Dataset for CDS BCL-2-like of organism Stegastes partitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4Z3X2_BCL2L1-      ---------atgtctcaa---aacagagaactggtggtttactacataaa
A0A3B4Z3X2_BCL2L1-      ---------atgtctcaa---aacagagaactggtggtttactacataaa
A0A3B5B4X7_BCL2L1-      atggaaataatgtcgtacagtaacagagagctagtggagttctttataag
A0A3B5BBQ0_BCL2-01      atggcga--acg----agtgtaatcgcaatattgtggaaaagtatatctg
A0A3B4ZFS0_BCL2L10      ---------atg------------------------------------tc
A0A3B4ZKP6_MCL1-01      ---------atg----aacattattccga---cgacgaaacggacggcgc
                                 * *                                      

A0A3B4Z3X2_BCL2L1-      gtataaactctcccagagaaactatcccctc-aatcacatggtgct--ca
A0A3B4Z3X2_BCL2L1-      gtataaactctcccagagaaactatcccctc-aatcacatggtgct--ca
A0A3B5B4X7_BCL2L1-      ctacaagctgtctcaaaggaactatccaacg-tctctgctgaggcc--gg
A0A3B5BBQ0_BCL2-01      ccataaactctccaaacggggctacgcgtggggctttgatgatgtccggg
A0A3B4ZFS0_BCL2L10      ctgtgggct-----------------------at--------------gg
A0A3B4ZKP6_MCL1-01      tcatgagct-----------------------gctttattcttcctcaaa
                               **                                         

A0A3B4Z3X2_BCL2L1-      atgaggctcccaacaggactgacgggggggaggc----------------
A0A3B4Z3X2_BCL2L1-      atgaggctcccaacaggactgacgggggggaggc----------------
A0A3B5B4X7_BCL2L1-      aggatgctgcaggaaggactgagggagacaagac----------------
A0A3B5BBQ0_BCL2-01      atgaagatgctgctaa---taacgggtcagtagttgaccctccgccgact
A0A3B4ZFS0_BCL2L10      aaagagaccttggttg---tggcagagg-actac--------ctgtccct
A0A3B4ZKP6_MCL1-01      atggagtcgttga--g---ggacagatgcactacggatcaggagatccct
                        *    *                  *                         

A0A3B4Z3X2_BCL2L1-      -----------------------------------------------gag
A0A3B4Z3X2_BCL2L1-      -----------------------------------------------gag
A0A3B5B4X7_BCL2L1-      -----------------------------------------------caa
A0A3B5BBQ0_BCL2-01      ttggtgcgccggtgc-cat----------------------------gaa
A0A3B4ZFS0_BCL2L10      gtgctgcacaagcccacat-------------------------------
A0A3B4ZKP6_MCL1-01      ---ccgcacagatccccatggcctcccctttggactcacacaacgggaat
                                                                          

A0A3B4Z3X2_BCL2L1-      gttggctg--aggaacagcggacagagacacacgccaacgggacttttaa
A0A3B4Z3X2_BCL2L1-      gttggctg--aggaacagcggacagagacacacgccaacgggacttttaa
A0A3B5B4X7_BCL2L1-      ctctgctgccagtaacggcttgctgg--------------------tgaa
A0A3B5BBQ0_BCL2-01      gccagca-ccgggcccgacaacgagagcgacc--------------ccca
A0A3B4ZFS0_BCL2L10      -tcagcc-cc------------------------------------tcca
A0A3B4ZKP6_MCL1-01      gtcggct-ccggcgccaccccgaagaggcccaagaacctgggagtgtcca
                            **                                           *

A0A3B4Z3X2_BCL2L1-      tggcacgagtcccgggaccccgccgccgtccccgcggcggt---------
A0A3B4Z3X2_BCL2L1-      tggcacgagtcccgggaccccgccgccgtccccgcggcggt---------
A0A3B5B4X7_BCL2L1-      cagca----------------------------gaggcgg----------
A0A3B5BBQ0_BCL2-01      c------------ctctgcagacggctccc--ccagtccga---------
A0A3B4ZFS0_BCL2L10      c------------------------ctcccagcgagtcagc---------
A0A3B4ZKP6_MCL1-01      cgacgaacgggtttgcgggaaagggcctccgacaggtcagcgacagcctg
                                                           * * *          

A0A3B4Z3X2_BCL2L1-      tggcgtcgacggcgaccatggac---------------------------
A0A3B4Z3X2_BCL2L1-      tggcgtcgacggcgaccatggac---------------------------
A0A3B5B4X7_BCL2L1-      ----------------catagag---------------------------
A0A3B5BBQ0_BCL2-01      ----cccgcacgctgccatccac---------------------------
A0A3B4ZFS0_BCL2L10      ----------cgctgccat-------------------------------
A0A3B4ZKP6_MCL1-01      gaggacagctcgctaccgtgcactccggagctacagtcggacagtgaaac
                                        * *                               

A0A3B4Z3X2_BCL2L1-      -------------------gcggtgaaggaggccctccggga------ca
A0A3B4Z3X2_BCL2L1-      -------------------gcggtgaaggaggccctccggga------ca
A0A3B5B4X7_BCL2L1-      -------------------gctgtaaaagcagcgcttaagga------ct
A0A3B5BBQ0_BCL2-01      -----------agagtcctgcgggaggc-------tggagac--------
A0A3B4ZFS0_BCL2L10      ---------gaggtgcctggcccaggaca------tggagaagcagcacc
A0A3B4ZKP6_MCL1-01      cgacgtgtcgagttgcccggcgggggacgaggtgctggagaa-tgacacg
                                           **              *   *          

A0A3B4Z3X2_BCL2L1-      cggccaacgagttcgagctgcg-------gtacgcccgcgccttcagcga
A0A3B4Z3X2_BCL2L1-      cggccaacgagttcgagctgcg-------gtacgcccgcgccttcagcga
A0A3B5B4X7_BCL2L1-      cggcagatgagtttgaacttct-------cttcacgcaagcttttagtga
A0A3B5BBQ0_BCL2-01      --------------gaacttgaaagactgtaccagccggactt-------
A0A3B4ZFS0_BCL2L10      aggc----------tcgcttcc---actccctcactcagacctt------
A0A3B4ZKP6_MCL1-01      aggcaactgattagcagcttcctaaaagactttact-ggactttcaaagc
                                         **                     * *       

A0A3B4Z3X2_BCL2L1-      cctg------cacagccagctgcacatcacgccggccaccgcctaccaaa
A0A3B4Z3X2_BCL2L1-      cctg------cacagccagctgcacatcacgccggccaccgcctaccaaa
A0A3B5B4X7_BCL2L1-      cctg------tcttcacagcttgacatcactcctgacacggcctaccaca
A0A3B5BBQ0_BCL2-01      cacggagatgtccaggcagctgtatctcacctccaccacggcgcagagga
A0A3B4ZFS0_BCL2L10      cctgaggcagcccgggcc---ggacctctgctccagc------ctcagga
A0A3B4ZKP6_MCL1-01      ctcggtggaacgagggca---aagcattatctacaa--------tgaaaa
                        *  *            *         *                      *

A0A3B4Z3X2_BCL2L1-      gcttcgagaacg------------------------------------tg
A0A3B4Z3X2_BCL2L1-      gcttcgagaacg------------------------------------tg
A0A3B5B4X7_BCL2L1-      gcttcaagagtg------------------------------------tg
A0A3B5BBQ0_BCL2-01      gattcgccgagg------------------------------------tg
A0A3B4ZFS0_BCL2L10      gggtgatggaggagctggtggga--------------------------g
A0A3B4ZKP6_MCL1-01      gagttgtggaggacgttttggaaaagcacagatacgcgtacaacggtatg
                        *  *       *                                     *

A0A3B4Z3X2_BCL2L1-      atggacgaggtgttccgggacggcgtcaactggggccgcatcgtagggct
A0A3B4Z3X2_BCL2L1-      atggacgaggtgttccgggacggcgtcaactggggccgcatcgtagggct
A0A3B5B4X7_BCL2L1-      atggacgaggtgttcaaggatggggtcaactggggacgtatagtgggcct
A0A3B5BBQ0_BCL2-01      atagacgaactgttccgggacggggtgaactggggccggattatcgcttt
A0A3B4ZFS0_BCL2L10      atggaca--------cttga--------actgggggagggttgtttccct
A0A3B4ZKP6_MCL1-01      atcaacaaactgtcgctggatg------acagaggggacgatgtgtcgtt
                        **  **            **        ** * **        *     *

A0A3B4Z3X2_BCL2L1-      tttcgcgttcggcggggcgctg--------------tgtgtcgagtgcgt
A0A3B4Z3X2_BCL2L1-      tttcgcgttcggcggggcgctg--------------tgtgtcgagtgcgt
A0A3B5B4X7_BCL2L1-      gttttgctttggcggtgtactg--------------tgtgtggaatgcgt
A0A3B5BBQ0_BCL2-01      cttcgagtt--cgggggaaccg------------tgtgcgtcgagtgcgc
A0A3B4ZFS0_BCL2L10      tttcacctttactggggtgctg--gccagacagctgcaggagcagaggga
A0A3B4ZKP6_MCL1-01      tgtca-----------gtgccgtagccaagagcctcttcgcagacaggac
                          *             *  * *                 *   *  *   

A0A3B4Z3X2_BCL2L1-      cgagaa---ggagatgagccccctggt-------------gggccggatc
A0A3B4Z3X2_BCL2L1-      cgagaa---ggagatgagccccctggt-------------gggccggatc
A0A3B5B4X7_BCL2L1-      agacaa---gaatatgaacgagctggt-------------tccccgcatc
A0A3B5BBQ0_BCL2-01      ggccaaagaggagat---------gacgtcgcaggt----ggacaacatc
A0A3B4ZFS0_BCL2L10      cacgaagccggggctggaacccgggaagcggcaggaactgggacaggggc
A0A3B4ZKP6_MCL1-01      caccaa-ctggggtcgcatcaccagcc-tggtggccttcggggcagtggt
                            **   *              *                  *      

A0A3B4Z3X2_BCL2L1-      -----------------------gtagagtggatgacggtttacctgg--
A0A3B4Z3X2_BCL2L1-      -----------------------gtagagtggatgacggtttacctgg--
A0A3B5B4X7_BCL2L1-      -----------------------gcagactggatgaccatgtacctgg--
A0A3B5BBQ0_BCL2-01      -----------------------gcggagtggatgacggagtattt----
A0A3B4ZFS0_BCL2L10      ---ccgtaaactgcaggggactggcagagaccatagctgattacctgg--
A0A3B4ZKP6_MCL1-01      gtgccagtacctgaaggagaggggcagggagaactgc-gtcgacctggtg
                                               *  *     *   *     *  *    

A0A3B4Z3X2_BCL2L1-      -acaaccacatt------------------------caggactggatcca
A0A3B4Z3X2_BCL2L1-      -acaaccacatt------------------------caggactggatcca
A0A3B5B4X7_BCL2L1-      -atgagcacatc------------------------agtctgtggatcca
A0A3B5BBQ0_BCL2-01      -aaatggacctcttaaca----------------------gctggataca
A0A3B4ZFS0_BCL2L10      -gagaggaga------------------------agaaagactggctgtt
A0A3B4ZKP6_MCL1-01      agcgaggagatttccacatacctgctctgcgatcagcgagactggctggt
                               *                                  *** *   

A0A3B4Z3X2_BCL2L1-      gagccaaggcggatgggaccgcttcgctgaaatcttcggccaggacgcgg
A0A3B4Z3X2_BCL2L1-      gagccaaggcggatgggaccgcttcgctgaaatcttcggccaggacgcgg
A0A3B5B4X7_BCL2L1-      aagccaaggaggatgggagtgctttgctgaaattttcgggcaagacgccg
A0A3B5BBQ0_BCL2-01      ggataacgggggatgggacgcctttgtggagctgt--------------a
A0A3B4ZFS0_BCL2L10      ggagaacgatggatgggaaggcttcgttaagttctcc--------ctcag
A0A3B4ZKP6_MCL1-01      gaagaacaactcatgggatggctttgtagagtttttc--------c----
                             *      ******   *** *   *  * *               

A0A3B4Z3X2_BCL2L1-      cagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtg
A0A3B4Z3X2_BCL2L1-      cagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtg
A0A3B5B4X7_BCL2L1-      ccgcagaagcacggagatctcgggattctctgaagcgatggctgctagtc
A0A3B5BBQ0_BCL2-01      tgacagacagaggga---ctcagt----cttcagttgctcttggccctcc
A0A3B4ZFS0_BCL2L10      tgccagagaggtgag---tcagga----ctt------------gtccatg
A0A3B4ZKP6_MCL1-01      -----gagtggcaga---ccctga----act------------gacggtc
                             **               *       *            *      

A0A3B4Z3X2_BCL2L1-      gggatgacggtggt------gaccggggtcgtggtcggttcgctcatcg-
A0A3B4Z3X2_BCL2L1-      gggatgacggtggt------gaccggggtcgtggtcggttcgctcatcg-
A0A3B5B4X7_BCL2L1-      ggaggggcgctgct------aacgggagtgctggctggtgtgctcatcg-
A0A3B5BBQ0_BCL2-01      atcaagacggtcttcggtctggcagcactcggggcagcgagcctcaccat
A0A3B4ZFS0_BCL2L10      aagacagcgctgtttgctgctgctggtgtcggcctcgctggactcacctt
A0A3B4ZKP6_MCL1-01      aggaacacactcatggcctttgctggatttgccggtattggggcgacact
                               *  *  *        * *   *                *    

A0A3B4Z3X2_BCL2L1-      --------cccagaaacgcctg---tga
A0A3B4Z3X2_BCL2L1-      --------cccagaaacgcctg---tga
A0A3B5B4X7_BCL2L1-      --------ctaagaaaca---g---tga
A0A3B5BBQ0_BCL2-01      cggagcgtaccttacacaaaag---tga
A0A3B4ZFS0_BCL2L10      cc------tcctggtgcgctag------
A0A3B4ZKP6_MCL1-01      gg------ccctgctgatcaggtcatga
                                             *      

© 1998-2019