Dataset for CDS BCL-2 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287APJ6_BCL2-03      ---------------------------atggcg--cacgctg--------
A0A287APJ6_BCL2-01      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
                                                    *****  *  ****        

A0A287APJ6_BCL2-03      -------------------------------------------ggagaac
A0A287APJ6_BCL2-01      catggtgtctccgctcatcagccccaagcccctcgccctgcccggagctc
                                                                   ****  *

A0A287APJ6_BCL2-03      agggtatgataaccgggaaat--agtgat-----gaagtacat--ccact
A0A287APJ6_BCL2-01      atgtggtggttactggaggctccagcggcatcggaaagtgcattgccatt
                        * *   ** * ** **    *  ** *        **** ***  *** *

A0A287APJ6_BCL2-03      -------------------------------------------------a
A0A287APJ6_BCL2-01      gagtgctataaacaaggagcgtttataactctggttgcacgaaatgagga
                                                                         *

A0A287APJ6_BCL2-03      taagctgtcgcagagggg--------------------ctacgagtggga
A0A287APJ6_BCL2-01      caagctgttgcaggcaaagaaagaaattgaaaaacactctattaatgata
                         ******* ****                         ***  * **  *

A0A287APJ6_BCL2-03      tgccggagacg----------cgggcgccgcgtccccgggggccgctccc
A0A287APJ6_BCL2-01      aacaggtggtgctttgtatatcagttgatgtgtctc--aagactatagcc
                          * ** *  *          * *  *  * *** *    * *     **

A0A287APJ6_BCL2-03      gcaccgggcatcttctcctcccagcccgggcgaacccccgctcc------
A0A287APJ6_BCL2-01      aagtagagaatgtcataaaacaagcacaggagaaactgggcccagtggac
                             * * ** *  *    * *** * ** *** *   ** *       

A0A287APJ6_BCL2-03      --------------cgccaggacctcgccgcc----------gccgaccc
A0A287APJ6_BCL2-01      atgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatct
                                       **  * *  ** *   *          *  ** * 

A0A287APJ6_BCL2-03      cgaccgcccccgccgccaccgccgccgccgccgccgccgcggggcctgta
A0A287APJ6_BCL2-01      tga----------------------agttagtacttttgagaggctcatg
                         **                       *      *    * * ***   * 

A0A287APJ6_BCL2-03      ctcagcccggtgccacctg--tggtccacctgaccctgcgccaggccggc
A0A287APJ6_BCL2-01      --------agtgtcaactacctgggcagcgtgtacccgagccgag-cggt
                                 *** ** **   *** *  * **  ** * ***  * *** 

A0A287APJ6_BCL2-03      gatgacttctctcgtcgctaccgccgcgactttgccgagat---------
A0A287APJ6_BCL2-01      gatcaccaccatgaagg--agcgccgcg---tgggcaggatcgtcttcgt
                        *** **  *  *    *  * *******   * * *  ***         

A0A287APJ6_BCL2-03      ---------gtccagccagctgcacctgactcccttca------------
A0A287APJ6_BCL2-01      gtcctctcaggccgggcagctgggcctgttcggcttcacagcctactctt
                                 * ** * ******  ****     *****            

A0A287APJ6_BCL2-03      ccgcgaggggacgctttgccac---ggtggtgg-aggagctcttcaggga
A0A287APJ6_BCL2-01      cctcaaag------tttgccatcaggggattggcagaagctctgcagatg
                        ** * * *      *******    **   *** ** ****** ***   

A0A287APJ6_BCL2-03      tggggtgaactgggggaggatt--------gtggcct-------------
A0A287APJ6_BCL2-01      gaggtgaagccatataatgtttatgtcacagtggcctaccctccagacac
                          **   * *      * * **        *******             

A0A287APJ6_BCL2-03      -----tctttgagttcggtgggg---------tcatgtgtgtggaga-gc
A0A287APJ6_BCL2-01      agacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactc
                              *  ** *** *  *  *          ** *  * ******  *

A0A287APJ6_BCL2-03      gtc---------------------------aaccgggagatgtcgcc--c
A0A287APJ6_BCL2-01      gtcttatttcagagaccacatctgtttgcaaaccagagcaagtggccaaa
                        ***                           **** *   * ** ***   

A0A287APJ6_BCL2-03      ctggtggacaacatcgccctgt--ggatgactgagtacctgaaccggcac
A0A287APJ6_BCL2-01      caaattgttaaagatgccatacaaggaaatttcaatagttccatcggctc
                        *   * *  **    *** *    ***    * * **  *  * **** *

A0A287APJ6_BCL2-03      -------------ctgcacacc-------------tggatccagg-----
A0A287APJ6_BCL2-01      agatgggtacatgctgtcctccctgacctgtggaatggctccagtaactt
                                     ***  * **             *** *****      

A0A287APJ6_BCL2-03      --ataacgga--ggct-----gggatgcctttgtggagctgtatgggccc
A0A287APJ6_BCL2-01      ccatcactgaagggctccagcaggatgcctttgtggagctgtatgggccc
                          ** ** **  ****      ****************************

A0A287APJ6_BCL2-03      agcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgct
A0A287APJ6_BCL2-01      agcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgct
                        **************************************************

A0A287APJ6_BCL2-03      cagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggcc
A0A287APJ6_BCL2-01      cagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggcc
                        **************************************************

A0A287APJ6_BCL2-03      ataagtga
A0A287APJ6_BCL2-01      ataagtga
                        ********

© 1998-2018