Dataset for CDS BCL-2-like of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9CJ81_MCL1-01      atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccgg
A0A2U9BIG9_BCL2L1-      atgtcggacagta---acagagagctggtcgagttcttcatc--------
A0A2U9BY16_BCL2L1-      atgtct--cag-a---acaaagaactggtggttttctacata--------
                        ***     **       ** * * * **  *  ***  * *         

A0A2U9CJ81_MCL1-01      agtcatgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A2U9BIG9_BCL2L1-      ggctataagctgtcccag--------------------------------
A0A2U9BY16_BCL2L1-      cagtataaactctcccag--------------------------------
                            **   **  * **                                 

A0A2U9CJ81_MCL1-01      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccgtg
A0A2U9BIG9_BCL2L1-      -------------aggaactacccgacctctctac----tgaggccggag
A0A2U9BY16_BCL2L1-      -------------aggaaatat----cctctcaaccatatgggacttaat
                                     ***** *      ** *    *    ** *       

A0A2U9CJ81_MCL1-01      atcgactcccgcggcgggaacgtcggcgccggggacgccccg--------
A0A2U9BIG9_BCL2L1-      ---gatgctggtggaaggactgagggagacaaggccaact----------
A0A2U9BY16_BCL2L1-      ---gagcctccgaacaggactgatcggggggaggcaggtttgggggagga
                           **  *        ***  *   * *    **                

A0A2U9CJ81_MCL1-01      -aagcggcc--caagaacctccaggtctccgcaacg----aaggcgtacg
A0A2U9BIG9_BCL2L1-      -cagctgccagcaatggcttgttggtcgacgg--cggcaacaggtgcggt
A0A2U9BY16_BCL2L1-      acagcagacagcgccgcat-----gccaacggaactctaaacggcgtga-
                          *** * *  *            * *  **   *       ** *    

A0A2U9CJ81_MCL1-01      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggc
A0A2U9BIG9_BCL2L1-      cagctggggactgac----------ccgttgcccccg----------gac
A0A2U9BY16_BCL2L1-      -atcccgggaccccc----------ccagagtccccactgcggctgcaac
                           *   *  *   *          *    *   *              *

A0A2U9CJ81_MCL1-01      ggctctctgccctccaccccggagtcggacggcgagcacgacgtctccgg
A0A2U9BIG9_BCL2L1-      gg----t--------------ggcgtggg---------------------
A0A2U9BY16_BCL2L1-      gg----ttgccttcatcgccgagcctgga---------------------
                        **                        **                      

A0A2U9CJ81_MCL1-01      ttgtccggcggcggacgaggcgctggacagcttcaccagggaactcatta
A0A2U9BIG9_BCL2L1-      ------ggctgtgaaggaggcgct------------cagggactccgctc
A0A2U9BY16_BCL2L1-      ------tgcagtaaaagaggccct------------tcgggactcggcca
                               ** *   * ***** **              ****        

A0A2U9CJ81_MCL1-01      gccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgac
A0A2U9BIG9_BCL2L1-      atgagtt--tgaacagctct-----tcaaccaagcgttcagtgacc----
A0A2U9BY16_BCL2L1-      acgagtt--tgagctgcggt-----acgcgcgcgccttcagcgatc----
                           ****  ***    *  *      *   *   *   * * *  *    

A0A2U9CJ81_MCL1-01      agcaaagcgctgtccacgatgaagagagtggtggaccgactggtggagaa
A0A2U9BIG9_BCL2L1-      -------------------------------tctccctgcagctcgaca-
A0A2U9BY16_BCL2L1-      -------------------------------tgcacaaccagctgcaca-
                                                       *   *   * * *  * * 

A0A2U9CJ81_MCL1-01      gcacagatacgcatacaacggtatgatgaatagactgtccttggacaaca
A0A2U9BIG9_BCL2L1-      ------tcacccctgacacggcctaccaaag--------ctttaagagtg
A0A2U9BY16_BCL2L1-      ------tcacgccggccacggcctaccaaag--------cttcgagagtg
                                ** *     ****  *    **         ***  * *   

A0A2U9CJ81_MCL1-01      gaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggg
A0A2U9BIG9_BCL2L1-      tgatggacgaggtg------------------------------ttcaag
A0A2U9BY16_BCL2L1-      tgatgaacgaggtg------------------------------ttccgg
                          * * **** ***                              ***  *

A0A2U9CJ81_MCL1-01      gacggcaacacaaactggggccgcgtctccagcctggtggcgttcggggc
A0A2U9BIG9_BCL2L1-      gacggagtc---aactggggacgtatagtgggcctgttcgcttttggcgg
A0A2U9BY16_BCL2L1-      gacggcgtc---aactggggccgcatcatagggctttttgcatttggcgg
                        *****   *   ******** **  *     * **  * ** ** ** * 

A0A2U9CJ81_MCL1-01      cgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagc
A0A2U9BIG9_BCL2L1-      cgtgctgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgccc
A0A2U9BY16_BCL2L1-      ggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtgggca
                         * * ** **  * *       **** *   * * *       ** *   

A0A2U9CJ81_MCL1-01      tcgtcgggcaggagatctccacatacctgctgacggaccagcgagactgg
A0A2U9BIG9_BCL2L1-      gtatcgctgactggatgaccatgtacctggatgagcacatcagcccctgg
A0A2U9BY16_BCL2L1-      ggatcgttgagtggatgacggtgtacctagacaacaacatccagccctgg
                           ***   *   ***  *    *****        **        ****

A0A2U9CJ81_MCL1-01      ctggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagt
A0A2U9BIG9_BCL2L1-      atccagagccaaggaggctggggctgctttgcggagatttttgggcaagg
A0A2U9BY16_BCL2L1-      atccaaagtcaaggaggatgggagcactttgctgaaatcttcgggcagga
                         *    *   *       ****    *****  **  * **    *  * 

A0A2U9CJ81_MCL1-01      agcagacccagagacgacaa---------------tgaggaacacactga
A0A2U9BIG9_BCL2L1-      cgccggcgcagaagcaaggagatatcgggagagcgtgaggcgatggctg-
A0A2U9BY16_BCL2L1-      cgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctg-
                         ** *   ***        *               * * *      *** 

A0A2U9CJ81_MCL1-01      ttggccttgctggatttgctggtgttggggcgacactggccctgttgatc
A0A2U9BIG9_BCL2L1-      ctagttggagtggggatgctg--acaggagtgctgattgctatgttcatc
A0A2U9BY16_BCL2L1-      ctggcagggatgaccctggtg--accggggtcgtggtgggctcactgatt
                         * *      **    ** **     ** *      * *      * ** 

A0A2U9CJ81_MCL1-01      ag------------gtga
A0A2U9BIG9_BCL2L1-      gctaagaaaca---gtga
A0A2U9BY16_BCL2L1-      gcccagaagcgcctgtga
                                      ****

© 1998-2019