Dataset for CDS BCL2L1 of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5K6B9_BCL2L1-      atgtc---tcaaaacagagaactggt----cattttctatattaagtaca
A0A3B5K6B9_BCL2L1-      atgtc---tcaaaacagagaactggt----cattttctatattaagtaca
H2U5I3_BCL2L1-01        atgtcgtataacaacagagagctggtggagcacttctta----agataca
H2U5I3_BCL2L1-02        atgtcgtataacaacagagagctggtggagcacttctta----agataca
                        *****   * * ******** *****    ** **  **    *  ****

A0A3B5K6B9_BCL2L1-      aactctcccaaagaaattaccctttcaatcacaatggactcatattagag
A0A3B5K6B9_BCL2L1-      aactctcccaaagaaattaccctttcaatcacaatggactcatattagag
H2U5I3_BCL2L1-01        agctgtctcagaggaactacc----caacttctctg--ctgagaccagag
H2U5I3_BCL2L1-02        agctgtctcagaggaactacc----caacttctctg--ctgagaccagag
                        * ** ** ** ** ** ****    ***   *  **  ** * *  ****

A0A3B5K6B9_BCL2L1-      cctccaagt---aggactgatgg-gcagtttgtaactactcagttcaatg
A0A3B5K6B9_BCL2L1-      cctccaagt---aggactgatgg-gcagtttgtaactactcagttcaatg
H2U5I3_BCL2L1-01        gatactgatggaaggacagagggagaaaagaggagcccc----------g
H2U5I3_BCL2L1-02        gatactgatggaaggacagagggagaaaagaggagcccc----------g
                          * *   *   ***** ** ** * *    * * *  *          *

A0A3B5K6B9_BCL2L1-      gaacttttaatgg--tgcaagccc----------------tggaacaccc
A0A3B5K6B9_BCL2L1-      gaacttttaatgg--tgcaagccc----------------tggaacaccc
H2U5I3_BCL2L1-01        gtgcttccaatggcctgctggtccgcagcaggaacaggggtggagcgtct
H2U5I3_BCL2L1-02        gtgcttccaatggcctgctggtccgcagcaggaacaggggtggagcgtct
                        *  ***  *****  ***  * **                **** *  * 

A0A3B5K6B9_BCL2L1-      ccagcaacaagt-ctggcaacaagtctggatacagtaaaggaagccctcc
A0A3B5K6B9_BCL2L1-      ccagcaacaagt-ctggcaacaagtctggatacagtaaaggaagccctcc
H2U5I3_BCL2L1-01        ccatccgcaggtgctggca-------tagaggctgtgaacgcagctcttc
H2U5I3_BCL2L1-02        ccatccgcaggtgctggca-------tagaggctgtgaacgcagctcttc
                        *** *  ** ** ******       * **  * ** ** * *** ** *

A0A3B5K6B9_BCL2L1-      gggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgac
A0A3B5K6B9_BCL2L1-      gggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgac
H2U5I3_BCL2L1-01        gggactcggcagaagagtttgagaagctctttgctcaagcattcagcgac
H2U5I3_BCL2L1-02        gggactcggcagaagagtttgagaagctctttgctcaagcattcagcgac
                        ***** * *   * ** ******  **  *   **   ** ***** ***

A0A3B5K6B9_BCL2L1-      ctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
A0A3B5K6B9_BCL2L1-      ctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
H2U5I3_BCL2L1-01        ctctcctcacagctcgacatcactcctgacacagcttaccagagctttaa
H2U5I3_BCL2L1-02        ctctcctcacagctcgacatcactcctgacacagcttaccagagctttaa
                        **   *   *****  ******* ** *  ** ******** ** *** *

A0A3B5K6B9_BCL2L1-      gaatgttatggatgaggtatttagggatggagtcaactgggggcggatag
A0A3B5K6B9_BCL2L1-      gaatgttatggatgaggtatttagggatggagtcaactgggggcggatag
H2U5I3_BCL2L1-01        gaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttg
H2U5I3_BCL2L1-02        gaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttg
                        ****** ***** ***** ** * *** ************** **  * *

A0A3B5K6B9_BCL2L1-      tggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaag
A0A3B5K6B9_BCL2L1-      tggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaag
H2U5I3_BCL2L1-01        tgggactatttgcctttggcggggtactatgtgtggaatgtgtcgagaag
H2U5I3_BCL2L1-02        tgggactatttgcctttggcggggtactatgtgtggaatgtgtcgagaag
                        **** ** ***** ***** ** *  ** ******** ***** ******

A0A3B5K6B9_BCL2L1-      gagatgagtcccctggtgggccggattatagagtggatgacagtctatct
A0A3B5K6B9_BCL2L1-      gagatgagtcccctggtgggccggattatagagtggatgacagtctatct
H2U5I3_BCL2L1-01        gatgcgagccaactggtttgccgcattgcagactggatgaccatttacct
H2U5I3_BCL2L1-02        gatgcgagccaactggtttgccgcattgcagactggatgaccatttacct
                        **   *** *  *****  **** ***  *** ********  * ** **

A0A3B5K6B9_BCL2L1-      tgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtt
A0A3B5K6B9_BCL2L1-      tgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtt
H2U5I3_BCL2L1-01        ggatgagcatattaacccgtggatccagagtcaaggaggatgggattgct
H2U5I3_BCL2L1-02        ggatgagcatattaacccgtggatccagagtcaaggaggatgggattgct
                         **  * ** *** * ** *************************   * *

A0A3B5K6B9_BCL2L1-      ttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcag
A0A3B5K6B9_BCL2L1-      ttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcag
H2U5I3_BCL2L1-01        tcgcgaagatttttggggacgacgccgcggcagaggggaggagagctcgc
H2U5I3_BCL2L1-02        tcgcgaagatttttggggacgacgccgcggcagaggggaggagagctcgc
                        * **  *  * ****** * ** ** ** *****  * ****** ***  

A0A3B5K6B9_BCL2L1-      gagagattcagaaacggactcctggtggggatgagcctggcagcagggat
A0A3B5K6B9_BCL2L1-      gagagattcagaaacggactcctggtggggatgagcctggcagcagggat
H2U5I3_BCL2L1-01        gagaacctgagtagatggatgctgggcggattggcgctgctgatgggagt
H2U5I3_BCL2L1-02        gagaacctgagtagatggatgctgggcggattggcgctgctgatgggagt
                        ****   * ** *   *  * ****  **  **   ***      **  *

A0A3B5K6B9_BCL2L1-      cgcaatcgggtcgttcatagtgaggaaactcctgtga
A0A3B5K6B9_BCL2L1-      cgcaatcgggtcgttcatagtgaggaaactcctgtga
H2U5I3_BCL2L1-01        tttggtcggcgctttcatcgtcaagaaacat---tga
H2U5I3_BCL2L1-02        tttggtcggcgctttcatcgtcaagaaacat---tga
                             ****  * ***** ** * *****     ***

© 1998-2019