Dataset for CDS BCL2L2 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TM77_BCL2L2-      ---------------------------------atggcgaccccagcctc
A0A2K6TM77_BCL2L2-      catctttcatccttgcctcttatagccgcccggatggcgaccccagcctc
A0A2K6TM77_BCL2L2-      ---------------------------------atggcgaccccagcctc
                                                         *****************

A0A2K6TM77_BCL2L2-      agccccagacacacgggctctggtggcagactttgtaggttataagctga
A0A2K6TM77_BCL2L2-      agccccagacacacgggctctggtggcagactttgtaggttataagctga
A0A2K6TM77_BCL2L2-      agccccagacacacgggctctggtggcagactttgtaggttataagctga
                        **************************************************

A0A2K6TM77_BCL2L2-      ggcagaagggttatgtctgtggagctggccccggggagggcccagcagct
A0A2K6TM77_BCL2L2-      ggcagaagggttatgtctgtggagctggccccggggagggcccagcagct
A0A2K6TM77_BCL2L2-      ggcagaagggttatgtctgtggagctggccccggggagggcccagcagct
                        **************************************************

A0A2K6TM77_BCL2L2-      gacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccg
A0A2K6TM77_BCL2L2-      gacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccg
A0A2K6TM77_BCL2L2-      gacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccg
                        **************************************************

A0A2K6TM77_BCL2L2-      cttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccag
A0A2K6TM77_BCL2L2-      cttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccag
A0A2K6TM77_BCL2L2-      cttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccag
                        **************************************************

A0A2K6TM77_BCL2L2-      gctcagcccaacaacgcttcacccaggtctccgatgaacttttccaaggg
A0A2K6TM77_BCL2L2-      gctcagcccaacaacgcttcacccaggtctccgatgaacttttccaaggg
A0A2K6TM77_BCL2L2-      gctcagcccaacaacgcttcacccaggtctccgatgaacttttccaaggg
                        **************************************************

A0A2K6TM77_BCL2L2-      ggtcccaactggggccgccttgtagccttctttgtctttggggctgcact
A0A2K6TM77_BCL2L2-      ggtcccaactggggccgccttgtagccttctttgtctttggggctgcact
A0A2K6TM77_BCL2L2-      ggtcccaactggggccgccttgtagccttctttgtctttggggctgcact
                        **************************************************

A0A2K6TM77_BCL2L2-      gtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
A0A2K6TM77_BCL2L2-      gtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
A0A2K6TM77_BCL2L2-      gtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
                        **************************************************

A0A2K6TM77_BCL2L2-      aggagtggatggtggcctacctggagacgcggctggccgactggatccac
A0A2K6TM77_BCL2L2-      aggagtggatggtggcctacctggagacgcggctggccgactggatccac
A0A2K6TM77_BCL2L2-      aggagtggatggtggcctacctggagacgcggctggccgactggatccac
                        **************************************************

A0A2K6TM77_BCL2L2-      agcagtgggggctgggagctggaagctatcaaagctcgagtcagggagat
A0A2K6TM77_BCL2L2-      agcagtgggggctgggcg------gagttcacagctctatacgggg----
A0A2K6TM77_BCL2L2-      agcagtgggggctgggcg------gagttcacagctctatacgggg----
                        **************** *      *   *** ***** *  * ***    

A0A2K6TM77_BCL2L2-      ggaggaagaagctgagaagctaaaggaactacagaacgaggtagagaagc
A0A2K6TM77_BCL2L2-      -----------------------------------acgggg---------
A0A2K6TM77_BCL2L2-      -----------------------------------acgggg---------
                                                           *** **         

A0A2K6TM77_BCL2L2-      agatgaatatgagtccacctccaggcaatgctggaccagtgatcatgtcc
A0A2K6TM77_BCL2L2-      ------------------------------------------------cc
A0A2K6TM77_BCL2L2-      ------------------------------------------------cc
                                                                        **

A0A2K6TM77_BCL2L2-      attgaggagaagatggaggctgatgcccgttccatctatgttggcaatgt
A0A2K6TM77_BCL2L2-      ctggaggaggcg-cggcgtctg----------------------------
A0A2K6TM77_BCL2L2-      ctggaggaggcg-cggcgtctg----------------------------
                         * ******  *  ** * ***                            

A0A2K6TM77_BCL2L2-      ggactatggtgcaacagcagaagagctggaagctcactttcatggctgtg
A0A2K6TM77_BCL2L2-      --------------cgggaggggaactgg---------------------
A0A2K6TM77_BCL2L2-      --------------cgggaggggaactgg---------------------
                                      * * **  ** ****                     

A0A2K6TM77_BCL2L2-      gttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatccc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6TM77_BCL2L2-      aaagggtttgcatatatagagttctcagacaaagagtcagtgaggacttc
A0A2K6TM77_BCL2L2-      ---------------------------------gcatcagtgaggacagt
A0A2K6TM77_BCL2L2-      ---------------------------------gcatcagtgaggacagt
                                                         *  ***********   

A0A2K6TM77_BCL2L2-      cttggccttagacgagtccctatttagaggacggcaaatcaaggttgact
A0A2K6TM77_BCL2L2-      gctgac-------------------aggggccg-----------------
A0A2K6TM77_BCL2L2-      gctgac-------------------aggggccg-----------------
                          ** *                   ** ** **                 

A0A2K6TM77_BCL2L2-      ttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaacc
A0A2K6TM77_BCL2L2-      ------------------------tggcactgggggccct----------
A0A2K6TM77_BCL2L2-      ------------------------tggcactgggggccct----------
                                                ** * * ** *  **           

A0A2K6TM77_BCL2L2-      aacagaccaggcatcagcacaacagaccggggttttccacgagcccgcta
A0A2K6TM77_BCL2L2-      ---------ggtaactgta---------ggggcctt--------------
A0A2K6TM77_BCL2L2-      ---------ggtaactgta---------ggggcctt--------------
                                 ** * * * *         ****  **              

A0A2K6TM77_BCL2L2-      ccgcgcacggaccaccaactacaacagttcccgctctcgattctacagtg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6TM77_BCL2L2-      gttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcg
A0A2K6TM77_BCL2L2-      -ttttgctagcaag------------------------------------
A0A2K6TM77_BCL2L2-      -ttttgctagcaag------------------------------------
                         ****   **** *                                    

A0A2K6TM77_BCL2L2-      acatcatggtattccccttactaa
A0A2K6TM77_BCL2L2-      ---------------------tga
A0A2K6TM77_BCL2L2-      ---------------------tga
                                             * *

© 1998-2018