Dataset for CDS BCL-2 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3WZW9_BCL2-01      ------------------------------------------------atggctcaccct
G3WZW9_BCL2-02      ccatttggctgctctccttggtgttcactgctctctcctttgggaataatggctcaccct
                                                                    ************

G3WZW9_BCL2-01      ggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatca
G3WZW9_BCL2-02      ggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatca
                    ************************************************************

G3WZW9_BCL2-01      cagagagggtacgagtgggatgctggaaatctgaggacaccagcctctccaagtcttcct
G3WZW9_BCL2-02      cagagagggtacga----------------------------------------------
                    **************                                              

G3WZW9_BCL2-01      cctgttgttgcttctgcccctgctgttggaatcttctctaaccagccaagacatacacct
G3WZW9_BCL2-02      ------------------------------------------------------------
                                                                                

G3WZW9_BCL2-01      ctgcctgctgcaccccaggacttggccacttctactactgctgctgctagaaactcacct
G3WZW9_BCL2-02      ------------------------------------------------------------
                                                                                

G3WZW9_BCL2-01      ttgcctcctcctcctgctgttgctgctgctactgttgctgctggaccagctgtcagtcca
G3WZW9_BCL2-02      --------------------------------tgttgctgctggaccagctgtcagtcca
                                                    ****************************

G3WZW9_BCL2-01      gtgccacctgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatat
G3WZW9_BCL2-02      gtgccacctgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatat
                    ************************************************************

G3WZW9_BCL2-01      cgaagagatttcgatgaaatgtcaggtcagctgcacctgacccctgttactgctagggga
G3WZW9_BCL2-02      cgaagagatttcgatgaaatgtcaggtcagctgcacctgacccctgttactgctagggga
                    ************************************************************

G3WZW9_BCL2-01      cgctttgccacagtagtggaagagctgttcagggatggggtgaactgggggcggattgtg
G3WZW9_BCL2-02      cgctttgccacagtagtggaagagctgttcagggatggggtgaactgggggcggattgtg
                    ************************************************************

G3WZW9_BCL2-01      gccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcct
G3WZW9_BCL2-02      gccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcct
                    ************************************************************

G3WZW9_BCL2-01      ctggtggacagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactgg
G3WZW9_BCL2-02      ctggtggacagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactgg
                    ************************************************************

G3WZW9_BCL2-01      atccaggataacggaggatggggtaccaaagcaatttgcatgggcaccagtggtccattt
G3WZW9_BCL2-02      atccaggataacggaggatggg------------------tagg-----------tgttt
                    **********************                  * **             ***

G3WZW9_BCL2-01      caggtaagttaa
G3WZW9_BCL2-02      cggct-------
                    * * *       

© 1998-2018