL2L1-01      gtctcagaggaactaccc----aacttctctg--ctgagaccagag----
H2U5I3_BCL2L1-02      gtctcagaggaactaccc----aacttctctg--ctgagaccagag----
H2SNZ9_BCL2L1-02      tgaccaagacaa----------gagcagaatcaccccagagcaaag--tc
H2SNZ9_BCL2L1-01      ctcccaaagaaattaccctttcaatcacaatggactcatattagagcctc
H2SNZ9_BCL2L1-03      ctcccaaagaaattaccctttcaatcacaatggactcatattagagcctc
                          **    **           *      *   *  * *  * **    

H2U5I3_BCL2L1-01      -----gatactgatggaaggacagagggagaaaagaggagccccggtgct
H2U5I3_BCL2L1-02      -----gatactgatgga---------------------------------
H2SNZ9_BCL2L1-02      aaaaagcgactgatggg---------------------cagtttgtaact
H2SNZ9_BCL2L1-01      caagtaggactgatggg---------------------cagtttgtaact
H2SNZ9_BCL2L1-03      caa-----------------------------------------------
                                                                        

H2U5I3_BCL2L1-01      tccaatggcctgctggtccgcagcaggaacaggggtggagcgtctccatc
H2U5I3_BCL2L1-02      ------------------------aggaacaggggtggagcgtctccatc
H2SNZ9_BCL2L1-02      actcagttcaatggaacttttaatggtgcaagccctggaacacccccagc
H2SNZ9_BCL2L1-01      actcagttcaatggaacttttaatggtgcaagccctggaacacccccagc
H2SNZ9_BCL2L1-03      --------------------------------------------------
                                                                        

H2U5I3_BCL2L1-01      cgcaggtgctggcatagaggctg-------tgaacgcagctcttcgggac
H2U5I3_BCL2L1-02      cgcaggtgctggcatagaggctg-------tgaacgcagctcttcgggac
H2SNZ9_BCL2L1-02      aacaagt-ctggcaacaagtctggatacagtaaaggaagccctccgggac
H2SNZ9_BCL2L1-01      aacaagt-ctggcaacaagtctggatacagtaaaggaagccctccgggac
H2SNZ9_BCL2L1-03      ------------------------------taaaggaagccctccgggac
                                                    * ** * *** ** ******

H2U5I3_BCL2L1-01      tcggcagaagagtttgagaagctctttgctcaagcattcagcgacctctc
H2U5I3_BCL2L1-02      tcggcagaagagtttgagaagctctttgctcaagcattcagcgacctctc
H2SNZ9_BCL2L1-02      acaggcaatgaatttgagctgcgatacacttgtgctttcagtgacctgca
H2SNZ9_BCL2L1-01      acaggcaatgaatttgagctgcgatacacttgtgctttcagtgacctgca
H2SNZ9_BCL2L1-03      acaggcaatgaatttgagctgcgatacacttgtgctttcagtgacctgca
                       * *   * ** ******  **  *   **   ** ***** *****   

H2U5I3_BCL2L1-01      ctcacagctcgacatcactcctgacacagcttaccagagctttaagaatg
H2U5I3_BCL2L1-02      ctcacagctcgacatcactcctgacacagcttaccagagctttaagaatg
H2SNZ9_BCL2L1-02      caaccagctacacatcaccccagctactgcttaccaaagttttgagaatg
H2SNZ9_BCL2L1-01      caaccagctacacatcaccccagctactgcttaccaaagttttgagaatg
H2SNZ9_BCL2L1-03      caaccagctacacatcaccccagctactgcttaccaaagttttgagaatg
                      *   *****  ******* ** *  ** ******** ** *** ******

H2U5I3_BCL2L1-01      tgatggacgaggtgttcaaggacggagtcaactggggacgagttgtggga
H2U5I3_BCL2L1-02      tgatggacgaggtgttcaaggacggagtcaactggggacgagttgtggga
H2SNZ9_BCL2L1-02      ttatggatgaggtatttagggatggagtcaactgggggcggatagtgggg
H2SNZ9_BCL2L1-01      ttatggatgaggtatttagggatggagtcaactgggggcggatagtgggg
H2SNZ9_BCL2L1-03      ttatggatgaggtatttagggatggagtcaactgggggcggatagtgggg
                      * ***** ***** ** * *** ************** **  * ***** 

H2U5I3_BCL2L1-01      ctatttgcctttggcggggtactatgtgtggaatgtgtcgagaaggatgc
H2U5I3_BCL2L1-02      ctatttgcctttggcggggtactatgtgtggaatgtgtcgagaaggatgc
H2SNZ9_BCL2L1-02      ctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagat
H2SNZ9_BCL2L1-01      ctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagat
H2SNZ9_BCL2L1-03      ctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagat
                      ** ***** ***** ** *  ** ******** ***** ********   

H2U5I3_BCL2L1-01      gagccaactggtttgccgcattgcagactggatgaccatttacctggatg
H2U5I3_BCL2L1-02      gagccaactggtttgccgcattgcagactggatgaccatttacctggatg
H2SNZ9_BCL2L1-02      gagtcccctggtgggccggattatagagtggatgacagtctatcttgaca
H2SNZ9_BCL2L1-01      gagtcccctggtgggccggattatagagtggatgacagtctatcttgaca
H2SNZ9_BCL2L1-03      gagtcccctggtgggccggattatagagtggatgacagtctatcttgaca
                      *** *  *****  **** ***  *** ********  * ** ** **  

H2U5I3_BCL2L1-01      agcatattaacccgtggatccagagtcaaggaggatgggattgcttcgcg
H2U5I3_BCL2L1-02      agcatattaacccgtggatccagagtcaaggaggatgggattgcttcgcg
H2SNZ9_BCL2L1-02      accacattcaaccatggatccagagtcaaggaggatgggtccgttttgct
H2SNZ9_BCL2L1-01      accacattcaaccatggatccagagtcaaggaggatgggtccgttttgct
H2SNZ9_BCL2L1-03      accacattcaaccatggatccagagtcaaggaggatgggtccgttttgct
                      * ** *** * ** *************************   * ** ** 

H2U5I3_BCL2L1-01      aagatttttggggacgacgccgcggcagaggggaggagagctcgcgagaa
H2U5I3_BCL2L1-02      aagatttttggggacgacgccgcggcagaggggaggagagctcgcgagaa
H2SNZ9_BCL2L1-02      gaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagag
H2SNZ9_BCL2L1-01      gaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagag
H2SNZ9_BCL2L1-03      gaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagag
                       *  * ****** * ** ** ** *****  * ****** ***  **** 

H2U5I3_BCL2L1-01      cctgagtagatggatgctgggcggattggcgctgctgatgggagttttgg
H2U5I3_BCL2L1-02      cctgagtagatggatgctgggcggattggcgctgctgatgggagttttgg
H2SNZ9_BCL2L1-02      attcagaaacggactcctggtggggatgagcctggcagcagggatcgcaa
H2SNZ9_BCL2L1-01      attcagaaacggactcctggtggggatgagcctggcagcagggatcgcaa
H2SNZ9_BCL2L1-03      attcagaaacggactcctggtggggatgagcctggcagcagggatcgcaa
                        * ** *   *  * ****  **  **   ***      **  *     

H2U5I3_BCL2L1-01      tcggcgctttcatcgtcaagaaa---cattga
H2U5I3_BCL2L1-02      tcggcgctttcatcgtcaagaaa---cattga
H2SNZ9_BCL2L1-02      tcgggtcgttcatagtgaggaaa---------
H2SNZ9_BCL2L1-01      tcgggtcgttcatagtgaggaaactcctgtga
H2SNZ9_BCL2L1-03      tcgggtcgttcatagtgaggaaa---------
                      ****  * ***** ** * ****         

© 1998-2018