Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
Q95KR3_MCL1-01          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
K9IWB2_MCL1-02          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
K9IWB2_MCL1-01          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
K9IWB2_MCL1-03          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
A0A287APJ6_BCL2-01      ----------------------------------------------atgc

O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
Q95KR3_MCL1-01          gggggccggattggggcctggaagcggcagcagc----------------
K9IWB2_MCL1-02          gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
K9IWB2_MCL1-01          gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
K9IWB2_MCL1-03          gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A287APJ6_BCL2-03      -----------------------atggcg--cacgctg------------
A0A287APJ6_BCL2-01      tgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatg

O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
K9IWB2_MCL1-01          gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
K9IWB2_MCL1-03          gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A287APJ6_BCL2-03      ----------------------------------------ggagaacagg
A0A287APJ6_BCL2-01      gt-gtctccgctcatcagccccaagcccctcgccctgcccggagctcatg

O77737_BCL2L1-01        ------------------atgtctcagagcaacc-----gggagctggtg
F1RZB9_BCL2L10-01       -------------------------atggcggac---gcgttcagggagc
A0A287AW74_BCL2L2-      -------------------------atggcgaccccggcctcagccccag
A0A287AW74_BCL2L2-      -------------------------atggcgaccccggcctcagccccag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
K9IWB2_MCL1-01          ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
K9IWB2_MCL1-03          ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
C7F841_BCL2A1-02        --a----------------tgactgacgacgagtttgg------------
C7F841_BCL2A1-01        --a----------------tgactgacgacgagtttgg------------
A0A287APJ6_BCL2-03      gta----------------tgataaccgggaaat--agtgat-----gaa
A0A287APJ6_BCL2-01      tgg----------------tggttactggaggctccagcggcatcggaaa

O77737_BCL2L1-01        gttgactttctct-------------------------------------
F1RZB9_BCL2L10-01       gcacagcccggct-------------------------------------
A0A287AW74_BCL2L2-      acacacgggctct-----------------------------agtggcag
A0A287AW74_BCL2L2-      acacacgggctct-----------------------------agtggcag
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
K9IWB2_MCL1-01          gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
K9IWB2_MCL1-03          gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
C7F841_BCL2A1-02        atatattc------------------------------------------
C7F841_BCL2A1-01        atatattc------------------------------------------
A0A287APJ6_BCL2-03      gtacat--ccact-------------------------------------
A0A287APJ6_BCL2-01      gtgcattgccattgagtgctataaacaaggagcgtttataactctggttg

O77737_BCL2L1-01        ---------cctacaa----------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      actttgtgggctataa----------------------------------
A0A287AW74_BCL2L2-      actttgtgggctataa----------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
K9IWB2_MCL1-01          gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
K9IWB2_MCL1-03          gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
C7F841_BCL2A1-02        ------------acat----------------------------------
C7F841_BCL2A1-01        ------------acat----------------------------------
A0A287APJ6_BCL2-03      ------------ataa----------------------------------
A0A287APJ6_BCL2-01      cacgaaatgaggacaa----------------------------------

O77737_BCL2L1-01        --------------------gctttcccagaaaggatacagctgga----
F1RZB9_BCL2L10-01       --------------------tctgaccgacta------------------
A0A287AW74_BCL2L2-      --------------------gctgaggcagaa------------------
A0A287AW74_BCL2L2-      --------------------gctgaggcagaa------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
K9IWB2_MCL1-01          gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
K9IWB2_MCL1-03          gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
C7F841_BCL2A1-02        --------------------gctggcccagga------------------
C7F841_BCL2A1-01        --------------------gctggcccagga------------------
A0A287APJ6_BCL2-03      --------------------gctgtcgcagagggg---------------
A0A287APJ6_BCL2-01      --------------------gctgttgcaggcaaagaaagaaattgaaaa

O77737_BCL2L1-01        --------------------gtcagtttactgatgtggaagagaacagaa
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------gggttatgtctg------------------
A0A287AW74_BCL2L2-      --------------------gggttatgtctg------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          cgacgccatcatgtctcccgaagaggagctggacggg-------tacgag
K9IWB2_MCL1-01          cgacgccatcatgtctcccgaagaggagctggacggg-------tacgag
K9IWB2_MCL1-03          cgacgccatcatgtctcccgaagaggagctggacggg-------tacgag
C7F841_BCL2A1-02        -----ctatct---------gaagtatgtc--------------------
C7F841_BCL2A1-01        -----ctatct---------gaagtatgtc--------------------
A0A287APJ6_BCL2-03      -----ctacga---------gtgggatgccggagacg----------cgg
A0A287APJ6_BCL2-01      acactctatta---------atgataaacaggtggtgctttgtatatcag

O77737_BCL2L1-01        ctgaggccccagaagggactgaatcagaagcggaaacccc-tagtgccat
F1RZB9_BCL2L10-01       ---------cctggagtactgcgcccg--------------ggagcccgg
A0A287AW74_BCL2L2-      -----------------------------------------tggagctgg
A0A287AW74_BCL2L2-      -----------------------------------------tggagctgg
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ccggagcccctcgggaagcggccggc-cgtcctgcccttgctggggttag
K9IWB2_MCL1-01          ccggagcccctcgggaagcggccggc-cgtcctgcccttgctggggttag
K9IWB2_MCL1-03          ccggagcccctcgggaagcggccggc-cgtcctgcccttgctggggttag
C7F841_BCL2A1-02        ---------ctgcagataccacaacc---------------tggatctgg
C7F841_BCL2A1-01        ---------ctgcagataccacaacc---------------tggatctgg
A0A287APJ6_BCL2-03      gcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccag
A0A287APJ6_BCL2-01      ttgatgtgtctc--aagactatagccaagtagagaatgtcataaaacaag

O77737_BCL2L1-01        caatggcaacccatcctggcacctggcggacagccccgcggtgaatggag
F1RZB9_BCL2L10-01       caccgccgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcg
A0A287AW74_BCL2L2-      ccccgggga-----------------------------------------
A0A287AW74_BCL2L2-      ccccgggga-----------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          tcgaggaggccagtagtggccccggcacggacggctcgctcccctcgacg
K9IWB2_MCL1-01          tcgaggaggccagtagtggccccggcacggacggctcgctcccctcgacg
K9IWB2_MCL1-03          tcgaggaggccagtagtggccccggcacggacggctcgctcccctcgacg
C7F841_BCL2A1-02        tccaagcaaaac------------------atctagagtgttacgagacg
C7F841_BCL2A1-01        tccaagcaaaac------------------atctagagtgttacgagacg
A0A287APJ6_BCL2-03      cccgggcgaacccccgctcc--------------------cgccaggacc
A0A287APJ6_BCL2-01      cacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatg

O77737_BCL2L1-01        ccactggc------------------------------------------
F1RZB9_BCL2L10-01       tggctgcc------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          ccgcccccggcagaggaggaggaggacgagttataccggcagtccctgga
K9IWB2_MCL1-01          ccgcccccggcagaggaggaggaggacgagttataccggcagtccctgga
K9IWB2_MCL1-03          ccgcccccggcagaggaggaggaggacgagttataccggcagtccctgga
C7F841_BCL2A1-02        tggctttc----------tccgtccaaaa---------------------
C7F841_BCL2A1-01        tggctttc----------tccgtccaaaa---------------------
A0A287APJ6_BCL2-03      tcgccgcc----------gccgaccccgaccgcccccgccgccacc----
A0A287APJ6_BCL2-01      tcactttcaggaaaatttgaagatcttga---------------------

O77737_BCL2L1-01        ------------------------cacagcagcagcttggatgcccggga
F1RZB9_BCL2L10-01       ---------------------------------------cagatacggga
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          gattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcga
K9IWB2_MCL1-01          gattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcga
K9IWB2_MCL1-03          gattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgcga
C7F841_BCL2A1-02        ---------------------------------------cgaagttgaaa
C7F841_BCL2A1-01        ---------------------------------------cgaagttgaaa
A0A287APJ6_BCL2-03      ----------------------------gccgccgccgccgccgccgcgg
A0A287APJ6_BCL2-01      ---------------------------------agttagtacttttgaga

O77737_BCL2L1-01        gg--------------tgatccccatggctg---cagtgaagcaagcgct
F1RZB9_BCL2L10-01       gtac---------------------------------------aacgtgc
A0A287AW74_BCL2L2-      -----------------gggcccagcagctgacccgctgcaccaagccat
A0A287AW74_BCL2L2-      -----------------gggcccagcagctgacccgctgcaccaagccat
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          agccaatgggcgggtctggggccgccagccggaaggcgttagagaccc-t
K9IWB2_MCL1-01          agccaatgggcgggtctggggccgccagccggaaggcgttagagaccc-t
K9IWB2_MCL1-03          agccaatgggcgggtctggggccgccagccggaaggcgttagagaccc-t
C7F841_BCL2A1-02        ag--------------------------------aattt----gaaac-c
C7F841_BCL2A1-01        ag--------------------------------aattt----gaaac-c
A0A287APJ6_BCL2-03      ggcctgtactcagcccggtgccacctg--tggtccacct----gaccc-t
A0A287APJ6_BCL2-01      ggctcatg--------agtgtcaactacctgggcagcgt----gtacc-c

O77737_BCL2L1-01        gagggaggcgggcgatgagtttgaactgaggtaccggagg-gcattcagt
F1RZB9_BCL2L10-01       gcaccttgtctg--------tctaccgcggcttccgctggaaccgtgtcg
A0A287AW74_BCL2L2-      gcgggcagctggagatgagttcgagacccgcttccggcgc-accttctca
A0A287AW74_BCL2L2-      gcgggcagctggagatgagttcgagacccgcttccggcgc-accttctca
Q95KR3_MCL1-01          -----------------------------------------gccttccaa
K9IWB2_MCL1-02          gcgacgggtcggggacggggtgcagcgcaacca-cgagacggccttccaa
K9IWB2_MCL1-01          gcgacgggtcggggacggggtgcagcgcaacca-cgagacggccttccaa
K9IWB2_MCL1-03          gcgacgggtcggggacggggtgcagcgcaacca-cgagacggccttccaa
C7F841_BCL2A1-02        atgcttggacaattttga----tgttgtgtccatagacac-----tgcca
C7F841_BCL2A1-01        atgcttggacaattttga----tgttgtgtccatagacac-----tgcca
A0A287APJ6_BCL2-03      gcgccaggccggcgatgacttctctcgtcgctaccgccgcgactttgccg
A0A287APJ6_BCL2-01      gagccgag-cggtgatcaccaccatgaagg--agcgccgcg---tgggca

O77737_BCL2L1-01        gacct------------------gacgtcccagctccacatcaccccagg
F1RZB9_BCL2L10-01       aa-----------------------ttggtggcctggatggcacag----
A0A287AW74_BCL2L2-      gattt------------------ggcagctcagttgcatgtgaccccggg
A0A287AW74_BCL2L2-      gattt------------------ggcagctcagttgcatgtgaccccggg
Q95KR3_MCL1-01          ggcat------------------gcttcggaaactggacatcaaaaacga
K9IWB2_MCL1-02          ggcat------------------gcttcggaaactggacatcaaaaacga
K9IWB2_MCL1-01          ggcat------------------gcttcggaaactggacatcaaaaacga
K9IWB2_MCL1-03          ggcat------------------gcttcggaaactggacatcaaaaacga
C7F841_BCL2A1-02        ga-at---------------------------------------------
C7F841_BCL2A1-01        ga-at---------------------------------------------
A0A287APJ6_BCL2-03      ag-at------------------gtccagccagctgcacctgactccctt
A0A287APJ6_BCL2-01      gg-atcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggctt

O77737_BCL2L1-01        gacagcgtatca--------------gagctttgagcaggtattgaacga
F1RZB9_BCL2L10-01       --------------------------aaactactcgcaag----------
A0A287AW74_BCL2L2-      ctcggcccagca--------------gcgcttcacccaggtctctgatga
A0A287AW74_BCL2L2-      ctcggcccagca--------------gcgcttcacccaggtctctgatga
Q95KR3_MCL1-01          ag--------------acgatgtcaaatctttgtctcgagtgatggtcca
K9IWB2_MCL1-02          ag--------------acgatgtcaaatctttgtctcgagtgatggtcca
K9IWB2_MCL1-01          ag--------------acgatgtcaaatctttgtctcgagtgatggtcca
K9IWB2_MCL1-03          ag--------------acgatgtcaaatctttgtctcgagtgatggtcca
C7F841_BCL2A1-02        --------------------------aatattcaatcaagtgatggaaaa
C7F841_BCL2A1-01        --------------------------aatattcaatcaagtgatggaaaa
A0A287APJ6_BCL2-03      ca------------ccgcgaggggacgctttgccac---ggtggtgg-ag
A0A287APJ6_BCL2-01      cacagcctactcttcctcaaag------tttgccatcaggggattggcag
                                                      *        *          

O77737_BCL2L1-01        actcttccgggatgg---ggtgaactggggtcgcatt--------gtggc
F1RZB9_BCL2L10-01       ------cccacgtgg---ccccaactggtaccgc-----------gtggc
A0A287AW74_BCL2L2-      actcttccaaggagg---ccccaactggggccgcctt--------gtggc
A0A287AW74_BCL2L2-      actcttccaaggagg---ccccaactggggccgcctt--------gtggc
Q95KR3_MCL1-01          cgttttaagtgacggagtaacaaactggggcaggatt--------gtgac
K9IWB2_MCL1-02          cgttttcagtgacggagtaacaaactggggcaggatt--------gtgac
K9IWB2_MCL1-01          cgttttcagtgacggagtaacaaactggggcaggatt--------gtgac
K9IWB2_MCL1-03          cgttttcagtgacggagtaacaaactggggcaggatt--------gtgac
C7F841_BCL2A1-02        ggaatttgaagatggcatcattaactggggaaggatt--------gtgac
C7F841_BCL2A1-01        ggaatttgaagatggcatcattaactggggaaggatt--------gtgac
A0A287APJ6_BCL2-03      gagctcttcagggat-ggggtgaactgggggaggatt--------gtggc
A0A287APJ6_BCL2-01      aagctctgcagatgg-aggtgaagccatataatgtttatgtcacagtggc
                                              * *                    *** *

O77737_BCL2L1-01        ct------------------ttttctccttcggtgggg---------cac
F1RZB9_BCL2L10-01       atcac---------------tcttgaccttcgcaggga------------
A0A287AW74_BCL2L2-      ct------------------tctttgtcttcggagctg---------cac
A0A287AW74_BCL2L2-      ct------------------tctttgtcttcggagctg---------cac
Q95KR3_MCL1-01          tc------------------ttatttcttttggtg---------------
K9IWB2_MCL1-02          tc------------------ttatttcttttggtg---------------
K9IWB2_MCL1-01          tc------------------ttatttcttttggtg---------------
K9IWB2_MCL1-03          tc------------------ttatttcttttggtg---------------
C7F841_BCL2A1-02        ca------------------tatttgcatttgaagg------------ta
C7F841_BCL2A1-01        ca------------------tatttgcatttgaagg------------ta
A0A287APJ6_BCL2-03      ct------------------tctttgagttcggtgggg---------tca
A0A287APJ6_BCL2-01      ctaccctccagacacagacacccctgggtttgccgaagaaaacaaaacca
                                                    ** *  *               

O77737_BCL2L1-01        tgtgcgtggaga-gcgta---------------------------gacaa
F1RZB9_BCL2L10-01       tgctgctggaaagacatc--------------------------------
A0A287AW74_BCL2L2-      tgtgtgctgaga-gtgtc---------------------------aataa
A0A287AW74_BCL2L2-      tgtgtgctgaga-gtgtc---------------------------aataa
Q95KR3_MCL1-01          -------------ccttt--------------------------------
K9IWB2_MCL1-02          -------------ccttt--------------------------------
K9IWB2_MCL1-01          -------------ccttt--------------------------------
K9IWB2_MCL1-03          -------------ccttt--------------------------------
C7F841_BCL2A1-02        ttctcatgaagaaacttc---------------------------tgcga
C7F841_BCL2A1-01        ttctcatgaagaaacttc---------------------------tgcga
A0A287APJ6_BCL2-03      tgtgtgtggaga-gcgtc---------------------------aaccg
A0A287APJ6_BCL2-01      agcctttggagactcgtcttatttcagagaccacatctgtttgcaaacca

O77737_BCL2L1-01        ggagatgcaggtattggtgagtcggatcgcaacttggatggccacttacc
F1RZB9_BCL2L10-01       -ctcgggaggcctgtgggcggaagaagaaggagggcaacg----ttagca
A0A287AW74_BCL2L2-      ggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacc
A0A287AW74_BCL2L2-      ggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacc
Q95KR3_MCL1-01          ------gtggccaa-------acacttg-----aagagta----taaatc
K9IWB2_MCL1-02          ------gtggccaa-------acacttg-----aagagta----taaatc
K9IWB2_MCL1-01          ------gtggccaa-------acacttg-----aagagta----taaatc
K9IWB2_MCL1-03          ------gtggccaa-------acacttg-----aagagta----taaatc
C7F841_BCL2A1-02        aagcgaattgcccc-------agatgtg-----gaca-------cgtaca
C7F841_BCL2A1-01        aagcgaattgcccc-------agatgtg-----gaca-------cgtaca
A0A287APJ6_BCL2-03      ggagatgtcgcc---------cctggtg-----gacaacatcgccctgt-
A0A287APJ6_BCL2-01      gagcaagtggccaa-------acaaatt-----gttaaagatgccataca

O77737_BCL2L1-01        tgaa--------------------------------------tgaccacc
F1RZB9_BCL2L10-01       gggactgccgact-----cctggtggctttgctgtgcgctc-agctctca
A0A287AW74_BCL2L2-      tggagacacggctggccgactggatccacagcagtgggggc-tgggcg--
A0A287AW74_BCL2L2-      tggagacacggctggccgactggatccacagcagtgggggc-tgggagct
Q95KR3_MCL1-01          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-02          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-01          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
K9IWB2_MCL1-03          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
C7F841_BCL2A1-02        aggagattt-----cttactttgtcgc---------cgagt-tcatcacc
C7F841_BCL2A1-01        aggagattt-----cttactttgtcgc---------cgagt-tcatcacc
A0A287APJ6_BCL2-03      -ggatgactgagtacctgaaccggcac-------------c-tgcacacc
A0A287APJ6_BCL2-01      aggaaatttcaatagttccatcggctcagatgggtacatgc-tgtcctcc

O77737_BCL2L1-01        tagagcct-------tggatccagg------------agaacggc--ggc
F1RZB9_BCL2L10-01       gggcagcatcgcacctggctattgg------------cgaacggc--ggc
A0A287AW74_BCL2L2-      ----gagttcacagctctatacgggga-----------------------
A0A287AW74_BCL2L2-      ggaagcgatcaaagctcgagtcagggagatggaggaagaagctgagaagc
Q95KR3_MCL1-01          aggacaaaacgagactggct--agt------------caaacaaagaggc
K9IWB2_MCL1-02          aggacaaaacgagactggct--agt------------caaacaaagaggc
K9IWB2_MCL1-01          aggacaaaacgagactggct--agt------------caaacaaagaggc
K9IWB2_MCL1-03          aggacaaaacgagactggct--agt------------caaacaaagaggc
C7F841_BCL2A1-02        aaaaacacaggacagtggataaggc------------aaaacgga--ggc
C7F841_BCL2A1-01        aaaaacacaggacagtggataaggc------------aaaacgga--ggc
A0A287APJ6_BCL2-03      ---------------tggatccagg------------ataacgga--ggc
A0A287APJ6_BCL2-01      ctgacctgtgg--aatggctccagtaa-----cttccatcactgaagggc
                                       *       *                          

O77737_BCL2L1-01        t-----gg------------------------------------------
F1RZB9_BCL2L10-01       t-----gg------------------------------------------
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A287AW74_BCL2L2-      taaaggagctacagaacgaagtagagaagcagatgaatatgagtccacca
Q95KR3_MCL1-01          t-----gg------------------------------------------
K9IWB2_MCL1-02          t-----gg------------------------------------------
K9IWB2_MCL1-01          t-----gg------------------------------------------
K9IWB2_MCL1-03          t-----gg------------------------------------------
C7F841_BCL2A1-02        t--gggaa------------------------------------------
C7F841_BCL2A1-01        t--gggaa------------------------------------------
A0A287APJ6_BCL2-03      t-----gg------------------------------------------
A0A287APJ6_BCL2-01      tccagcag------------------------------------------

O77737_BCL2L1-01        ------------------------gacacttttgtggaactctacggaaa
F1RZB9_BCL2L10-01       ------------------------gatggatttt----gtctcttcttcc
A0A287AW74_BCL2L2-      -----------------------cggggccctggaggag-----------
A0A287AW74_BCL2L2-      ccaggcaatgctggcccagttatcatgtccattgaggagaagatggaggc
Q95KR3_MCL1-01          ------------------------gatgggtttgtggagttcttccatgt
K9IWB2_MCL1-02          ------------------------gatgggtttgtggagttcttccatgt
K9IWB2_MCL1-01          ------------------------gatgggtttgtggagttcttccatgt
K9IWB2_MCL1-03          ------------------------gatgggtttgtggagttcttccatgt
C7F841_BCL2A1-02        ------------------------aatggctttgtaaagaagttt-----
C7F841_BCL2A1-01        ------------------------aatggctttgtaaagaagttt-----
A0A287APJ6_BCL2-03      ------------------------gatgcctttgtggagctgtat-----
A0A287APJ6_BCL2-01      ------------------------gatgcctttgtggagctgtat-----

O77737_BCL2L1-01        caatg---------------------------------------cagcag
F1RZB9_BCL2L10-01       aaggttca------------------------------------ttgcaa
A0A287AW74_BCL2L2-      --------------------------gcgcggcgtctg------cgggag
A0A287AW74_BCL2L2-      agatgcccgatctatctatgttggcaatgtggactatggtgcaacagcag
Q95KR3_MCL1-01          agaggacc------------------------------------tagaag
K9IWB2_MCL1-02          agaggacc------------------------------------tagaag
K9IWB2_MCL1-01          agaggacc------------------------------------tagaag
K9IWB2_MCL1-03          agaggacc------------------------------------tagaag
C7F841_BCL2A1-02        ---gaacc------------------------------------caa---
C7F841_BCL2A1-01        ---gaacc------------------------------------caa---
A0A287APJ6_BCL2-03      ---gggcc------------------------------------cagcat
A0A287APJ6_BCL2-01      ---gggcc------------------------------------cagcat

O77737_BCL2L1-01        ctgagagccggaagggccaggaacgcttcaaccgat--------------
F1RZB9_BCL2L10-01       caaacttggacaaga---cacatggtctg---------------------
A0A287AW74_BCL2L2-      gggaactg------------------------------------------
A0A287AW74_BCL2L2-      aagagctggaagcacactttcatggctgtggttcagtcaaccgcgttact
Q95KR3_MCL1-01          gcggc----atcagaaatgtgct-gct-----------------------
K9IWB2_MCL1-02          gcggc----atcagaaatgtgct-gct-----------------------
K9IWB2_MCL1-01          gcggc----atcagaaatgtgct-gct-----------------------
K9IWB2_MCL1-03          gc------------------------------------------------
C7F841_BCL2A1-02        ---------atctgg------ctggct-----------------------
C7F841_BCL2A1-01        ---------atctgg------ctggct-----------------------
A0A287APJ6_BCL2-03      gcggcctctatttgatttctcctggct-----------------------
A0A287APJ6_BCL2-01      gcggcctctatttgatttctcctggct-----------------------

O77737_BCL2L1-01        ---------------------ggttcctg---------------------
F1RZB9_BCL2L10-01       ---------------------ggtttttgtg-------------------
A0A287AW74_BCL2L2-      ---------------------ggcc-------------------------
A0A287AW74_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcatatataga
Q95KR3_MCL1-01          ---------------------ggcttttgcaggtgttgc-----------
K9IWB2_MCL1-02          ---------------------ggcttttgcaggtgttgc-----------
K9IWB2_MCL1-01          ---------------------ggcttttgcaggtgttgc-----------
K9IWB2_MCL1-03          --------------------------------------------------
C7F841_BCL2A1-02        ---------------------gacctttgtggaagtta------------
C7F841_BCL2A1-01        ---------------------gacctttgtggaagtta------------
A0A287APJ6_BCL2-03      ---------------------g-tctctgaaggcgctgc-----------
A0A287APJ6_BCL2-01      ---------------------g-tctctgaaggcgctgc-----------

O77737_BCL2L1-01        ----------------acgggcatgac-----------------------
F1RZB9_BCL2L10-01       ----------------tcatactgtac-----------------------
A0A287AW74_BCL2L2-      ----------------tcagtgaggac-----------------------
A0A287AW74_BCL2L2-      gttctcagacaaagagtcagtgaggacttccttggccttagatgagtccc
Q95KR3_MCL1-01          ----------------tggagtaggag-----------------------
K9IWB2_MCL1-02          ----------------tggagtaggag-----------------------
K9IWB2_MCL1-01          ----------------tggagtaggag-----------------------
K9IWB2_MCL1-03          --------------------------------------------------
C7F841_BCL2A1-02        -----------------caggaaagat-----------------------
C7F841_BCL2A1-01        -----------------caggaaagat-----------------------
A0A287APJ6_BCL2-03      ----------------tcagtctggcc-----------------------
A0A287APJ6_BCL2-01      ----------------tcagtctggcc-----------------------

O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      ----------------------agtg------------------------
A0A287AW74_BCL2L2-      tatttagaggaagacaaatcaaggtgatcccaaaacgaaccaacagacca
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------

O77737_BCL2L1-01        ------------tctagctggggtggttctg-------------------
F1RZB9_BCL2L10-01       ---------------agcagtggtcttactc-------------------
A0A287AW74_BCL2L2-      -------------ctgacggggg------------------ccgtggc--
A0A287AW74_BCL2L2-      ggcatcagcacaacagaccggggttttccacgagctcgataccgtgcccg
Q95KR3_MCL1-01          -------------ctggtttg-----------------------------
K9IWB2_MCL1-02          -------------ctggtttg-----------------------------
K9IWB2_MCL1-01          -------------ctggtttg-----------------------------
K9IWB2_MCL1-03          --------------------g-----------------------------
C7F841_BCL2A1-02        -------------ct-gtgaaatgttatgtc-------------------
C7F841_BCL2A1-01        -------------ct-gtgaaatgttatgtc-------------------
A0A287APJ6_BCL2-03      -------------ctggtgggagcttgcatc-------------------
A0A287APJ6_BCL2-01      -------------ctggtgggagcttgcatc-------------------

O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
A0A287AW74_BCL2L2-      -----------------------------------------------act
A0A287AW74_BCL2L2-      gaccaccaactacaacagttcccgctctcgattctacagtggttttaaca
Q95KR3_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-02          --------------------------------------------------
K9IWB2_MCL1-01          --------------------------------------------------
K9IWB2_MCL1-03          --------------------------------------------------
C7F841_BCL2A1-02        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A287APJ6_BCL2-03      --------------------------------------------------
A0A287APJ6_BCL2-01      --------------------------------------------------

O77737_BCL2L1-01        -------ctgggttcgctcttcagtcggaa--------------------
F1RZB9_BCL2L10-01       ----------------tacttgtggagaaa--------------------
A0A287AW74_BCL2L2-      gggggccctg-----gtaactgtaggggcc--------------------
A0A287AW74_BCL2L2-      gcaggccccggggtcgtgtctacaggggccgggctagagcgacatcatgg
Q95KR3_MCL1-01          -----------------gcatatcta------------------------
K9IWB2_MCL1-02          -----------------gcatatcta------------------------
K9IWB2_MCL1-01          -----------------gcatatcta------------------------
K9IWB2_MCL1-03          -----------------gcatatcta------------------------
C7F841_BCL2A1-02        -----tcctg---------------aagca--------------------
C7F841_BCL2A1-01        -----tcctg---------------aagca--------------------
A0A287APJ6_BCL2-03      ----accctgg----gtgcctatctgggcc--------------------
A0A287APJ6_BCL2-01      ----accctgg----gtgcctatctgggcc--------------------

O77737_BCL2L1-01        --------atg-------------a
F1RZB9_BCL2L10-01       --------attattgtg-------a
A0A287AW74_BCL2L2-      ttttttgctagcaagtg-------a
A0A287AW74_BCL2L2-      tattccccttac---ta-------a
Q95KR3_MCL1-01          --------ataagatag--------
K9IWB2_MCL1-02          --------ataagatag--------
K9IWB2_MCL1-01          --------ataagatag--------
K9IWB2_MCL1-03          --------ataagatagccttttaa
C7F841_BCL2A1-02        --------atactattg-------a
C7F841_BCL2A1-01        --------atactattg-------a
A0A287APJ6_BCL2-03      --------ata--agtg-------a
A0A287APJ6_BCL2-01      --------ata--agtg-------a

© 1998-2019