Dataset for CDS BCL-2-like of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H0ZCL9_BCL2A1-01      atg-----------------------------------gaaactgctgag
H0YUX3_BCL2-01        atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
H0Z8G3_BCL2L1-01      atg------------------tacagcagtaaccgggagttagtgattga
                      ***                                   *  * ** *   

H0ZCL9_BCL2A1-01      ttctattacgttta------------------------------------
H0YUX3_BCL2-01        gtacatccactataaactctctcagaggggatacgactggg--ctgccgg
H0Z8G3_BCL2L1-01      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
                       *   *    *  *                                    

H0ZCL9_BCL2A1-01      -------------------------------------ttacttagc----
H0YUX3_BCL2-01        ----------cgaggacagggcatccctgcctccagatcactccgcttct
H0Z8G3_BCL2L1-01      aagaggaggatgagaacaggac---------------tgactttgcaggg
                                                           * ***  **    

H0ZCL9_BCL2A1-01      ----------------ccaggattatctgcagtatgtgctccagg-----
H0YUX3_BCL2-01        gctgctgctgcgattgctg----ctgctgcgattgctgctgctgg-----
H0Z8G3_BCL2L1-01      gaggaggacgagatggacggggtcctcaacgggagcccctcctggcacgc
                                                *  *        ** * **     

H0ZCL9_BCL2A1-01      -------aatcaca---------------cctcggaccagcccagacccg
H0YUX3_BCL2-01        gacttctgatcacactg-ggctggtgtctccgcaccccg----agccccc
H0Z8G3_BCL2L1-01      ggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcg
                                ****               **     **     ** * * 

H0ZCL9_BCL2A1-01      ggttgctcatgtcctgagaaccatggcatcctctctgcaagac-------
H0YUX3_BCL2-01        cg--gctcggctactgctagccacacgcccccagccgaggggctgcgccc
H0Z8G3_BCL2L1-01      aa--gt--------------ccatgagatcc--gtcgagcagctg-----
                          *               ***      **     *     *       

H0ZCL9_BCL2A1-01      -------------------------------caaacggaggaggctgtca
H0YUX3_BCL2-01        tgcaccccaggccgtccacctcgtcctgcgccaggcgggggatgagttct
H0Z8G3_BCL2L1-01      ---atgtgaggcag--------gcgctgagagaggcgggggatgagtttg
                                                      *  *** *** *   *  

H0ZCL9_BCL2A1-01      ggc--cgctcctggacaggattg----------------------acatc
H0YUX3_BCL2-01        cccgacgctaccagagagacttttcccaaatgtctggccagctgcacctg
H0Z8G3_BCL2L1-01      agctgaggtaccggcgggcgttcagcgacctcacttcccagctccacatc
                        *   * * *  *   *  **                       ** * 

H0ZCL9_BCL2A1-01      acctctgtagcggctgccaagagaattttcaatggagtcatggatgaaaa
H0YUX3_BCL2-01        acgccctttaca---gccaggagccgcttcgtggcggtggtggaggagct
H0Z8G3_BCL2L1-01      actcccagcaca---gcgtatcagagctttgagcaggtagtgaacgaact
                      **  *     *    **          **       **  ** * **   

H0ZCL9_BCL2A1-01      gtttgctgatggaaatactaactggggacgaatcatgaccatctttacat
H0YUX3_BCL2-01        cttccgagatggg---gttaactggggcagaattgtggccttcttcgagt
H0Z8G3_BCL2L1-01      gttccgcgatgga---gtgaactggggccgcatcgtggctttcttctcct
                       **    *****       ********  * **  ** *  ****    *

H0ZCL9_BCL2A1-01      ttggaggtcttctcaccaagaagcttcaagagcatggggttcagctgact
H0YUX3_BCL2-01        ttggcggtgtgat-------gtgtgtggagagcgt--------------c
H0Z8G3_BCL2L1-01      tcggaggagcctt-------gtgcgtggagagcgt--------------t
                      * ** **     *         *  *  ***** *               

H0ZCL9_BCL2A1-01      gcagaggaga------------aggagcagatttcttatttcatcacgga
H0YUX3_BCL2-01        aacagggagatgtttcccctcgtggacaacattgccacctggatgactga
H0Z8G3_BCL2L1-01      gttaaggagatgagggtattggtgaaacgcatcgtctcttggatgaccac
                           *****             * *    **       *  ** **   

H0ZCL9_BCL2A1-01      gtacatcatcaacaacaaagccgaatggattgatgcgaatggtggctggg
H0YUX3_BCL2-01        gtacctgaaccggcacctgcacaactggatccaggacaacggaggctggg
H0Z8G3_BCL2L1-01      gtacttgaccgaccacttagatccctggatccaggagaatggcggatggg
                      **** * * *    **         *****  * *  ** ** ** ****

H0ZCL9_BCL2A1-01      aaaatggcttcctaactaagtttgaaaga---------------------
H0YUX3_BCL2-01        ---atgcctttgtggagttgtatg---------------gcaacaatatg
H0Z8G3_BCL2L1-01      ---agcgctttgtgga-ctctatgaacgatgctgctgccgagatgagaaa
                         *   ***  *       * **                          

H0ZCL9_BCL2A1-01      ----------------agatcactactgtccttctccaaa----------
H0YUX3_BCL2-01        aggcc-----tttgtttgatttctcctggatctctctgaagac-----ta
H0Z8G3_BCL2L1-01      aggccaggagttcaacaaatggctcctga-------cgggggcgacggtg
                                        **  ** ***                      

H0ZCL9_BCL2A1-01      -----attacagccctgttcatagc---------tcttgtgtccttgttc
H0YUX3_BCL2-01        tcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctt
H0Z8G3_BCL2L1-01      gccggag--tgcttctgctgggatc----------cctg--------ctg
                           *        *** *   * *          * **         * 

H0ZCL9_BCL2A1-01      agagagtactactga
H0YUX3_BCL2-01        gga---cataagtag
H0Z8G3_BCL2L1-01      agc---cgcaagtga
                       *        * *  

© 1998-2019