Dataset for CDS BCL2L1 of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B5XAY3_BCL2L1-01      atgatgacttacaacaacagagaactggtggtgtactatattacctataa
C0HAD8_BCL2L1-01      ---atgtcttacagtaacagggaactggtggtgttttttataagctatag
                         *** ******  ***** *************  * *** * ***** 

B5XAY3_BCL2L1-01      actatcacagagggactaccccttcaaccacatggagctcacggaagccc
C0HAD8_BCL2L1-01      actgtcccagaggaattattcatgttgtcaattggggctggagggtgcaa
                      *** ** ****** * **  * *     **  *** ***   **  **  

B5XAY3_BCL2L1-01      agaatcggactgagg----tgggacaggtggaagggggtgcggcagtcct
C0HAD8_BCL2L1-01      gtggacggactgagggagatgacgccattgcaaatgggtctgtggggaac
                           **********    **   *   ** **  ****  *   *    

B5XAY3_BCL2L1-01      aacatacgtcaacgggacgagtcccgggactccaccaccacggcagtcgc
C0HAD8_BCL2L1-01      agcagaag-caatttggcgaagccc------tcatctccacag-------
                      * ** * * ***   * ***  ***       ** * **** *       

B5XAY3_BCL2L1-01      ccccctcctcccctcggcggacagcgggcctggacgcagtgaaagaggca
C0HAD8_BCL2L1-01      -----------------------gggggcatggagccagtgaaagcagca
                                             * **** ****  *********  ***

B5XAY3_BCL2L1-01      ttgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcag
C0HAD8_BCL2L1-01      ctacgggactcagtggatgagtttgagctgcgctacacccgcgccttcag
                       * ******** *   * ************** **  ** * ** *****

B5XAY3_BCL2L1-01      tgacctgtcctcccagctacacatcacgccgtccacagcctaccagagct
C0HAD8_BCL2L1-01      tgacctctcctcccagctccacatcacccctgccacagcctaccacagct
                      ****** *********** ******** **  ************* ****

B5XAY3_BCL2L1-01      ttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgg
C0HAD8_BCL2L1-01      ttgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgc
                      ******  *********** ****** ******* *********** ** 

B5XAY3_BCL2L1-01      gtggtgggcctgttttccttcggaggggccctctgtgtagaatgtgtgga
C0HAD8_BCL2L1-01      gtggtgggtctgtttgctttcggcggggccttgtgtgttgagtgtgttga
                      ******** ****** * ***** ****** * ***** ** ***** **

B5XAY3_BCL2L1-01      caaggagatgaaccccttggtgggaaggatcacagactggatgaccgtct
C0HAD8_BCL2L1-01      gaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacct
                       ***** **** ***  ******   * *** **************  **

B5XAY3_BCL2L1-01      acctggacaaccacatccagccctggatccagagccaaggaggatgggac
C0HAD8_BCL2L1-01      acctggacaaccatatccagccctggatccagagccaaggaggatgggac
                      ************* ************************************

B5XAY3_BCL2L1-01      cggtttgcagagatctttggaatggacgctgcagccgagagcaggaagtc
C0HAD8_BCL2L1-01      cgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
                      ** ***************** *  ** ***** ** **     *   ***

B5XAY3_BCL2L1-01      tcaggagagctttaagaagtggcttctggcagggatgaccctggtcacag
C0HAD8_BCL2L1-01      tcaggagagcataattaaatggctgctagttggggtgattctgctttcag
                      ********** * *  ** ***** ** *  *** ***  *** *  ***

B5XAY3_BCL2L1-01      gagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
C0HAD8_BCL2L1-01      gagtgctggtcggcactctcatcatgaagaaacgccagtga
                      ****  * ** **  * *** **    ********* ****

© 1998-2018