Dataset for CDS BCL2A1 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TLM0_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactcaggactatct
A0A2K6TLM0_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactcaggactatct
A0A2K6TLM0_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactcaggactatct
                        **************************************************

A0A2K6TLM0_BCL2A1-      gcggtatgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
A0A2K6TLM0_BCL2A1-      gcggtatgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
A0A2K6TLM0_BCL2A1-      gcggtatgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
                        **************************************************

A0A2K6TLM0_BCL2A1-      ccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagag
A0A2K6TLM0_BCL2A1-      ccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagag
A0A2K6TLM0_BCL2A1-      ccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagag
                        **************************************************

A0A2K6TLM0_BCL2A1-      agtctgaagccatgcttggacaacgttcatattgtgtccatggacaatgc
A0A2K6TLM0_BCL2A1-      agtctgaagccatgcttggacaacgttcatattgtgtccatggacaatgc
A0A2K6TLM0_BCL2A1-      agtctgaagccatgcttggacaacgttcatattgtgtccatggacaatgc
                        **************************************************

A0A2K6TLM0_BCL2A1-      cagaacaatattcagtcaagtgatggaaaaggaatttgaagatggcatta
A0A2K6TLM0_BCL2A1-      cagaacaatattcagtcaagtgatggaaaaggaatttgaagatggcatta
A0A2K6TLM0_BCL2A1-      cagaacaatattcagtcaagtgatggaaaaggaatttgaagatggcatta
                        **************************************************

A0A2K6TLM0_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6TLM0_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6TLM0_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                        **************************************************

A0A2K6TLM0_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
A0A2K6TLM0_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
A0A2K6TLM0_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
                        **************************************************

A0A2K6TLM0_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
A0A2K6TLM0_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
A0A2K6TLM0_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
                        **************************************************

A0A2K6TLM0_BCL2A1-      taagacgaaacggaggctgggggaa-------atggaacagtctcatgct
A0A2K6TLM0_BCL2A1-      taagacgaaacggaggctgggaaaatggctttgtaaagaagtttgaacct
A0A2K6TLM0_BCL2A1-      taagacgaaacggaggctgggac---------------------------
                        *********************                             

A0A2K6TLM0_BCL2A1-      tatgctag--------------tggagtcagcgcagaagaagaagaaaat
A0A2K6TLM0_BCL2A1-      aaatctggctggatgacttttctagaagttacaggaaagatctgtgaaat
A0A2K6TLM0_BCL2A1-      --------------------------------------------------
                                                                          

A0A2K6TLM0_BCL2A1-      ggcttt---------gtaa---------
A0A2K6TLM0_BCL2A1-      gctatctctcttgaagcaatactactga
A0A2K6TLM0_BCL2A1-      -ctatc---------gcaatag------
                            *          * **         

© 1998-2018