Dataset for CDS BCL-2-like of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q0KFR9_MCL1-01        atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattt
B5XAY3_BCL2L1-01      atga---tgac--------ttaca------acaacagagaactgg-----
C0HAD8_BCL2L1-01      ---a---tgtc--------ttaca------gtaacagggaactgg-----
                         *   ** *        *****        ***   **  * *     

Q0KFR9_MCL1-01        tcaaaatggaggatcttcgtacctagctgatgatgctaggccgttgtact
B5XAY3_BCL2L1-01      ------tggtgtactatattaccta-------------------taaact
C0HAD8_BCL2L1-01      ------tggtgttttttataagcta-------------------tagact
                            *** *     *   * ***                   *  ***

Q0KFR9_MCL1-01        atttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaa
B5XAY3_BCL2L1-01      atcacagagggactaccccttcaaccacatggagctcacggaagcccaga
C0HAD8_BCL2L1-01      gtcccagaggaattattcatgttgtcaattggggctggagggtgcaagtg
                       *  *   **   *                **   *    *  *      

Q0KFR9_MCL1-01        gt-ggacttggg-aaatgggactggcgatactccaccacgacccacgacg
B5XAY3_BCL2L1-01      atcggactgagg----tgggacaggtg-----------------------
C0HAD8_BCL2L1-01      gacggactgagggagatgacgccattg-----------------------
                         *****  **    **   *    *                       

Q0KFR9_MCL1-01        ttaggagtgaatgtcgtgaaaagcaacggccttgataatcatttgtctga
B5XAY3_BCL2L1-01      -gaagggggtgcggcagtcctaaca-------------------------
C0HAD8_BCL2L1-01      -caaatgggtctgtggggaacagca-------------------------
                        *   * *   *        * **                         

Q0KFR9_MCL1-01        ccgaagcaacaatgacgactctttgccgtgcactccccagatgg------
B5XAY3_BCL2L1-01      --tacgtcaacgggacgagtcccgggactccaccacc---acggcagtcg
C0HAD8_BCL2L1-01      --gaag-caatttggcgaagccc------tcatctcc---acag------
                         * *  *    * ***  *         **   **   *  *      

Q0KFR9_MCL1-01        ---------------cgtcagaatgtgggcctgaactatcgaattgtcca
B5XAY3_BCL2L1-01      cccccctcctcccctcggcggacagcgggcctgga---------------
C0HAD8_BCL2L1-01      ------------------------gggggcatgga---------------
                                              * **** ** *               

Q0KFR9_MCL1-01        tcgggcgatgaagtattggaacatgataccagacaactcattgagaattt
B5XAY3_BCL2L1-01      ---cgcagtgaaa----gaggca---------------------------
C0HAD8_BCL2L1-01      ---gccagtgaaa----gcagca---------------------------
                           *  ****     *   **                           

Q0KFR9_MCL1-01        tttgggggactacacaggactgtctcagcctcgatggacgcaaagcaagc
B5XAY3_BCL2L1-01      -ttgcgggactctgccaacgagtttgagctgcgttatgcca---------
C0HAD8_BCL2L1-01      -ctacgggactcagtggatgagtttgagctgcgctacaccc---------
                        *  ******          ** * ***  ** *   *           

Q0KFR9_MCL1-01        ctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccga
B5XAY3_BCL2L1-01      --------------------------------------------------
C0HAD8_BCL2L1-01      --------------------------------------------------
                                                                        

Q0KFR9_MCL1-01        tacgcatacaatggtatggtcgccaaacttgacttggatgaccgatgcga
B5XAY3_BCL2L1-01      -gagcgttcagtgacctgtcctcccagctacac----atcacgccgtcca
C0HAD8_BCL2L1-01      -gcgccttcagtgacctctcctcccagctccac----atcacccctgcca
                         ** * ** **   *   * ** * **  **    ** **     * *

Q0KFR9_MCL1-01        tgacat----gggcgtcatcaattctgtggccaagaccatgttcagtgac
B5XAY3_BCL2L1-01      cagcctaccagagctttgagaacgtgatggacgag---gtgttccgggac
C0HAD8_BCL2L1-01      cagcctaccacagctttgagagtgtgatggacgaa---gtgttcagggac
                         * *      ** *    *      *** * *     ***** * ***

Q0KFR9_MCL1-01        gggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagt
B5XAY3_BCL2L1-01      ggtgtc---aactggggacgggtggtgggcctgttttccttcggaggggc
C0HAD8_BCL2L1-01      ggggtc---aactggggtcgcgtggtgggtctgtttgctttcggcggggc
                      **  **   ******** **  * *   * *** *  * ** ** *  * 

Q0KFR9_MCL1-01        ggtgagccagcacctgaaggagaggggcaggggacactgcgttgagttgg
B5XAY3_BCL2L1-01      cctctgt-----gtagaatgtgtggacaaggagatgaaccccttggtggg
C0HAD8_BCL2L1-01      cttgtgt-----gttgagtgtgttgagaaggatatgagcccactggtggc
                        *  *         **  * *  *   ***  *     *     ** * 

Q0KFR9_MCL1-01        tgggccaagagattgccaaatacctcctctctgaccaa-agtgactggct
B5XAY3_BCL2L1-01      aaggatcacagactg--gatgaccgtctacctggacaaccacatccagcc
C0HAD8_BCL2L1-01      gcgcatcgcagactg--gatgaccacctacctggacaaccatatccagcc
                        *      *** **   *  ***  **  ***  ***      *  ** 

Q0KFR9_MCL1-01        ---gatcaaaaacaa---tgcttggaatggatttgtagagttctttcatg
B5XAY3_BCL2L1-01      ctggatccagagccaaggaggatgggaccggtttgcagagatctttggaa
C0HAD8_BCL2L1-01      ctggatccagagccaaggaggatgggaccgttttgcagagatctttggca
                         **** * * * *    *  *** *  * **** **** *****    

Q0KFR9_MCL1-01        taca-----------agatcctgagtcctcagtaaggaacaccctcctag
B5XAY3_BCL2L1-01      tggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtgg
C0HAD8_BCL2L1-01      gagatgctgctgcagacgttcgacggtctcaggagagcataattaaatgg
                         *           *           ***** *  *          * *

Q0KFR9_MCL1-01        cctttgctggagttg----------ctggaattggggca---acactcgc
B5XAY3_BCL2L1-01      cttctggcagggatgaccctggtcacaggagtcgtcgtagggtcactctt
C0HAD8_BCL2L1-01      ctgctagttggggtgattctgctttcaggagtgctggtcggcactctcat
                      *   *    * * **          * *** *    *      * ***  

Q0KFR9_MCL1-01        catgttca---tcaggtga
B5XAY3_BCL2L1-01      cgctcagaaacgcctgtga
C0HAD8_BCL2L1-01      catgaagaaacgccagtga
                      *      *    *  ****

© 1998-2018