Dataset for CDS BCL-2-like of organism Seriola lalandi dorsalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4YAG2_BCL2-01      atg------------gcgagcgagtataatcgcaatattgtggaaaagt-
A0A3B4WGF4_BCL2L10      atg--tcatg-cgggctgtggaaagagacccgggctgtggcagaggacta
A0A3B4XS24_BCL2L1-      atg--tc--------gtacagcaacaga----------------gagct-
A0A3B4XKA5_MCL1-01      atgaatcttatccaggcaccgaaacaggccgctttaaccgccgtgaacta
A0A3B4XU17_BCL2L1-      atg--tct-----------caaaacaga----------------gaact-
                        ***                   *  *                      * 

A0A3B4YAG2_BCL2-01      ---------------acatctgccat------------------------
A0A3B4WGF4_BCL2L10      cct-gttcctttgctgcac-------------------------------
A0A3B4XS24_BCL2L1-      ----ggtggagttcttcataagctac------------------------
A0A3B4XKA5_MCL1-01      ttgcatttgtcgtcaaaatggaggattggagacttggagggacagctccg
A0A3B4XU17_BCL2L1-      ----ggtcgttttctacataaagtat------------------------
                                         *                                

A0A3B4YAG2_BCL2-01      -aaactctccaaacggggatacgtgtggggat------------------
A0A3B4WGF4_BCL2L10      -aagccc----------acagccagcccctccacct--------------
A0A3B4XS24_BCL2L1-      -aaactgtctcaaagtaactgccc----aacctcactgc-----------
A0A3B4XKA5_MCL1-01      gagactcctcgccggagattgccattggctctacattatgttgtgacaac
A0A3B4XU17_BCL2L1-      -aagctctcccagagaaactatcctctcacccacat--------------
                         *  *                                             

A0A3B4YAG2_BCL2-01      -ttgatgatgtccgagatgaagatgctgctaataatggctcaatagttgc
A0A3B4WGF4_BCL2L10      ------------cccagcgaatcagccgct---gccatgagaggcatggc
A0A3B4XS24_BCL2L1-      -tgag------gccagaggatgctggtggaaggactgagggagacaaggc
A0A3B4XKA5_MCL1-01      gggaatgttgtgccaaatgataattctaaacggcccaagagcctggaagt
A0A3B4XU17_BCL2L1-      -ggaa-------ctcaatgagtctcccaacaggactgatggcggggaggc
                                    *     **                            * 

A0A3B4YAG2_BCL2-01      ccctccaccgactttggtccgccggtgccgtgaagccaaca-------cc
A0A3B4WGF4_BCL2L10      cc--------------aagacatggag------acgcagca---------
A0A3B4XS24_BCL2L1-      cagctcagctgccagtaatggcttgtt------ggtcaaca---------
A0A3B4XKA5_MCL1-01      cacctc----------aacaaatgggt------atgcaacaaaagcgagt
A0A3B4XU17_BCL2L1-      -----------------agggttggtt------gaggaaca---------
                                                *            * **         

A0A3B4YAG2_BCL2-01      gggcctgacaacgacagctcacctaacctctgc-----------------
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3B4XS24_BCL2L1-      -------gcagtgacag---------------------------------
A0A3B4XKA5_MCL1-01      cgggaggacagcgacgt-cgacgacggctctttgccgtgtactccggaga
A0A3B4XU17_BCL2L1-      ---gcggatagcgacgcacgccaatggaacttt-----------------
                                                                          

A0A3B4YAG2_BCL2-01      -------agacggc----------------------------------tc
A0A3B4WGF4_BCL2L10      ---------------------------------------ccaggctcgct
A0A3B4XS24_BCL2L1-      -------gtgtggt----------------------cagcccgggacgtc
A0A3B4XKA5_MCL1-01      tgcagtcggatggcgaaaccgacgtccctagttgtccagctggggaagtg
A0A3B4XU17_BCL2L1-      -------taatggc-------acg----------------------agtc
                                                                          

A0A3B4YAG2_BCL2-01      tctcagtccgac--------------------------------------
A0A3B4WGF4_BCL2L10      tccacaccc-----------------------------------------
A0A3B4XS24_BCL2L1-      ctcgcccccg----------------------------------------
A0A3B4XKA5_MCL1-01      ttggagtccgatacgagtcaactcattagccagtccatgaaaagctttac
A0A3B4XU17_BCL2L1-      ctgggacccgtccagagtccccgca-------------------------
                               **                                         

A0A3B4YAG2_BCL2-01      -------------------------------------ccgcacgccgaga
A0A3B4WGF4_BCL2L10      --------------------------------------------------
A0A3B4XS24_BCL2L1-      -----------catggtggc-----------------atagaggccgtaa
A0A3B4XKA5_MCL1-01      cggacggtcgatacagcggcggactgaacacagagcactacaaacaatga
A0A3B4XU17_BCL2L1-      ---gcggcagcaacggctgccgtc--aacaacgagc-ctggacgcagtga
                                                                          

A0A3B4YAG2_BCL2-01      tccacagagtcctgcgcgaggctggagacgaacttgagagattataccag
A0A3B4WGF4_BCL2L10      ---------ttgctcaaacctttgtaacgcagtgtggg------------
A0A3B4XS24_BCL2L1-      ---agtcagcccttaaggactctgctgacgaatttgaattgctcttcaac
A0A3B4XKA5_MCL1-01      ---agagggttgt---gg--------aaggcgttttgg-aaaaacacaga
A0A3B4XU17_BCL2L1-      ---aagaggccctccgggattccgccaacgagtttgagttgcgatactcc
                                                          *               

A0A3B4YAG2_BCL2-01      ccggacttcacggagatgtcgcggcagctctatctcacctccaccac---
A0A3B4WGF4_BCL2L10      ---------------------------------------ctggaccc---
A0A3B4XS24_BCL2L1-      caagcatttagtgacctttccacgcagcttgacatcactcctgacac---
A0A3B4XKA5_MCL1-01      tacgcatacaatggtatgatcaacaaactgt------cactggacaacag
A0A3B4XU17_BCL2L1-      cgcgccttcagcgatctgcacaaccagctgcatatcacgccggccac---
                                                                    *     

A0A3B4YAG2_BCL2-01      ---ggcgcagagaagattcgccgaggttatagacgaac----tgttccgg
A0A3B4WGF4_BCL2L10      ------ctgctccagcctcaggaaggtgatggaggagc----tggtggga
A0A3B4XS24_BCL2L1-      ---tgcataccacagctttaagagtgtgatggatgagt----tgttcaag
A0A3B4XKA5_MCL1-01      aggggatgatgtgaggtttgtcggtgcagtag-cgaagagcctgttcgca
A0A3B4XU17_BCL2L1-      ---agcttaccaaagctttgcgaacgtgatggatgaag----tgttccgg
                                     **  *       *   * *  **      ** *    

A0A3B4YAG2_BCL2-01      gacggggtg---aactggggccggattatcgctttcttcgagttcggggg
A0A3B4WGF4_BCL2L10      gatggacacttgaactgggggagggttgtttccattttcacctttactgg
A0A3B4XS24_BCL2L1-      gatggagtc---aactggggacgtatagtgggcctgtttgcctttggggg
A0A3B4XKA5_MCL1-01      gatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggt
A0A3B4XU17_BCL2L1-      gatggcttc---aactggggccgcatcatagggctttttgtgttcggcgg
                        ** **       ********  *  *        *  *    **    * 

A0A3B4YAG2_BCL2-01      cacggtgtgc------gttgagtgcgcggccaaggaggaga-tgacatcg
A0A3B4WGF4_BCL2L10      ggtgctg---------gccagactgctgctggagcagaaccgtgtgaacc
A0A3B4XS24_BCL2L1-      tgtactgtgt------gtggaatgcatacagaagaata----tgagcgag
A0A3B4XKA5_MCL1-01      ggtggtgtgtcagcacatgaaggacacaggcagggagaactgtgtggaat
A0A3B4XU17_BCL2L1-      ggcgctgtgt------gtcgagtgtgtggagaaggaga----tgagtcct
                             **                          * *      **      

A0A3B4YAG2_BCL2-01      cagg---------tggacaacatc--------------------------
A0A3B4WGF4_BCL2L10      cggggctggaccctgggcagggacaggggctcagaaactgcaggggactg
A0A3B4XS24_BCL2L1-      ctgg---------tttcccgtatc--------------------------
A0A3B4XKA5_MCL1-01      ctgt---------ggggcagga----------------------------
A0A3B4XU17_BCL2L1-      ctgg---------tgggcaggatc--------------------------
                        * *              *                                

A0A3B4YAG2_BCL2-01      gtggagtggatgacggagtatttaaatggacctcttaacagc-----tgg
A0A3B4WGF4_BCL2L10      gcagagaccatagctgattacctgggagaagaga-----agaaagactgg
A0A3B4XS24_BCL2L1-      gcagactggatgaccatgtacctggatgagcaca---tcagtccg--tgg
A0A3B4XKA5_MCL1-01      --------gatctccaaatacctg-----ctgtctgatcagcgagactgg
A0A3B4XU17_BCL2L1-      gtagagtggatgaccgtctacctggacaaccgcat--tcagcca---tgg
                                 **  *    **  *                **      ***

A0A3B4YAG2_BCL2-01      ataaaggataacggggga----tgggatgcctttgtggagctgtatgaca
A0A3B4WGF4_BCL2L10      ctgctggagaacggtgga----tgggaggggttctgtaagttctcc----
A0A3B4XS24_BCL2L1-      atccagagccaaggaggc----tgggactgctttgctgagatgtttgggc
A0A3B4XKA5_MCL1-01      ct----ggtgaaaaacaactcctgggatggatttgtatcgttctttcg--
A0A3B4XU17_BCL2L1-      atccagagtcaaggagga----tgggagcgatttgctgaaatctttgggc
                         *        *           *****    **        * *      

A0A3B4YAG2_BCL2-01      gacagagggagtccgtcttcagttgctcctggc--cctccatcaagacag
A0A3B4WGF4_BCL2L10      ----cacagtgccaga---gaggtgagccaggacttgtcgatgaagacag
A0A3B4XS24_BCL2L1-      aagacgccgctgcagaagcgaggagatctcggg--aggctgtgaggag--
A0A3B4XKA5_MCL1-01      -------agtagcagacc-cag--agtctaaag--tgag------gaaca
A0A3B4XU17_BCL2L1-      aggacgcagcagcagacagcaggaggtctcagg--agagttttaagaa--
                                *   * *     **     *                 **   

A0A3B4YAG2_BCL2-01      tcttcggcctggctgcactcgg----------ggcagcgagcctcaccat
A0A3B4WGF4_BCL2L10      cactat---ttgctgctgctggtgt---------------gggcctcgct
A0A3B4XS24_BCL2L1-      -----g---tggctgctagttggagtggcgatgttggcaggagtgctgat
A0A3B4XKA5_MCL1-01      cactca---tggcctttgctggatttg----cgggaatcggcgcaacact
A0A3B4XU17_BCL2L1-      -----g---tggctgctggcggggatgaccctggtgaccggggttgtggt
                                 * **        *                  *        *

A0A3B4YAG2_BCL2-01      cggagcataccttacacagaag----------tga
A0A3B4WGF4_BCL2L10      ggactcacctttc-tcctggtgcgc-------tag
A0A3B4XS24_BCL2L1-      gggcgtgctcatcgttaagaaacat-------taa
A0A3B4XKA5_MCL1-01      ggccctgttgatc-------agcgccatgatgtga
A0A3B4XU17_BCL2L1-      gggctcactgatcgcccaaaagcgcc----tgtga
                         *         *                    *  

© 1998-2019