Dataset for CDS BCL2A1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

C7F841_BCL2A1-02      atgactgacgacgagtttggatatattcacatgctggcccaggactatct
C7F841_BCL2A1-01      atgactgacgacgagtttggatatattcacatgctggcccaggactatct

C7F841_BCL2A1-02      gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat
C7F841_BCL2A1-01      gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat

C7F841_BCL2A1-02      ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag
C7F841_BCL2A1-01      ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag

C7F841_BCL2A1-02      aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc
C7F841_BCL2A1-01      aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc

C7F841_BCL2A1-02      cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca
C7F841_BCL2A1-01      cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca

C7F841_BCL2A1-02      ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg
C7F841_BCL2A1-01      ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg

C7F841_BCL2A1-02      aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga
C7F841_BCL2A1-01      aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga

C7F841_BCL2A1-02      gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
C7F841_BCL2A1-01      gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga

C7F841_BCL2A1-02      taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaaccc
C7F841_BCL2A1-01      taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaaccc

C7F841_BCL2A1-02      aaatctggctggctgacctttgtggaagttacaggaaagatctgtgaaat
C7F841_BCL2A1-01      aaatctggctggctgacctttgtggaagttacaggaaagatctgtgaaat

C7F841_BCL2A1-02      gttatgtctcctgaagcaatactattga
C7F841_BCL2A1-01      gttatgtctcctgaagcaatactattga

© 1998-2019