Dataset for CDS BCL2L2 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287AW74_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A287AW74_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A3Q9B4M8_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt

A0A287AW74_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A287AW74_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A3Q9B4M8_BCL2L2-      tgtgggctataagatgaggcagaagggttatgtctgtggagctggccccg
                        ************* ************************************

A0A287AW74_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A287AW74_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A3Q9B4M8_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga

A0A287AW74_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A287AW74_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A3Q9B4M8_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca

A0A287AW74_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A287AW74_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A3Q9B4M8_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg

A0A287AW74_BCL2L2-      atgaactcttccaaggaggccccaactggggccgccttgtggccttcttt
A0A287AW74_BCL2L2-      atgaactcttccaaggaggccccaactggggccgccttgtggccttcttt
A0A3Q9B4M8_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
                        **************** *********************************

A0A287AW74_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A287AW74_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A3Q9B4M8_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc

A0A287AW74_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A287AW74_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A3Q9B4M8_BCL2L2-      actcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
                        ***************** ********************************

A0A287AW74_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A287AW74_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
A0A3Q9B4M8_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
                        ********************************* *      * * *** *

A0A287AW74_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A287AW74_BCL2L2-      gctctatacgggga------------------------------------
A0A3Q9B4M8_BCL2L2-      gctctatacgggga------------------------------------
                        **** *  * ****                                    

A0A287AW74_BCL2L2-      gaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctg
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------

A0A287AW74_BCL2L2-      gcccagttatcatgtccattgaggagaagatggaggcagatgcccgatct
A0A287AW74_BCL2L2-      ----------cggggccctggaggag------------------------
A0A3Q9B4M8_BCL2L2-      ----------cggggccctggaggag------------------------
                                  *  * ** * ******                        

A0A287AW74_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
A0A287AW74_BCL2L2-      -------------gcgcggcgtctg------cgggaggggaactg-----
A0A3Q9B4M8_BCL2L2-      -------------gcgcggcgtctg------cgggaggggaactg-----
                                       * **  * **      * * **  ** ***     

A0A287AW74_BCL2L2-      acactttcatggctgtggttcagtcaaccgcgttactatactctgtgaca
A0A287AW74_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------

A0A287AW74_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A287AW74_BCL2L2-      --------ggcc--------------------------------------
A0A3Q9B4M8_BCL2L2-      --------ggcc--------------------------------------

A0A287AW74_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A287AW74_BCL2L2-      ---tcagtgaggac------------------------------------
A0A3Q9B4M8_BCL2L2-      ---tcagtgaggac------------------------------------

A0A287AW74_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A287AW74_BCL2L2-      ---------agtg-------------------------------------
A0A3Q9B4M8_BCL2L2-      ---------agtg-------------------------------------

A0A287AW74_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A287AW74_BCL2L2-      ctgacggggg------------------ccgtggc---------------
A0A3Q9B4M8_BCL2L2-      ctgacggggg------------------ccgtggc---------------
                        * *** ****                  ***** *               

A0A287AW74_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287AW74_BCL2L2-      ----------------------------------actgggggccctg---
A0A3Q9B4M8_BCL2L2-      ----------------------------------actgggggccctg---
                                                          ** *  ***** *   

A0A287AW74_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttac-
A0A287AW74_BCL2L2-      --gtaactgtaggggcc--------------------ttttttgctagca
A0A3Q9B4M8_BCL2L2-      --gtaactgtaggggcc--------------------ttttttgctagca
                          **  **  *******                    * **   **  * 

A0A287AW74_BCL2L2-      --taa
A0A287AW74_BCL2L2-      agtga
A0A3Q9B4M8_BCL2L2-      agtga
                          * *

© 1998-2019