Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C7F841_BCL2A1-01        atgactgacgacgagtttggatatattcaca---------tgctggccca
O77737_BCL2L1-01        atgtct---------------------cagagcaaccgggagctggtggt
A0A287ATE4_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
A0A3Q9B4M8_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
A0A482LX62_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
A0A4D6NWN1_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
A0A287ATE4_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
A0A287ATE4_BCL2L2-      atggcgaccc-cggcctcagccccagacaca-----cgggctctagtggc
F1RZB9_BCL2L10-01       atggcggacg-cgttcag-g----gagcgcacagcccggcttctgaccga
Q95KR3_MCL1-01          atgtttg--g-cctccagag----aaacgcagtaatcggactc--aacct
A0A287BK44_MCL1-02      atgtttg--g-cctccagag----aaacgcagtaatcggactc--aacct
A0A287BK44_MCL1-03      atgtttg--g-cctccagag----aaacgcagtaatcggactc--aacct
A0A287BK44_MCL1-01      atgtttg--g-cctccagag----aaacgcagtaatcggactc--aacct
                        ***                        *  *           *       

C7F841_BCL2A1-01        ggactatctgaagtatgtcctgca--------------------------
O77737_BCL2L1-01        tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
A0A287ATE4_BCL2L2-      agactttgtgggctataagctgaggcagaagggttatgtctg--------
A0A3Q9B4M8_BCL2L2-      agactttgtgggctataagatgaggcagaagggttatgtctg--------
A0A482LX62_BCL2L2-      agactttgtgggctataagctgaggcagaagggttatgtctg--------
A0A4D6NWN1_BCL2L2-      agactttgtgggctataagctgaggcagaagggttatgtctg--------
A0A287ATE4_BCL2L2-      agactttgtgggctataagctgaggcagaagggttatgtctg--------
A0A287ATE4_BCL2L2-      agactttgtgggctataagctgaggcagaagggttatgtctg--------
F1RZB9_BCL2L10-01       ctacctggagtactgcgcccgggagc------------------------
Q95KR3_MCL1-01          ctactgtgggggggccggattggggc------------------------
A0A287BK44_MCL1-02      ctactgtgggggggccggattggggc------------------------
A0A287BK44_MCL1-03      ctactgtgggggggccggattggggc------------------------
A0A287BK44_MCL1-01      ctactgtgggggggccggattggggc------------------------
                          **                                              

C7F841_BCL2A1-01        ----------------------------gatac---------------ca
O77737_BCL2L1-01        ttactgatgtggaagagaacagaactgaggccccagaagggactgaatca
A0A287ATE4_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
A0A3Q9B4M8_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
A0A482LX62_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
A0A4D6NWN1_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
A0A287ATE4_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
A0A287ATE4_BCL2L2-      -------------------tggagct--ggccccggggagggcc----ca
F1RZB9_BCL2L10-01       ------------------------cc--ggcaccgccgcg--------cg
Q95KR3_MCL1-01          ------------------------ct--ggaa-------g--------cg
A0A287BK44_MCL1-02      ------------------------ct--ggaa-------g--------cg
A0A287BK44_MCL1-03      ------------------------ct--ggaa-------g--------cg
A0A287BK44_MCL1-01      ------------------------ct--ggaa-------g--------cg
                                                    *                   * 

C7F841_BCL2A1-01        caacctggatct-----------------------------ggtccaagc
O77737_BCL2L1-01        gaagcggaaacccctagtgccatcaatggcaacccatcctggcacctggc
A0A287ATE4_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
A0A3Q9B4M8_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
A0A482LX62_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
A0A4D6NWN1_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
A0A287ATE4_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
A0A287ATE4_BCL2L2-      gcagctgacccgct---------------------------gcaccaagc
F1RZB9_BCL2L10-01       gcagc--cgtcctc---------------------------gcccgaggc
Q95KR3_MCL1-01          gcagcagc------------------------------------------
A0A287BK44_MCL1-02      gcagcagcgcctcc---------------------------gctccggga
A0A287BK44_MCL1-03      gcagcagcgcctcc---------------------------gctccggga
A0A287BK44_MCL1-01      gcagcagcgcctcc---------------------------gctccggga
                          * *                                             

C7F841_BCL2A1-01        a-------------------------------------------------
O77737_BCL2L1-01        ggacagccccgcggtgaatgga----------------------------
A0A287ATE4_BCL2L2-      c-------------------------------------------------
A0A3Q9B4M8_BCL2L2-      c-------------------------------------------------
A0A482LX62_BCL2L2-      c-------------------------------------------------
A0A4D6NWN1_BCL2L2-      c-------------------------------------------------
A0A287ATE4_BCL2L2-      c-------------------------------------------------
A0A287ATE4_BCL2L2-      c-------------------------------------------------
F1RZB9_BCL2L10-01       cgcagt--------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagg
A0A287BK44_MCL1-03      ggccgtctctt---------------------------------------
A0A287BK44_MCL1-01      ggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagg
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gggaggggaagccggcatggtgattggcggaagcgccggcgcgagccccc
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      gggaggggaagccggcatggtgattggcggaagcgccggcgcgagccccc
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccatt
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      cgtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccatt
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttctt
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      ggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttctt
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------gccactggccacagcagc------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------gctgcgttgcgtggctgc------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcct
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      cgcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcct
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggag
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      ccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggag
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cccctcgggaagcggccggccgtcctgcccttgctggggttagtcgagga
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      cccctcgggaagcggccggccgtcctgcccttgctggggttagtcgagga
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggccagtagtggccccggcacggacggctcgctcccctcgacgccgcccc
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      ggccagtagtggccccggcacggacggctcgctcccctcgacgccgcccc
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cggcagaggaggaggaggacgagttataccggcagtccctggagattatc
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      cggcagaggaggaggaggacgagttataccggcagtccctggagattatc
                                                                          

C7F841_BCL2A1-01        -------------------------------------------aaacatc
O77737_BCL2L1-01        agcttggatgcccgggaggtgatccccatggctgcagtgaagcaagcgct
A0A287ATE4_BCL2L2-      ------------------------------------------------at
A0A3Q9B4M8_BCL2L2-      ------------------------------------------------at
A0A482LX62_BCL2L2-      ------------------------------------------------at
A0A4D6NWN1_BCL2L2-      ------------------------------------------------at
A0A287ATE4_BCL2L2-      ------------------------------------------------at
A0A287ATE4_BCL2L2-      ------------------------------------------------at
F1RZB9_BCL2L10-01       -------------------------------ccagatacgggagtacaac
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      tctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaat
A0A287BK44_MCL1-03      --------------------ggcaaccggcgccaaggacgcgaagccaat
A0A287BK44_MCL1-01      tctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaat
                                                                          

C7F841_BCL2A1-01        tagagtgttacgagacg---------------------------------
O77737_BCL2L1-01        gagggaggcgggcgatg---------------------------------
A0A287ATE4_BCL2L2-      gcgggcagctggagatg---------------------------------
A0A3Q9B4M8_BCL2L2-      gcgggcagctggagatg---------------------------------
A0A482LX62_BCL2L2-      gcgggcagctggagatg---------------------------------
A0A4D6NWN1_BCL2L2-      gcgggcagctggagatg---------------------------------
A0A287ATE4_BCL2L2-      gcgggcagctggagatg---------------------------------
A0A287ATE4_BCL2L2-      gcgggcagctggagatg---------------------------------
F1RZB9_BCL2L10-01       gtgcgcaccttgt-------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gggcgggtctggggccgccagccggaaggcgttagagaccctgcgacggg
A0A287BK44_MCL1-03      gggcgggtctggggccgccagccggaaggcgttagagaccctgcgacggg
A0A287BK44_MCL1-01      gggcgggtctggggccgccagccggaaggcgttagagaccctgcgacggg
                                                                          

C7F841_BCL2A1-01        -----------tggctttctccgtccaaaacgaagttgaaaagaa---tt
O77737_BCL2L1-01        ---------------------agtttgaactgaggtaccggagggcattc
A0A287ATE4_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
A0A3Q9B4M8_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
A0A482LX62_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
A0A4D6NWN1_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
A0A287ATE4_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
A0A287ATE4_BCL2L2-      ---------------------agttcgagacccgcttccggcgcaccttc
F1RZB9_BCL2L10-01       ------------------------------ctgtctaccgcggcttccgc
Q95KR3_MCL1-01          --------------------------------gccttccaaggcatgctt
A0A287BK44_MCL1-02      tcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
A0A287BK44_MCL1-03      tcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
A0A287BK44_MCL1-01      tcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
                                                           *      *       

C7F841_BCL2A1-01        tgaaacc----------------atgcttggacaattttgatgt-tgtgt
O77737_BCL2L1-01        agtgacc----------------------tgacgtcccagctccacatca
A0A287ATE4_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
A0A3Q9B4M8_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
A0A482LX62_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
A0A4D6NWN1_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
A0A287ATE4_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
A0A287ATE4_BCL2L2-      tcagatt----------------------tggcagctcagttgcatgtga
F1RZB9_BCL2L10-01       tggaacc---------------------gtgtcgaattggtggcctgga-
Q95KR3_MCL1-01          cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag-
A0A287BK44_MCL1-02      cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag-
A0A287BK44_MCL1-03      cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag-
A0A287BK44_MCL1-01      cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag-
                            *                         * *                 

C7F841_BCL2A1-01        ccatagacactgccagaataatattc----aatcaagtgatggaaaagga
O77737_BCL2L1-01        ccccagggacagcgtatcagagcttt----gagcaggtattgaacgaact
A0A287ATE4_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
A0A3Q9B4M8_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
A0A482LX62_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
A0A4D6NWN1_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
A0A287ATE4_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
A0A287ATE4_BCL2L2-      ccccgggctcggcccagcagcgcttc----acccaggtctctgatgaact
F1RZB9_BCL2L10-01       ---------tggcacagaaactactcgcaagcccacgtggcc--------
Q95KR3_MCL1-01          ---------tgat----------------ggtccacgttttaagtg----
A0A287BK44_MCL1-02      ---------tgat----------------ggtccacgttttcagtg----
A0A287BK44_MCL1-03      ---------tgat----------------ggtccacgttttcagtg----
A0A287BK44_MCL1-01      ---------tgat----------------ggtccacgttttcagtg----
                                                         ** **            

C7F841_BCL2A1-01        atttgaagatggcatcattaactggggaaggattgtgaccatatttgcat
O77737_BCL2L1-01        cttccgggatggggtg---aactggggtcgcattgtggcctttttctcct
A0A287ATE4_BCL2L2-      cttccaaggaggcccc---aactggggccgccttgtggccttctttgtct
A0A3Q9B4M8_BCL2L2-      cttccaagggggcccc---aactggggccgccttgtggccttctttgtct
A0A482LX62_BCL2L2-      cttccaagggggcccc---aactggggccgccttgtggccttctttgtct
A0A4D6NWN1_BCL2L2-      cttccaagggggcccc---aactggggccgccttgtggccttctttgtct
A0A287ATE4_BCL2L2-      cttccaaggaggcccc---aactggggccgccttgtggccttctttgtct
A0A287ATE4_BCL2L2-      cttccaaggaggcccc---aactggggccgccttgtggccttctttgtct
F1RZB9_BCL2L10-01       --------------cc---aactggtaccgcgtggcatcactcttgacct
Q95KR3_MCL1-01          -----acggagtaaca---aactggggcaggattg--tgactcttatttc
A0A287BK44_MCL1-02      -----acggagtaaca---aactggggcaggattg--tgactcttatttc
A0A287BK44_MCL1-03      -----acggagtaaca---aactggggcaggattg--tgactcttatttc
A0A287BK44_MCL1-01      -----acggagtaaca---aactggggcaggattg--tgactcttatttc
                                           ******    *  * *      * **     

C7F841_BCL2A1-01        ttgaaggtattctcatgaagaaacttctgc-----gaaagcgaattgccc
O77737_BCL2L1-01        tcggtggggcactg-------------tgcgtggagagcgtagac--aag
A0A287ATE4_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
A0A3Q9B4M8_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
A0A482LX62_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
A0A4D6NWN1_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
A0A287ATE4_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
A0A287ATE4_BCL2L2-      tcggagctgcactg-------------tgtgctgagagtgtcaat--aag
F1RZB9_BCL2L10-01       tcgcagggatgctgctggaaagacatcctcgggaggcctgtgggcggaag
Q95KR3_MCL1-01          ttttggtgcctttg-tggccaaacactt----gaagagtataaatcaaga
A0A287BK44_MCL1-02      ttttggtgcctttg-tggccaaacactt----gaagagtataaatcaaga
A0A287BK44_MCL1-03      ttttggtgcctttg-tggccaaacactt----gaagagtataaatcaaga
A0A287BK44_MCL1-01      ttttggtgcctttg-tggccaaacactt----gaagagtataaatcaaga
                        *    *      *                      *              

C7F841_BCL2A1-01        cagatgtggacacgtacaaggagatttcttactttgtcgccgagtt----
O77737_BCL2L1-01        gagatgcaggtattggtgagtcggatcgcaacttggatggccactt----
A0A287ATE4_BCL2L2-      gagatggagccactcgtgggacaagtgcaggagtggatggtgacct----
A0A3Q9B4M8_BCL2L2-      gagatggagccactcgtgggacaagtgccggagtggatggtgacct----
A0A482LX62_BCL2L2-      gagatggagccactcgtgggacaagtgcaggagtggatggtgacct----
A0A4D6NWN1_BCL2L2-      gagatggagccactcgtgggacaagtgcaggagtggatggtgacct----
A0A287ATE4_BCL2L2-      gagatggagccactcgtgggacaagtgcaggagtggatggtgacct----
A0A287ATE4_BCL2L2-      gagatggagccactcgtgggacaagtgcaggagtggatggtgacct----
F1RZB9_BCL2L10-01       aagaaggagggcaacgttagcagggactgccgactcctggtggctttgct
Q95KR3_MCL1-01          aagctgcatcgaaccgttagcagaaagcatca----cagatgttctcg--
A0A287BK44_MCL1-02      aagctgcatcgaaccgttagcagaaagcatca----cagatgttctcg--
A0A287BK44_MCL1-03      aagctgcatcgaaccgttagcagaaagcatca----cagatgttctcg--
A0A287BK44_MCL1-01      aagctgcatcgaaccgttagcagaaagcatca----cagatgttctcg--
                         **  *             *                  *      *    

C7F841_BCL2A1-01        -----------catcaccaaaaacacaggacagtggataaggcaaaacgg
O77737_BCL2L1-01        ----------acctgaatgaccacctagagccttggatccaggagaacgg
A0A287ATE4_BCL2L2-      ----------acctggagacacggctggccgactggatccacagcagtgg
A0A3Q9B4M8_BCL2L2-      ----------acctggagacacggctggccgactggatccacagcagtgg
A0A482LX62_BCL2L2-      ----------acctggagacacggctggccgactggatccacagcagc--
A0A4D6NWN1_BCL2L2-      ----------acctggagtcacggctggccgactggatccacagcagtgg
A0A287ATE4_BCL2L2-      ----------acctggagacacggctggccgactggatccacagcagtgg
A0A287ATE4_BCL2L2-      ----------acctggagacacggctggccgactggatccacagcagtgg
F1RZB9_BCL2L10-01       gtgcgctcagctctcagggcagcatcg--cacctggctattggcgaacgg
Q95KR3_MCL1-01          -------------taaggacaaaa-cg--agactggctagtcaaacaaag
A0A287BK44_MCL1-02      -------------taaggacaaaa-cg--agactggctagtcaaacaaag
A0A287BK44_MCL1-03      -------------taaggacaaaa-cg--agactggctagtcaaacaaag
A0A287BK44_MCL1-01      -------------taaggacaaaa-cg--agactggctagtcaaacaaag
                                     *                   *** *            

C7F841_BCL2A1-01        aggctgggaa-----------aatggctt---------------------
O77737_BCL2L1-01        cggctgggac------acttttgtggaactctacggaaacaatg------
A0A287ATE4_BCL2L2-      gggctgggcg------gagttcacagctctatacggggacgggg------
A0A3Q9B4M8_BCL2L2-      gggctgggcg------gagttcacagctctatacggggacgggg------
A0A482LX62_BCL2L2-      -------------------------gcttcacccagg-------------
A0A4D6NWN1_BCL2L2-      gggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaag
A0A287ATE4_BCL2L2-      gggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaag
A0A287ATE4_BCL2L2-      gggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaag
F1RZB9_BCL2L10-01       cggctgggat-----ggattttgtctcttcttccaagg------------
Q95KR3_MCL1-01          aggctgggat-----gggtttgtggagttcttcca---------------
A0A287BK44_MCL1-02      aggctgggat-----gggtttgtggagttcttcca---------------
A0A287BK44_MCL1-03      aggctgggat-----gggtttgtggagttcttcca---------------
A0A287BK44_MCL1-01      aggctgggat-----gggtttgtggagttcttcca---------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      -------------------tct-------------------ctgatgaac
A0A4D6NWN1_BCL2L2-      aagctgagaagctaaaggagctacagaacgaagtagagaagcagatgaat
A0A287ATE4_BCL2L2-      aagctgagaagctaaaggagctacagaacgaagtagagaagcagatgaat
A0A287ATE4_BCL2L2-      aagctgagaagctaaaggagctacagaacgaagtagagaagcagatgaat
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------tgtaaa
O77737_BCL2L1-01        ----------------------------------------cagcagctga
A0A287ATE4_BCL2L2-      ----------------------------------------ccctggagga
A0A3Q9B4M8_BCL2L2-      ----------------------------------------ccctggagga
A0A482LX62_BCL2L2-      ---------------------------------------tcttccaagga
A0A4D6NWN1_BCL2L2-      atgagtccaccaccaggcaatgctggcccagttatcatgtccattgagga
A0A287ATE4_BCL2L2-      atgagtccaccaccaggcaatgctggcccagttatcatgtccattgagga
A0A287ATE4_BCL2L2-      atgagtccaccaccaggcaatgctggcccagttatcatgtccattgagga
F1RZB9_BCL2L10-01       ---------------------------------------ttcattgcaac
Q95KR3_MCL1-01          --------------------------------------------tgtaga
A0A287BK44_MCL1-02      --------------------------------------------tgtaga
A0A287BK44_MCL1-03      --------------------------------------------tgtaga
A0A287BK44_MCL1-01      --------------------------------------------tgtaga
                                                                          

C7F841_BCL2A1-01        gaagtttgaacccaaatctggct----------------ggctgaccttt
O77737_BCL2L1-01        gagccggaagggccaggaacgcttcaacc----------gatggttcctg
A0A287ATE4_BCL2L2-      g---------------gcgcggcgtctgcgggaggggaac-tgggcctca
A0A3Q9B4M8_BCL2L2-      g---------------gcgcggcgtctgcgggaggggaac-tgggcctca
A0A482LX62_BCL2L2-      g-------------------gccccaactggggccgccttgtggccttct
A0A4D6NWN1_BCL2L2-      gaagatggaggcagatgcccgatctatctatgttggcaatgtggactatg
A0A287ATE4_BCL2L2-      gaagatggaggcagatgcccgatctatctatgttggcaatgtggactatg
A0A287ATE4_BCL2L2-      gaagatggaggcagatgcccgatctatctatgttggcaatgtggactatg
F1RZB9_BCL2L10-01       aaacttgg--------acaagacacatgg----------tctgggttttt
Q95KR3_MCL1-01          ggacctagaaggcggcatcagaaatgtgc----------tgctggctttt
A0A287BK44_MCL1-02      ggacctagaaggcggcatcag-----------------------------
A0A287BK44_MCL1-03      ggacctagaaggcggcatcagaaatgtgc----------tgctggctttt
A0A287BK44_MCL1-01      ggacctagaaggcggcatcagaaatgtgc----------tgctggctttt
                                            *                             

C7F841_BCL2A1-01        gtg-----------------------------------------------
O77737_BCL2L1-01        acg-----------------------------------------------
A0A287ATE4_BCL2L2-      gtg------------------------------aggacagtgctgacggg
A0A3Q9B4M8_BCL2L2-      gtg------------------------------aggacagtgctgacggg
A0A482LX62_BCL2L2-      ttg-------------------------tcttcggagctg----------
A0A4D6NWN1_BCL2L2-      gtgcaacagcagaagagctggaagcacactttcatggctgtggttcagtc
A0A287ATE4_BCL2L2-      gtgcaacagcagaagagctggaagcacactttcatggctgtggttcagtc
A0A287ATE4_BCL2L2-      gtgcaacagcagaagagctggaagcacactttcatggctgtggttcagtc
F1RZB9_BCL2L10-01       gt------------------------------------------------
Q95KR3_MCL1-01          gca-----------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      gca-----------------------------------------------
A0A287BK44_MCL1-01      gca-----------------------------------------------
                                                                          

C7F841_BCL2A1-01        ---gaagttacaggaaagatctgtga------------------------
O77737_BCL2L1-01        ---ggcatgactcta-gctggggtggttctgctg----------------
A0A287ATE4_BCL2L2-      ggccgtggcactgggggccctggtaactgta-------------------
A0A3Q9B4M8_BCL2L2-      ggccgtggcactgggggccctggtaactgta-------------------
A0A482LX62_BCL2L2-      --------cactgtgtgctg------------------------------
A0A4D6NWN1_BCL2L2-      aaccgcgttactatactctgtgacaaatttagtggccatcccaaagggtt
A0A287ATE4_BCL2L2-      aaccgcgttactatactctgtgacaaatttagtggccatcccaaagggtt
A0A287ATE4_BCL2L2-      aaccgcgttactatactctgtgacaaatttagtggccatcccaaagggtt
F1RZB9_BCL2L10-01       ----gtcatactgta--cagcagtggtctta-------------------
Q95KR3_MCL1-01          ---ggtgttgctgga-gtaggagctggtttg-------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      ---ggtgttgctgga-gtaggagctggtttg-------------------
A0A287BK44_MCL1-01      ---ggtgttgctgga-gtaggagctggtttg-------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      ----------------------agagtgtcaataagg-------------
A0A4D6NWN1_BCL2L2-      tgcatatatagagttctcagacaaagagtcagtgaggacttccttggcct
A0A287ATE4_BCL2L2-      tgcatatatagagttctcagacaaagagtcagtgaggacttccttggcct
A0A287ATE4_BCL2L2-      tgcatatatagagttctcagacaaagagtcagtgaggacttccttggcct
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        -----aatgttatgtctcctgaagcaatactattga--------------
O77737_BCL2L1-01        -----ggttcgctcttcagtcggaaatga---------------------
A0A287ATE4_BCL2L2-      -----ggggccttttttgctag----------------------------
A0A3Q9B4M8_BCL2L2-      -----ggggccttttttgctag----------------------------
A0A482LX62_BCL2L2-      -agatggagcc--actcgtggga---------------------------
A0A4D6NWN1_BCL2L2-      tagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaacga
A0A287ATE4_BCL2L2-      tagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaacga
A0A287ATE4_BCL2L2-      tagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaacga
F1RZB9_BCL2L10-01       ---------ctctacttgtggagaaaattattgtga--------------
Q95KR3_MCL1-01          ---------gcatatctaataagatag-----------------------
A0A287BK44_MCL1-02      -------------atctaataagatagccttttaa---------------
A0A287BK44_MCL1-03      ---------gcatatctaataagatag-----------------------
A0A287BK44_MCL1-01      ---------gcatatctaataagatag-----------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      accaacagaccaggcatcagcacaacagaccggggttttccacgagctcg
A0A287ATE4_BCL2L2-      accaacagaccaggcatcagcacaacagaccggggttttccacgagctcg
A0A287ATE4_BCL2L2-      accaacagaccaggcatcagcacaacagaccggggttttccacgagctcg
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      ------------------caagtga-------------------------
A0A3Q9B4M8_BCL2L2-      ------------------caagtga-------------------------
A0A482LX62_BCL2L2-      ------------------caagtgcaggagt-------------------
A0A4D6NWN1_BCL2L2-      ataccgtgcccggaccaccaactacaacagttcccgctctcgattctaca
A0A287ATE4_BCL2L2-      ataccgtgcccggaccaccaactacaacagttcccgctctcgattctaca
A0A287ATE4_BCL2L2-      ataccgtgcccggaccaccaactacaacagttcccgctctcgattctaca
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      ----------------------ggatggtga-------------------
A0A4D6NWN1_BCL2L2-      gtggttttaacagcaggccccggggtcgtgtctacaggggccgggctaga
A0A287ATE4_BCL2L2-      gtggttttaacagcaggccccggggtcgtgtctacaggggccgggctaga
A0A287ATE4_BCL2L2-      gtggttttaacagcaggccccggggtcgtgtctaca--ggtcaggatag-
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-03      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        ---------------------------
O77737_BCL2L1-01        ---------------------------
A0A287ATE4_BCL2L2-      ---------------------------
A0A3Q9B4M8_BCL2L2-      ---------------------------
A0A482LX62_BCL2L2-      ---------------------------
A0A4D6NWN1_BCL2L2-      gcgacatcatggtattccccttactaa
A0A287ATE4_BCL2L2-      gcgacatcatggtattccccttactaa
A0A287ATE4_BCL2L2-      ---------------------------
F1RZB9_BCL2L10-01       ---------------------------
Q95KR3_MCL1-01          ---------------------------
A0A287BK44_MCL1-02      ---------------------------
A0A287BK44_MCL1-03      ---------------------------
A0A287BK44_MCL1-01      ---------------------------
                                                   

© 1998-2019