Dataset for CDS MCL-1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q95KR3_MCL1-01      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccgga
K9IWB2_MCL1-02      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccgga
K9IWB2_MCL1-01      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccgga
K9IWB2_MCL1-03      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccgga
                    ************************************************************

Q95KR3_MCL1-01      ttggggcctggaagcggcagcagc------------------------------------
K9IWB2_MCL1-02      ttggggcctggaagcggcagcagcgcctccgctccgggaggccgtctcttggctacggga
K9IWB2_MCL1-01      ttggggcctggaagcggcagcagcgcctccgctccgggaggccgtctcttggctacggga
K9IWB2_MCL1-03      ttggggcctggaagcggcagcagcgcctccgctccgggaggccgtctcttggctacggga
                    ************************                                    

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      aaagaggccacggcccggcaagaggtagggggaggggaagccggcatggtgattggcgga
K9IWB2_MCL1-01      aaagaggccacggcccggcaagaggtagggggaggggaagccggcatggtgattggcgga
K9IWB2_MCL1-03      aaagaggccacggcccggcaagaggtagggggaggggaagccggcatggtgattggcgga
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      agcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
K9IWB2_MCL1-01      agcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
K9IWB2_MCL1-03      agcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
K9IWB2_MCL1-01      tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
K9IWB2_MCL1-03      tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctccgacgccatc
K9IWB2_MCL1-01      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctccgacgccatc
K9IWB2_MCL1-03      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctccgacgccatc
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      atgtctcccgaagaggagctggacgggtacgagccggagcccctcgggaagcggccggcc
K9IWB2_MCL1-01      atgtctcccgaagaggagctggacgggtacgagccggagcccctcgggaagcggccggcc
K9IWB2_MCL1-03      atgtctcccgaagaggagctggacgggtacgagccggagcccctcgggaagcggccggcc
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      gtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
K9IWB2_MCL1-01      gtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
K9IWB2_MCL1-03      gtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctg
K9IWB2_MCL1-01      ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctg
K9IWB2_MCL1-03      ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctg
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      gagattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
K9IWB2_MCL1-01      gagattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
K9IWB2_MCL1-03      gagattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
                                                                                

Q95KR3_MCL1-01      ------------------------------------------------------------
K9IWB2_MCL1-02      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggtcggggacggg
K9IWB2_MCL1-01      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggtcggggacggg
K9IWB2_MCL1-03      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggtcggggacggg
                                                                                

Q95KR3_MCL1-01      ---------------------gccttccaaggcatgcttcggaaactggacatcaaaaac
K9IWB2_MCL1-02      gtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
K9IWB2_MCL1-01      gtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
K9IWB2_MCL1-03      gtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
                                         ***************************************

Q95KR3_MCL1-01      gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttaagtgacggagtaaca
K9IWB2_MCL1-02      gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaaca
K9IWB2_MCL1-01      gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaaca
K9IWB2_MCL1-03      gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaaca
                    ******************************************** ***************

Q95KR3_MCL1-01      aactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaag
K9IWB2_MCL1-02      aactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaag
K9IWB2_MCL1-01      aactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaag
K9IWB2_MCL1-03      aactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaag
                    ************************************************************

Q95KR3_MCL1-01      agtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-02      agtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-01      agtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-03      agtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
                    ************************************************************

Q95KR3_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
K9IWB2_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
K9IWB2_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
K9IWB2_MCL1-03      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
                    ************************************************************

Q95KR3_MCL1-01      catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgct
K9IWB2_MCL1-02      catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgct
K9IWB2_MCL1-01      catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgct
K9IWB2_MCL1-03      catgtagaggacctagaaggc---------------------------------------
                    *********************                                       

Q95KR3_MCL1-01      ggagtaggagctggtttggcatatctaataagatag--------
K9IWB2_MCL1-02      ggagtaggagctggtttggcatatctaataagatag--------
K9IWB2_MCL1-01      ggagtaggagctggtttggcatatctaataagatag--------
K9IWB2_MCL1-03      -----------------ggcatatctaataagatagccttttaa
                                     *******************        

© 1998-2018