Dataset for CDS BCL-2-like of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6TLM0_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6TLM0_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6TLM0_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6UEL3_BCL2-01      ---------------------------------atggcgcacgctgggag
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------------------------------atggcgacccc---agc
A0A2K6TM77_BCL2L2-      ---------------------------------atggcgacccc---agc
A0A2K6TM77_BCL2L2-      catctttcatccttgcctcttatagccgcccggatggcgacccc---agc
A0A2K6TIT7_BCL2L10      ---------------------------------atggctgaccc---gct
A0A2K6V5Y3_MCL1-02      ---------------------------------atgttcggcct----cc
A0A2K6V5Y3_MCL1-01      ---------------------------------atgttcggcct----cc
A0A2K6V5Y3_MCL1-03      ---------------------------------atgttcggcct----cc

A0A2K6TLM0_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6TLM0_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6TLM0_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6UEL3_BCL2-01      aacagggtacgataaccgggag---------atagtgatgaagtacatcc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      -atgtctcagagcaaccgggag---------ctggtggttgactttctct
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TIT7_BCL2L10      gcagcagcgcaccgagcag------------ctggtggcggactacctgg
A0A2K6V5Y3_MCL1-02      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg
A0A2K6V5Y3_MCL1-01      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg
A0A2K6V5Y3_MCL1-03      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg

A0A2K6TLM0_BCL2A1-      ggtatgtcctgcag------------------------------------
A0A2K6TLM0_BCL2A1-      ggtatgtcctgcag------------------------------------
A0A2K6TLM0_BCL2A1-      ggtatgtcctgcag------------------------------------
A0A2K6UEL3_BCL2-01      actataagctgtcgcagaggggctacgagtggga------------tgcc
A0A2K6UWY8_BCL2L1-      ---------------------------------------------atgtg
A0A2K6UWY8_BCL2L1-      cctacaagctttcccagaaaggatacagctggagtcagtttagtgatgtg
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtc-----------------tgtg
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtc-----------------tgtg
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtc-----------------tgtg
A0A2K6TIT7_BCL2L10      agtactgctcccgggagcccggcacccccgagtcgccacc----------
A0A2K6V5Y3_MCL1-02      ggggccggcagcggcggcgccacccccccgggagggcggcttct--ggcc
A0A2K6V5Y3_MCL1-01      ggggccggcagcggcggcgccacccccccgggagggcggcttct--ggcc
A0A2K6V5Y3_MCL1-03      ggggccggcagcggcggcgccacccccccgggagggcggcttct------

A0A2K6TLM0_BCL2A1-      ----------ataccacaatctggaacgggtccaa---gcaaa-------
A0A2K6TLM0_BCL2A1-      ----------ataccacaatctggaacgggtccaa---gcaaa-------
A0A2K6TLM0_BCL2A1-      ----------ataccacaatctggaacgggtccaa---gcaaa-------
A0A2K6UEL3_BCL2-01      ggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatctt
A0A2K6UWY8_BCL2L1-      gaagagaacaggactgaggccccagaagggactgattcggagatgg----
A0A2K6UWY8_BCL2L1-      gaagagaacaggactgaggccccagaagggactgattcggagatgg----
A0A2K6TM77_BCL2L2-      ga----------gct--ggccccggggagggccca---gcagct------
A0A2K6TM77_BCL2L2-      ga----------gct--ggccccggggagggccca---gcagct------
A0A2K6TM77_BCL2L2-      ga----------gct--ggccccggggagggccca---gcagct------
A0A2K6TIT7_BCL2L10      -----------ggccacggcc-----------------------------
A0A2K6V5Y3_MCL1-02      gcggagaaggaggcctcggcccagcgagaggtag----ggggaggg----
A0A2K6V5Y3_MCL1-01      gcggagaaggaggcctcggcccagcgagaggtag----ggggaggg----
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      -------------------------acgtccagagtacta----------
A0A2K6TLM0_BCL2A1-      -------------------------acgtccagagtacta----------
A0A2K6TLM0_BCL2A1-      -------------------------acgtccagagtacta----------
A0A2K6UEL3_BCL2-01      ctcctcccagcccgggcacacgcccggtcccgctgcgccc----------
A0A2K6UWY8_BCL2L1-      -------------------------agacccccagtgccatcaat-----
A0A2K6UWY8_BCL2L1-      -------------------------agacccccagtgccatcaatggcaa
A0A2K6TM77_BCL2L2-      --------------------------gacccgctgcacca----------
A0A2K6TM77_BCL2L2-      --------------------------gacccgctgcacca----------
A0A2K6TM77_BCL2L2-      --------------------------gacccgctgcacca----------
A0A2K6TIT7_BCL2L10      -------------------------gaggccgctgtgctg----------
A0A2K6V5Y3_MCL1-02      -------------------------gaggccggcgcggtg----------
A0A2K6V5Y3_MCL1-01      -------------------------gaggccggcgcggtg----------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ----cgggaccctgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnn
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      cccagcctggcacctggcggacagccccgcggtgaatggagccacgggcc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      -----------------------------------caaaaggttgcattc
A0A2K6TLM0_BCL2A1-      -----------------------------------caaaaggttgcattc
A0A2K6TLM0_BCL2A1-      -----------------------------------caaaaggttgcattc
A0A2K6UEL3_BCL2-01      nnnnnnnnnnnnnnnnnnnnnnnnncagcccagtgccacctgtggtccac
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      acagcagcagtttggatgcccgggaggtgatccccatggcagcaataaag
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-02      -------------------------------attggcggaagcgccggcg
A0A2K6V5Y3_MCL1-01      -------------------------------attggcggaagcgccggcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      tcagtccaaaaggaagtggaa-----gagagtctgaagccatgcttggac
A0A2K6TLM0_BCL2A1-      tcagtccaaaaggaagtggaa-----gagagtctgaagccatgcttggac
A0A2K6TLM0_BCL2A1-      tcagtccaaaaggaagtggaa-----gagagtctgaagccatgcttggac
A0A2K6UEL3_BCL2-01      ctgaccctccgccaggccggc-----gacgacttctcccgccgct--atc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      caagcactgagggaggcaggc-----gacgagtttgaactgcggt--acc
A0A2K6TM77_BCL2L2-      --agcaatgcgggcagctgga-----gatgagttcgagacccgct--tcc
A0A2K6TM77_BCL2L2-      --agcaatgcgggcagctgga-----gatgagttcgagacccgct--tcc
A0A2K6TM77_BCL2L2-      --agcaatgcgggcagctgga-----gatgagttcgagacccgct--tcc
A0A2K6TIT7_BCL2L10      --cgcgccacggccgcc---------gttgtacggaaactc---t--acc
A0A2K6V5Y3_MCL1-02      ctagccctccggccgccctgacgcctgacgcccggagggtcgtgc--ggc
A0A2K6V5Y3_MCL1-01      ctagccctccggccgccctgacgcctgacgcccggagggtcgtgc--ggc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      aacgttcatattgtgt--------------------------------cc
A0A2K6TLM0_BCL2A1-      aacgttcatattgtgt--------------------------------cc
A0A2K6TLM0_BCL2A1-      aacgttcatattgtgt--------------------------------cc
A0A2K6UEL3_BCL2-01      gccgcgacttcgccga-------gatgtccagccagctgcacctgacgcc
A0A2K6UWY8_BCL2L1-      -----------------------------------gctccacatcacccc
A0A2K6UWY8_BCL2L1-      ggcgggcatttagtga-------cctgacatcccagctccacatcacccc
A0A2K6TM77_BCL2L2-      ggcgcaccttctctga-------tctggcggctcagctgcatgtgacccc
A0A2K6TM77_BCL2L2-      ggcgcaccttctctga-------tctggcggctcagctgcatgtgacccc
A0A2K6TM77_BCL2L2-      ggcgcaccttctctga-------tctggcggctcagctgcatgtgacccc
A0A2K6TIT7_BCL2L10      cgtccttcttctccgc--------------ttaccgcggc----tacccc
A0A2K6V5Y3_MCL1-02      cgccgcccattggcgccgaggtccccgacgtcaccgcgac----cccctc
A0A2K6V5Y3_MCL1-01      cgccgcccattggcgccgaggtccccgacgtcaccgcgac----cccctc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      atgg----------------------acaatgccagaacaatatt-----
A0A2K6TLM0_BCL2A1-      atgg----------------------acaatgccagaacaatatt-----
A0A2K6TLM0_BCL2A1-      atgg----------------------acaatgccagaacaatatt-----
A0A2K6UEL3_BCL2-01      cttc----------------------accgcgcggggacgctt-------
A0A2K6UWY8_BCL2L1-      cggg----------------------acagcgtatcaaagctt-------
A0A2K6UWY8_BCL2L1-      cggg----------------------acagcgtatcaaagctt-------
A0A2K6TM77_BCL2L2-      aggc----------------------tcagcccaacaacgctt-------
A0A2K6TM77_BCL2L2-      aggc----------------------tcagcccaacaacgctt-------
A0A2K6TM77_BCL2L2-      aggc----------------------tcagcccaacaacgctt-------
A0A2K6TIT7_BCL2L10      agga----------------------accgcgtcgagctggtggcgagga
A0A2K6V5Y3_MCL1-02      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggaggaga
A0A2K6V5Y3_MCL1-01      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggaggaga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      -------cagtcaagtgatggaaaaggaatttgaagatggcattattaac
A0A2K6TLM0_BCL2A1-      -------cagtcaagtgatggaaaaggaatttgaagatggcattattaac
A0A2K6TLM0_BCL2A1-      -------cagtcaagtgatggaaaaggaatttgaagatggcattattaac
A0A2K6UEL3_BCL2-01      -------tgccacggtggtggaggagctcttcagggacgg---ggtgaac
A0A2K6UWY8_BCL2L1-      -------tgaacaggtagtgaacgaactcttccgggatgg---ggtgaac
A0A2K6UWY8_BCL2L1-      -------tgaacaggtagtgaacgaactcttccgggatgg---ggtgaac
A0A2K6TM77_BCL2L2-      -------cacccaggtctccgatgaacttttccaaggggg---tcccaac
A0A2K6TM77_BCL2L2-      -------cacccaggtctccgatgaacttttccaaggggg---tcccaac
A0A2K6TM77_BCL2L2-      -------cacccaggtctccgatgaacttttccaaggggg---tcccaac
A0A2K6TIT7_BCL2L10      tggcggaggccttgctctccgacagtccc---------gg---tcccacc
A0A2K6V5Y3_MCL1-02      t---ggaagccccggccgccgacgccatc---------at---gtcgccc
A0A2K6V5Y3_MCL1-01      t---ggaagccccggccgccgacgccatc---------at---gtcgccc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      tggggaagaat----tgtaaccatatttgcatttgaaggta--ttctcat
A0A2K6TLM0_BCL2A1-      tggggaagaat----tgtaaccatatttgcatttgaaggta--ttctcat
A0A2K6TLM0_BCL2A1-      tggggaagaat----tgtaaccatatttgcatttgaaggta--ttctcat
A0A2K6UEL3_BCL2-01      tgggggaggat----tgtggccttctttgagttcggtgggg---------
A0A2K6UWY8_BCL2L1-      tggggtcgcat----tgtggcctttttctccttcggcgggg---------
A0A2K6UWY8_BCL2L1-      tggggtcgcat----tgtggcctttttctccttcggcgggg---------
A0A2K6TM77_BCL2L2-      tggggccgcct----tgtagccttctttgtctttggggctg---------
A0A2K6TM77_BCL2L2-      tggggccgcct----tgtagccttctttgtctttggggctg---------
A0A2K6TM77_BCL2L2-      tggggccgcct----tgtagccttctttgtctttggggctg---------
A0A2K6TIT7_BCL2L10      tggggcaacgt----ggtgatgctcctggccttcgcgggga---------
A0A2K6V5Y3_MCL1-02      gaagacgagctggacgggtacgagccggagcctctcgggaagcggccggc
A0A2K6V5Y3_MCL1-01      gaagacgagctggacgggtacgagccggagcctctcgggaagcggccggc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      caagaaacttctacgagagcgaattgccccggatgtggata---cttaca
A0A2K6TLM0_BCL2A1-      caagaaacttctacgagagcgaattgccccggatgtggata---cttaca
A0A2K6TLM0_BCL2A1-      caagaaacttctacgagagcgaattgccccggatgtggata---cttaca
A0A2K6UEL3_BCL2-01      --------tcatgtg------------------tgtggagagcgtcaacc
A0A2K6UWY8_BCL2L1-      --------cactgtg------------------cgtggaaagcgtagaca
A0A2K6UWY8_BCL2L1-      --------cactgtg------------------cgtggaaagcgtagaca
A0A2K6TM77_BCL2L2-      --------cactgtg------------------tgctgagagtgtcaaca
A0A2K6TM77_BCL2L2-      --------cactgtg------------------tgctgagagtgtcaaca
A0A2K6TM77_BCL2L2-      --------cactgtg------------------tgctgagagtgtcaaca
A0A2K6TIT7_BCL2L10      --------cgctgctagagag----ggggccgctggtgaccgcccggtgg
A0A2K6V5Y3_MCL1-02      tgtcctgcccctgctggagctggtcggggagcctggtcatggctccagta
A0A2K6V5Y3_MCL1-01      tgtcctgcccctgctggagctggtcggggagcctggtcatggctccagta
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      aggagatttcgtatt-----------------------------------
A0A2K6TLM0_BCL2A1-      aggagatttcgtatt-----------------------------------
A0A2K6TLM0_BCL2A1-      aggagatttcgtatt-----------------------------------
A0A2K6UEL3_BCL2-01      gggagatgtcgcccc--------------tggtggacaacatcgccctgt
A0A2K6UWY8_BCL2L1-      aggagatgcaagtat--------------tggtgagtcggatcgcagctt
A0A2K6UWY8_BCL2L1-      aggagatgcaagtat--------------tggtgagtcggatcgcagctt
A0A2K6TM77_BCL2L2-      aggagatggaaccac--------------tggtgggacaagtgcaggagt
A0A2K6TM77_BCL2L2-      aggagatggaaccac--------------tggtgggacaagtgcaggagt
A0A2K6TM77_BCL2L2-      aggagatggaaccac--------------tggtgggacaagtgcaggagt
A0A2K6TIT7_BCL2L10      aagaagtggggcttc--------cagtcgcggttgaaggagccggagggc
A0A2K6V5Y3_MCL1-02      cggacgggtcactcccctcgacgccgccgcccgcagaggaggaggaggac
A0A2K6V5Y3_MCL1-01      cggacgggtcactcccctcgacgccgccgcccgcagaggaggaggaggac
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      ---------------------------------ttgttgctgagttcata
A0A2K6TLM0_BCL2A1-      ---------------------------------ttgttgctgagttcata
A0A2K6TLM0_BCL2A1-      ---------------------------------ttgttgctgagttcata
A0A2K6UEL3_BCL2-01      gg---------------------------------atgaccgagtacctg
A0A2K6UWY8_BCL2L1-      gg---------------------------------atggccacttacctg
A0A2K6UWY8_BCL2L1-      gg---------------------------------atggccacttacctg
A0A2K6TM77_BCL2L2-      gg---------------------------------atggtggcctacctg
A0A2K6TM77_BCL2L2-      gg---------------------------------atggtggcctacctg
A0A2K6TM77_BCL2L2-      gg---------------------------------atggtggcctacctg
A0A2K6TIT7_BCL2L10      ga-----------cgtcgcccgggactgccagcgcctggtgggcttgctg
A0A2K6V5Y3_MCL1-02      gagttgtaccggcagtcgctggagattatc----tctcggtacctccggg
A0A2K6V5Y3_MCL1-01      gagttgtaccggcagtcgctggagattatc----tctcggtacctccggg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      atgaataacacaggagaatggataagacga-------------aacggag
A0A2K6TLM0_BCL2A1-      atgaataacacaggagaatggataagacga-------------aacggag
A0A2K6TLM0_BCL2A1-      atgaataacacaggagaatggataagacga-------------aacggag
A0A2K6UEL3_BCL2-01      aaccggcacctgcacacctggatccaggat-------------aacggag
A0A2K6UWY8_BCL2L1-      aatgaccacctagagccttggatccaggag-------------aacggcg
A0A2K6UWY8_BCL2L1-      aatgaccacctagagccttggatccaggag-------------aacggcg
A0A2K6TM77_BCL2L2-      gagacgcggctggccgactggatccacagc-------------agtgggg
A0A2K6TM77_BCL2L2-      gagacgcggctggccgactggatccacagc-------------agtgggg
A0A2K6TM77_BCL2L2-      gagacgcggctggccgactggatccacagc-------------agtgggg
A0A2K6TIT7_BCL2L10      agctcgcggctcgtggggcag-caccgtgcctggctggaggctcagggcg
A0A2K6V5Y3_MCL1-02      agcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggcc
A0A2K6V5Y3_MCL1-01      agcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggcc
A0A2K6V5Y3_MCL1-03      ----ggcgaccggcgccaaggacacaaagccaatgggcaggtccggggcc
                                            *                         **  

A0A2K6TLM0_BCL2A1-      gct-----ggggg---aa-------atggaacagtctcatg---------
A0A2K6TLM0_BCL2A1-      gct-----gggac-------------------------------------
A0A2K6TLM0_BCL2A1-      gct-----gggaa---aatggctttgtaaagaagtttgaac---------
A0A2K6UEL3_BCL2-01      gct-----gggat------gcctttgtggaactgtatggcc---------
A0A2K6UWY8_BCL2L1-      gct-----gggac------acttttgtggaactctatggaa---------
A0A2K6UWY8_BCL2L1-      gct-----gggac------acttttgtggaactctatggaa---------
A0A2K6TM77_BCL2L2-      gct-----gggagctggaagctatcaaagctcgagtcagggagatggagg
A0A2K6TM77_BCL2L2-      gct-----gggcg------gagttcacagctctatacgggg---------
A0A2K6TM77_BCL2L2-      gct-----gggcg------gagttcacagctctatacgggg---------
A0A2K6TIT7_BCL2L10      gctgggtgagcacgcggaggaggacgtggggcgggatggg----------
A0A2K6V5Y3_MCL1-02      gcc-agcaggaaggcgctggagaccctgcggcgggtcgggg---------
A0A2K6V5Y3_MCL1-01      gcc-agcaggaaggcgctggagaccctgcggcgggtcgggg---------
A0A2K6V5Y3_MCL1-03      gcc-agcaggaaggcgctggagaccctgcggcgggtcgggg---------
                        **       *                                        

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ------------------------------acaatg--------------
A0A2K6UWY8_BCL2L1-      ------------------------------acaatg--------------
A0A2K6TM77_BCL2L2-      aagaagctgagaagctaaaggaactacagaacgaggtagagaagcagatg
A0A2K6TM77_BCL2L2-      ------------------------------acgggg--------------
A0A2K6TM77_BCL2L2-      ------------------------------acgggg--------------
A0A2K6TIT7_BCL2L10      --------------------------------------------cacctg
A0A2K6V5Y3_MCL1-02      ------------------------------acggcgtgcagcgcaaccac
A0A2K6V5Y3_MCL1-01      ------------------------------acggcgtgcagcgcaaccac
A0A2K6V5Y3_MCL1-03      ------------------------------acggcgtgcagcgcaaccac

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      aatatgagtccacctccaggcaatgctggaccagtgatcatgtccattga
A0A2K6TM77_BCL2L2-      -------------------------------------------ccctgga
A0A2K6TM77_BCL2L2-      -------------------------------------------ccctgga
A0A2K6TIT7_BCL2L10      ggaagggcccgccagg----------------------------------
A0A2K6V5Y3_MCL1-02      gagacggccttccaa-----------------------------------
A0A2K6V5Y3_MCL1-01      gagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaaga
A0A2K6V5Y3_MCL1-03      gagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaaga

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------cagcagc-----------------------------------
A0A2K6UWY8_BCL2L1-      --------cagcagc-----------------------------------
A0A2K6TM77_BCL2L2-      ggagaagatggaggctgatgcccgttccatctatgttggcaatgtggact
A0A2K6TM77_BCL2L2-      ggaggcg-cggcgtctg---------------------------------
A0A2K6TM77_BCL2L2-      ggaggcg-cggcgtctg---------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cgatgtc-aaatctttgtctcgagtgatggtccatgttttcagcgacggc
A0A2K6V5Y3_MCL1-03      cgatgtc-aaatctttgtctcgagtgatggtccatgttttcagcgacggc

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ---------cgagagcagaaaggg--------------------------
A0A2K6UWY8_BCL2L1-      ---------cgagagcagaaaggg--------------------------
A0A2K6TM77_BCL2L2-      atggtgcaacagcagaagagctggaagctcactttcatggctgtggttca
A0A2K6TM77_BCL2L2-      ---------cgggaggggaactgg--------------------------
A0A2K6TM77_BCL2L2-      ---------cgggaggggaactgg--------------------------
A0A2K6TIT7_BCL2L10      ---------tggggtat--------------ttttctcctgtgcctat--
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gtaacaaactggggtaggattgtgactctcatttcttttggtgcctttgt
A0A2K6V5Y3_MCL1-03      gtaacaaactggggtaggattgtgactctcatttcttttggtgcctttgt

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattag
A0A2K6V5Y3_MCL1-03      ggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattag

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------ccagcatg----------------------
A0A2K6UWY8_BCL2L1-      --------------------ccaggagcgcttcaac--------------
A0A2K6UWY8_BCL2L1-      --------------------ccaggagcgcttcaac--------------
A0A2K6TM77_BCL2L2-      gtttgcatatatagagttctcagacaaagagtcag---------------
A0A2K6TM77_BCL2L2-      ----------------------------gcatcag---------------
A0A2K6TM77_BCL2L2-      ----------------------------gcatcag---------------
A0A2K6TIT7_BCL2L10      --taaatgacctcctactcgctggcatggagaaaac--------------
A0A2K6V5Y3_MCL1-02      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtt
A0A2K6V5Y3_MCL1-03      cagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtt

A0A2K6TLM0_BCL2A1-      --------------------------cttatgctag--------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------ctaaatctggc-------------
A0A2K6UEL3_BCL2-01      ------------cggcctctgtttgatttctcctggc-------------
A0A2K6UWY8_BCL2L1-      --------------cgctggttcctgacgggcatgac-------------
A0A2K6UWY8_BCL2L1-      --------------cgctggttcctgacgggcatgac-------------
A0A2K6TM77_BCL2L2-      ---------------------tgaggacttccttggccttagacgagtcc
A0A2K6TM77_BCL2L2-      ---------------------tgaggacagtgctgac-------------
A0A2K6TM77_BCL2L2-      ---------------------tgaggacagtgctgac-------------
A0A2K6TIT7_BCL2L10      ---------tgctggtcccggttt------tcctgtcatg----------
A0A2K6V5Y3_MCL1-02      --------------ggatgggtttgtggagttcttccatgtagaggatct
A0A2K6V5Y3_MCL1-01      aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggatct
A0A2K6V5Y3_MCL1-03      aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggatct

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ------tgtggccggcg---------------------------------
A0A2K6UWY8_BCL2L1-      ------tgtggccggcg---------------------------------
A0A2K6TM77_BCL2L2-      ctatttagaggacggcaaatcaaggttgactttaaggctttcatttattc
A0A2K6TM77_BCL2L2-      ------aggggccg------------------------------------
A0A2K6TM77_BCL2L2-      ------aggggccg------------------------------------
A0A2K6TIT7_BCL2L10      ----gttgttaacagca---------------------------------
A0A2K6V5Y3_MCL1-02      agaaggtggcatcagaa---------------------------------
A0A2K6V5Y3_MCL1-01      agaaggtggcatcagaa---------------------------------
A0A2K6V5Y3_MCL1-03      agaaggtggcatcagaa---------------------------------

A0A2K6TLM0_BCL2A1-      ------------------tggagtcagcgcagaagaagaagaaaatggct
A0A2K6TLM0_BCL2A1-      -----------------------------------------------cta
A0A2K6TLM0_BCL2A1-      -----tggatgacttttctagaagttacaggaaagatctgtgaaatgcta
A0A2K6UEL3_BCL2-01      -----tgtctctgaagactctgctcagcttggccctggtgggagcttgca
A0A2K6UWY8_BCL2L1-      -----tggttctgctgggctcact--------------------------
A0A2K6UWY8_BCL2L1-      -----tggttctgctgggctcact--------------------------
A0A2K6TM77_BCL2L2-      atctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A2K6TM77_BCL2L2-      -----tggcactgggggccct-------------------ggtaactgta
A0A2K6TM77_BCL2L2-      -----tggcactgggggccct-------------------ggtaactgta
A0A2K6TIT7_BCL2L10      -----gcattcatct-acttctggacacgat----aattaggagttttaa
A0A2K6V5Y3_MCL1-02      -----atgtgctgctggcttttgcaggtgttgctggagtaggag------
A0A2K6V5Y3_MCL1-01      -----atgtgctgctggcttttgcaggtgttgctggagtaggag------
A0A2K6V5Y3_MCL1-03      -----atgtgctgctggcttttgcaggtgttgctggagtaggag------

A0A2K6TLM0_BCL2A1-      tt------------------------------------------------
A0A2K6TLM0_BCL2A1-      tc------------------------------------------------
A0A2K6TLM0_BCL2A1-      tctctc--------------------------------------------
A0A2K6UEL3_BCL2-01      tcaccctgggtgccta----------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      caacagaccggggttttccacgagcccgctaccgcgcacggaccaccaac
A0A2K6TM77_BCL2L2-      ---------ggggcctt---------------------------------
A0A2K6TM77_BCL2L2-      ---------ggggcctt---------------------------------
A0A2K6TIT7_BCL2L10      aatttttagcccacttctgcct----------------------------
A0A2K6V5Y3_MCL1-02      ----------ctggtttggcat----------------------------
A0A2K6V5Y3_MCL1-01      ----------ctggtttggcat----------------------------
A0A2K6V5Y3_MCL1-03      ----------ctggtttggcat----------------------------

A0A2K6TLM0_BCL2A1-      -------------------------------------gtaa---------
A0A2K6TLM0_BCL2A1-      -------------------------------------gcaatag------
A0A2K6TLM0_BCL2A1-      --------------------------------ttgaagcaatactac---
A0A2K6UEL3_BCL2-01      --------------------------------tctgggccacaag-----
A0A2K6UWY8_BCL2L1-      --------------------------------ctttagtcggaaa-----
A0A2K6UWY8_BCL2L1-      --------------------------------ctttagtcggaaa-----
A0A2K6TM77_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
A0A2K6TM77_BCL2L2-      --------------------------------ttttgctagcaag-----
A0A2K6TM77_BCL2L2-      --------------------------------ttttgctagcaag-----
A0A2K6TIT7_BCL2L10      --------------------------------gcccaac----------t
A0A2K6V5Y3_MCL1-02      --------------------------------atctaataagatagcctt
A0A2K6V5Y3_MCL1-01      --------------------------------atctaataagatag----
A0A2K6V5Y3_MCL1-03      --------------------------------atctaataagatag----

A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      g-------------------------------------------------
A0A2K6V5Y3_MCL1-02      g-------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------

A0A2K6TLM0_BCL2A1-      -----
A0A2K6TLM0_BCL2A1-      -----
A0A2K6TLM0_BCL2A1-      --tga
A0A2K6UEL3_BCL2-01      --tga
A0A2K6UWY8_BCL2L1-      --tga
A0A2K6UWY8_BCL2L1-      --tga
A0A2K6TM77_BCL2L2-      actaa
A0A2K6TM77_BCL2L2-      --tga
A0A2K6TM77_BCL2L2-      --tga
A0A2K6TIT7_BCL2L10      --tga
A0A2K6V5Y3_MCL1-02      --taa
A0A2K6V5Y3_MCL1-01      -----
A0A2K6V5Y3_MCL1-03      -----

© 1998-2019